RNAi Targeting CXCR4 Inhibits Tumor Growth Through Inducing Cell Cycle Arrest and Apoptosis
|
|
- Amy Wilkerson
- 5 years ago
- Views:
Transcription
1 originl rtile RNAi Trgeting CXCR4 Inhiits Tumor Growth Through Induing Cell Cyle Arrest nd Apoptosis To Yu 1,2, Yingying Wu 2, Yi Hung 1,2, Chorn Yn 1, Ying Liu 1, Zongsheng Wng 3, Xioyi Wng 1, Yuming Wen 1, Chngmei Wng 1 nd Longjing Li 1,2 1 Deprtment of Hed nd Nek Onology Surgery, West Chin College of Stomtology, Sihun University, Sihun, People s Repuli of Chin; 2 Stte Key Lortory of Orl Diseses, West Chin College of Stomtology, Sihun University, Sihun, People s Repuli of Chin; 3 Deprtment of Stomtology, Wendeng Centrl Hospitl of Weihi, Shndong, People s Repuli of Chin. CXC hemokine reeptor 4 (CXCR4) is involved in mny humn mlignnt tumors nd plys n importnt role in tumor growth nd metstsis. To explore the effets of CXCR4 expression on the mlignnt ells of orl squmous ell rinom (OSCC), T8113 nd ell lines, s well s their xenogrft models, of nude mie were used to detet ner ell prolifertion ltertion. This study lso exmined the orresponding moleulr mehnism fter CXCR4 knokdown using reominnt lentivirl vetor expressing smll interferene RNA (sirna) for CXCR4. RNA interferene-medited knokdown of CXCR4 in highly ggressive (T8113 nd ) tumor ells signifintly inhiited the prolifertion of the two ell lines in vitro nd in vivo. The expression levels of >1,5 genes involved in ell yle, poptosis, nd multiple signling pthwys were lso ltered. These results provide new evidene of CXCR4 s promising tumor gene therpeuti trget. Reeived 31 July 211; epted 29 Otoer 211; pulished online 22 Novemer 211. doi:1.138/mt INTRODUCTION Squmous ell rinom is the most ommon mlignnt tumor of the orl vity. Despite dvnes in hemotherpy, rdiotherpy, nd surgil therpy over the lst two dedes, the 5-yer survivl rte for ptients with orl squmous ell rinom (OSCC) is still poor (~5%). 1 Lol nd/or regionl tumor reurrene develops in pproximtely one-third of ptients, despite definitive tretment. Ptients with reurrent OSCC tht is refrtory to hemotherpy nd/or rdition therpy hve medin life expetny of severl months, nd the response rte to seond- or third-line hemotherpeuti regimens is ~15%. 2 Two-thirds of ptients dying of this disese hve no evidene of symptomti distnt metstses. Therefore, lol nd regionl disese ontrol is n urgent need for more effetive therpies. Chemokines, superfmily of smll ytokine-like proteins, n ind to nd tivte fmily of seven trnsmemrne G-proteinoupled reeptors, the hemokine reeptors. CXC hemokine reeptor 4 (CXCR4) nd its lignd stroml ell derived ftor-1 (SDF-1), lso known s CXCL12, hve een implited in mny mlignnies. 3 The CXCL12/CXCR4 xis is involved in severl spets of tumor progression inluding ngiogenesis, metstsis, nd survivl. 4 7 Müller et l. identified tht CXCR4 is ommonly elevted in mlignnt versus norml mmmry epithelil ell lines. Bloking ntiody to CXCR4 inhiited metstsis in mouse xenogrft model using MDA-MB-231 humn rest ner ells. 8 In ddition to rest ner, CXCR4 is lso deteted in mlignnies of the ovry, prostte, olon, hed nd nek, lung, pnres, rin, nd ldder. 6,9 The funtionl role of CXCR4 in tumor metstsis ws demonstrted in multiple studies using low-moleulr-weight inhiitory peptides or neutrlizing ntiody direted to CXCR4, whih showed tht inhiiting CXCR4 tivity redued tumor ell migrtion nd metstsis in vitro nd in vivo. 8,1,11 Uhid et l. identified tht the lokde of CXCR4 inhiited lymph node metstsis in B88 OSCC ells through shrna nd the AMD3, CXCR4 ntgonist. After orthotopilly inoulting OSCC ells into the msseter musle of nude mie, lymph node metstses, loss in ody weight, nd tumor volumes were signifintly inhiited in mie inoulted with shcxcr4-17 ells ompred with mie inoulted with ontrol ells. 12 Aside from supporting metstsis, CXCL12 nd its reeptor CXCR4 diretly ffets the prolifertion of tumor ells. Ovrin rinom nd non-hodgkin s lymphom ells n grow very well in vitro in the presene of CXCL12. Moreover, this proprolifertive effet is loked with TN13, speifi ntgonist of CXCR4. 11 Smll moleulr inhiitors of CXCR4, suh s plerixfor, TN13, or BKT14, re eing investigted in vrious ner settings. Inhiition of CXCR4 with plerixfor hs shown utility y filitting moiliztion of hemtopoieti stem ells (HSCs) for utologous trnsplnt in non-hodgkin s lymphom nd multiple myelom. 13 However, there re some potentil side effets of CXCR4 ntgonists. The long-term inhiition of the CXCR4-CXCL12 xis would potentilly expose ptients to risks of immune system nd hemtopoieti dysfuntions. 14 The use of CXCR4 ntgonists in ner ptients my lso use the moiliztion of norml progenitor ells, suh s hemtopoieti stem ells, from their miroenvironments to the lood. Moilized hemtopoieti stem ells tht re normlly proteted in mrrow nihes would e exposed to the effets of ytotoxi drugs in trils The first two uthors ontriuted eqully to this work. Correspondene: Longjing Li, Deprtment of Hed nd Nek Onology Surgery, West Chin College of Stomtology, Sihun University, No.14, Se.3, Renminnn Rod, Chengdu 641, Sihun, People s Repuli of Chin. E-mil: muzili63@163.om vol. 2 no. 2, fe. 212
2 where CXCR4 ntgonists re dministered long with ytotoxi drugs, whih ould result in prolonged ytopenis. 15 Therefore, seeking sfe nd effetive therpeuti method is n urgent tsk for ner therpy. In reent yers, RNA interferene (RNAi), powerful gene-silening tehnology with high effiieny nd speifiity s well s low toxiity, hs een widely used for silening mlignnt ellulr nd virl genes. 16,17 This tehnique provides gret promise in the field of ner therpy. This study shows tht the CXCR4 expression is neessry for OSCC ells to eome prolifertive, nd inhiiting this expression using reominnt lentivirl vetor expressing smll interferene RNA (sirna) for CXCR4 n indue tumor growth inhiition in vivo. Furthermore, CXCR4 expression is identified to promote ner ell prolifertion y ltering the expression of >1,5 genes involved in ell yle, poptosis, nd multiple signling pthwys using mirorry nlysis tehnology. RESULTS CXCR4 expression is inresed in multiple OSCC tumors nd ell lines The CXCR4 expression ws exmined using rel-time polymerse hin retion (RT-PCR) in five mthed norml nd OSCC iopsies s well s in OSCC ell lines, inluding T8113, SCC-4, nd ell lines. The results show tht CXCR4 mrna levels inresed more thn tenfold in OSCC tumors from ptients 1 4 ompred with their mthed norml tissues. Additionlly, the CXCR4 mrna levels in T8113 nd ell lines were pproximtely inresed fourfold ompred with the SCC-4 ell line. Therefore, T8113 nd ell lines were seleted for further studies (Figure 1,). Reltive CXCR4 mrna level 5 3 CXCR4 -tin Norml 1 Norml 1 Tumor 1 Norml 2 Tumor 2 Norml 3 Tumor 3 Norml 4 Tumor 4 Norml 5 Tumor 5 T8113 SCC-4 Norml Tumor Tumor 1 Norml 2 Tumor 2 Norml 3 Tumor 3 Norml 4 Tumor 4 Norml 5 Tumor 5 T8113 Ptient 1 Ptient 2 Ptient 3 Ptient 4 Ptient 5 SCC-4 Cell lines Figure 1 Elevted CXCR4 mrna expression in OSCC. () Trnsript levels of CXCR4 in five ptients with OSCC nd three OSCC ell lines (T8113, SCC-4, ). -tin loding ontrol is lso shown. () Quntittive nlysis of trnsript levels of CXCR4, reltive to -tin, determined y qrt-pcr nd ompred with SCC-4 ells. Error rs indite men ± SD, n = 3 experiments; P <.1. OSCC, orl squmous ell rinom; qrt-pcr, quntittive rel-time polymerse hin retion. Effets of CXCR4 reominnt vetor nd TN13 on the protein expression of CXCR4 in T8113 nd ells in vitro First, sirna reominnt vetor from two different CXCR4 sequenes (sirna1 or sirna2) were expressed in the highly mlignnt T8113 nd ell lines (Figure 2). To determine whether the reominnt vetors were trnsdued into the tumor ells, the green fluoresent protein (GFP) expression of T8113 nd ells in the, CXCR4-lentivirus 1 (CXCR4- LV1), nd CXCR4-lentivirus 2 (CXCR4-LV2) groups ws ssessed using flow ytometry. The results show tht the delivery effiieny of,, nd CXCR4-LV2 ws more thn 95%, nd no GFP expression ws oserved in the T8113 nd T8113 Reltive level (% of T8113) CXCR4 -tin 15 5 T8113 T8113 * TN13 TN13 d 15 Reltive level (% of ) 5 T8113 TN13 TN13 CXCR4-LV2 Figure 2 The inhiition of CXCR4 protein expression in OSCC ells treted with nd TN13. () T8113 nd tongue squmous ell rinom ells were trnsdued with (MOI = 5), CXCR4-LV2 (MOI = 5), nd (MOI = 5) for 72 hours nd were then photogrphed under n inverted fluoresene mirosope ( ). () After 5 μmol/l TN13 tretment for 8 hours nd trnsdution with nd for 72 hours in T8113 nd ells, CXCR4 protein levels were deteted using Western lot nlysis in the two ell lines. -tin loding ontrol is lso shown. () Densitometri nlysis of protein levels of CXCR4, reltive to -tin, determined y Western lot nd ompred with T8113 ells. (d) Densitometri nlysis of protein levels of CXCR4, reltive to -tin, determined y Western lot nd ompred with ells. Error rs indite men ± SD; n = 3 experiments; *P <.5; P <.1. OSCC, orl squmous ell rinom. * Moleulr Therpy vol. 2 no. 2 fe
3 groups, s expeted (Supplementry Figure S1). Then, the effets of different reominnt vetors nd TN13, the ntgonist of CXCR4, on CXCR4 expression were deteted. After (multipliity of infetion (MOI) = 5), CXCR4-LV2 (MOI = 5), nd (MOI = 5) trnsdution for 72 hours in T8113 nd ells, the expression of CXCR4 protein levels ws sustntilly redued y ~9% nd 8% in expressing T8113 nd ells, respetively, ompred with their prentl ells (Figure 2 d). However, the expression of CXCR4 protein ws sustntilly redued y ~2% nd 3% in CXCR4- LV2 expressing T8113 nd ells, respetively (dt not shown). Therefore, the vetor ws hosen for further study. Additionlly, the effet of TN13 on protein expression of CXCR4 ws tested. After 5 μmol/l TN13 tretment for 8 hours, the protein expression levels of CXCR4 ws sustntilly redued y ~6% in T8113 nd ells (Figure 2 d). Interestingly, TN13 (5 μmol/l) indued signifint redution of CXCR4 protein levels t 8 hours, ut the expression of CXCR4 ompletely reovered t 24 hours in T8113 ells nd 16 hours in ells (Supplementry Figure S2). Inhiition of CXCR4 expression promotes ell yle rrest nd poptosis of OSCC ells in vitro To detet the effets of CXCR4 knokdown nd TN13 on OSCC ell prolifertion nd poptosis, the ell yle distriution of ells treted with nd TN13 in T8113 nd ell lines were exmined. After 5 μmol/l TN13 tretment for 8 hours nd trnsdution with (MOI = 5) nd (MOI = 5) for 72 hours in T8113 nd ells, oth ell lines showed deresed umultion in S nd G 2 /M phses nd inresed umultion in the G 1 s well s su-g 1 phses. After 8 hours of TN13 tretment, the perentges of ells in the S phse deresed from ~32% to 14% in T8113 nd from 35% to 21% in ells. The perentges of ells in the G 2 /M phse deresed from ~23% to 1% in T8113 nd from 19% to 11% in ells. Conversely, the perentges of ells in su- G 1 phse inresed from ~4% to 21% in T8113 nd from 3% to 18% in ells. Interestingly, the perentges of ells in the G 1 phse inresed from ~4% to 54% in T8113 nd from 42% to 5% in ells. Similrly, for the two ell lines trnsdued with, the perentges of ells in the S phse deresed from ~32% to 11% in T8113 nd from 35% to 13% in ells. The perentges of ells in the G 2 /M phse deresed from ~23% to 8% in T8113 nd from 19% to 9% in ells. The perentges of ells in su-g 1 phse inresed from ~4% to 32% in T8113 nd from 3% to 28% in ells. The perentges of ells in G 1 phse inresed from ~4% to 48% in T8113 nd from 41% to 49% in ells (Figure 3 ). In ddition, the ell yle distriution of T8113 nd ells t different time points of TN13 tretment were exmined. At 24 hours fter TN13 tretment, the perentges of ells in the S phse were restored to 28% nd 32% in the T8113 nd ells, respetively. The perentges of ells in the G 2 /M phse were restored to 19% nd 17% in the T8113 nd ells, respetively, wheres those in the su-g 1 phse were 9% nd 7%, respetively. Finlly, the perentges of ells in G 1 phse were restored to 44% nd 43% in the T8113 nd ells, respetively (Supplementry Figure S3). These results suggest tht CXCR4 downregultion promotes OSCC ell poptosis. An Annexin V-FITC kit ws used to determine the perentge of ells tht underwent poptosis. After 5 μmol/l TN13 tretment for 8 hours, Annexin V/PI stining of T8113 nd ells showed tht ~35% nd ~33% of ells were Annexin V positive, respetively. Furthermore, fter trnsdution with (MOI = 5) nd (MOI = 5) in T8113 nd ells for 72 hours, T8113 nd ells showed tht ~51% nd ~48% of ells were Annexin V positive, respetively. These dt suggest tht the inhiitory effet on the protein expression of CXCR4 promotes T8113 nd ell poptosis (Figure 3d f). Inhiition of tumor ell prolifertion y RNAi-medited knokdown for CXCR4 in vitro nd in vivo CCK-8 nd plte olony formtion ssys were used to ssess the effet of CXCR4 knokdown on the prolifertion of OSCC ell lines in vitro. CXCR4 knokdown signifintly deresed the prolifertion nd olony formtion of T8113 nd ells (P <.5) (Figure 4 e). To investigte whether shrna trgeting CXCR4 used n inhiitory effet on preestlished tumor growth in nude mie, 36 nude mie were oserved nd mesured in 35-dy follow-up period. On dy 42, rpid inrese in the T8113 tumor volumes in the Mok (2,21 ± 458 mm 3 ) nd (1,965 ± 389 mm 3 ) groups ompred with tht in the (288 ± 85 mm 3 ) group (P <.1) ws oserved, nd the sme tendeny ws found in the tumors. The volume of tumors in the Mok (2,489 ± 587 mm 3 ) nd (2,367 ± 678 mm 3 ) groups ws signifintly inresed ompred with the (323 ± 78 mm 3 ) group (P <.1). However, there were no differenes in tumor size nd growth tendeny etween the Mok nd the groups either in T8113 or in tumors (Figure 5 ). To determine whether the vetors were trnsdued into tumor ells, GFP expression of tumor tissues ws ssessed y ounting 1 rndom fields of frozen setions under n inverted fluoresene mirosope (Figure 5d). This vetor independently expresses green fluoresent protein, filitting diret monitoring of the delivery effiieny of the gene-silening onstrut. The delivery effiieny in the nd groups ws ~7%, nd no GFP expression ws oserved in the Mok group, s expeted. Given tht the CXCR4 mrna levels in SCC-4 ells were omprle with tht of norml tissues (Figure 1), nd to further onfirm whether the oserved effets re used y downregultion of CXCR4 y shrna, SCC-4 ells were lso used s ontrol for simultneous in vitro nd in vivo experiments. CXCR4 downregultion did not inhiit SCC-4 ell prolifertion in vitro nd in vivo (Supplementry Figure S4). Additionlly, to onfirm whether the RNAi sequenes hve offtrget effets, fter trnsdution with (MOI = 5) nd (MOI = 5) in SCC-4 ells for 72 hours, the mrna levels of multiple genes identified y mirorry nlysis inluding CCND1, MAPK3, ERBB2, MMP9, MMP13, CDKN1A, TP53, CDKN1B, BRCA1, nd erythropoietin reeptor in SCC-4 ells were deteted. The results demonstrte tht SCC-4 ells trnsdued y nd do not ffet the mrna levels of these genes (Supplementry Figure S5). vol. 2 no. 2 fe. 212
4 3 T8113 M1 M2 M3 M4 M5 M1 M4 M2 M3 M5 15 Su-G1 G1 S G2/M , TN , TN M1 M2 M3 M4 M , M1 M4 M2 M3 M , 15 T8113 TN13 Su-G1 G1 S G2/M M1 M2 M3 M4 M5 M1 M2 M3 M4 M5 3 d PI , M1 M2 M3 M4 M5 T , TN TN Annexin V-FITC M1 M2 M3 M , M , e Annexin V positive ells (%) f Annexin V positive ells (%) TN13 T8113 TN13 TN13 Figure 3 Cell yle nd poptosis nlysis of T8113 nd ells whih were treted with nd TN13. () After 5 μmol/l TN13 tretment for 8 hours nd trnsdution with (MOI = 5) nd (MOI = 5) in T8113 nd ells for 72 hours, ell nulei were fixed, stined with PI, nd nlyzed y flow ytometry. Representtive histogrms re shown. () The frtions of T8113 ells in su-g1 (lk), G1 (2N; gry), S (white), nd G2 M (4N; spekled) re shown. () The frtions of ells in su-g1 (lk), G1 (2N; gry), S (white), nd G2 M (4N; spekled) re shown. Error rs indite men ± SD, n = 3 experiments. (d) Apoptosis ells were stined with Annexin V-FITC nd were nlyzed s desried in the text (see Mterils nd Methods). PI indites propidium iodide. (e) Quntittive nlysis of positive Annexin V T8113 ells in different groups. (f) Quntittive nlysis of positive Annexin V ells in different groups. Error rs indite men ± SD; n = 3 experiments; P <.1. CXCR4 knokdown promotes tumor ells poptosis nd Ki-67 protein expression in vivo To further onfirm whether CXCR4 downregultion n inhiit OSCC ell prolifertion in tumor tissues, the protein expression of CXCR4 nd prolifertion-relted gene Ki-67 were nlyzed y immunohistohemistry, nd the results show tht CXCR4 nd Ki-67 protein expression levels were weker in the CXCR4- LV1 group thn in the Mok nd groups (Figure 6,). The TUNEL ssy ws then used to evlute poptosis of tumor ells. The numer of poptoti ells ws signifintly inresed in tumors treted with ompred with those in the Mok nd groups (Figure 6 e). These results demonstrte tht CXCR4-speifi shrna n signifintly inhiit tumor growth nd promote tumor ell poptosis in vivo. Gene expression profile nlysis To investigte further the effets of CXCR4 knokdown in OSCC ells on downstrem trgets, gene expression profiling on T8113 nd ells expressing either or grown in ulture ws performed. Unsupervised lustering nlysis of Moleulr Therpy vol. 2 no. 2 fe
5 OD t 45 nm T8113 * OD t 45 nm Dy 1 Dy 2 Dy 3 Dy 4 Dy 5 Dy 1 Dy 2 Dy 3 Dy 4 Dy 5 T8113 d Numer of olonies 8 6 T8113 e Numer of olonies 5 3 Figure 4 CXCR4 knokdown deresed ell prolifertion of T8113 nd OSCC ells in vitro. (,) After (MOI = 5) nd (MOI = 5) trnsdution for 72 hours in T8113 nd ells, the numer of vile ells ws ssessed y CCK-8 ssy. () Representtive photogrphs of plte olony formtion of T8113 nd ells. (d,e) Quntittive nlysis of plte olony formtion of T8113 nd ells. Error rs indite men ± SD; n = 3 experiments; *P <.5; P <.1. OSCC, orl squmous ell rinom. 1,53 genes identified two groups of genes (trees 1 nd 2) tht signifintly hnged expression levels (y >twofold) fter CXCR4 downregultion in T8113 nd tumor ells. Tree 1 inluded 467 downregulted genes nd tree 2 ontined 289 upregulted genes on CXCR4 downregultion (Figure 7). Funtionl profiling of these genes reveled tht the gretest proportion of the genes ws ssoited with ell yle, followed y JAK/STAT signling, extrellulr mtrix (ECM) protein signling, poptosis, nd p53 signling. Quntittive RT-PCR ws performed to onfirm CXCR4-dependent expression of over 3 genes identified in the mirorry nlysis. Exept for PLAGL1 nd HOXB2 genes, the expression levels of the other 3 genes were onsistent with tht from the mirorry nlysis (Figure 7,). DISCUSSION In this study, RNAi-medited CXCR4 silening ould signifintly downregulte the protein levels of CXCR4 in OSCC ell lines nd their xenogrft model of nude mie. More importntly, CXCR4 knokdown signifintly promoted ell yle rrest nd poptosis of tumor ells nd inhiited tumor growth, resulting in the ltertion of expression of mny ell yle-, poptosis-, nd signling-relted genes. This phenomenon suggests tht CXCR4 is promising genetrgeting therpy for orl ner. Quntittive RT-PCR results show tht CXCR4 is overexpressed in severl different OSCC tumors nd ell lines, suggesting the potentil roles of this protein in OSCC progression. To onfirm the role of CXCR4 in OSCC, CXCR4 reominnt lentivirl vetor ws used nd speifi inhiitor of CXCR4, TN13, ws reruited to inhiit CXCR4 expression in T8113 nd ell lines. Cell yle plys n importnt role in ell prolifertion, differentition, nd tumor progression, regulted y intrellulr nd extrellulr signl trnsdution pthwy. 18 In this study, ells of phse G 1 signifintly inresed, nd ells of S nd G 2 /M phses signifintly deresed in ells treted with TN13 nd, suggesting tht CXCR4 downregultion ould indue phse G 1 rrest nd poptosis s well s inhiit tumor ell prolifertion. To onfirm the effets of CXCR4 expression on ell prolifertion, ner ell prolifertion nd olony formtion potentils were investigted. The finding tht CXCR4 knokdown led to signifint derese in the T8113 nd ell prolifertion nd olony formtion ws onsistent with mny previous reports, whih showed tht high levels of CXCR4 expression promoted OSCC ell prolifertion. 19,2 After onstruting the xenogrft tumor models using T8113 nd ells in nude mie, the tumor volume in the tretment group ws signifintly lower thn those in the Mok nd groups on dy 42. To detet the effets of CXCR4 expression on OSCC tumor growth 42 vol. 2 no. 2 fe. 212
6 Mok T8113 3, 2,5 2, 1,5 1, 5 Mok Tumor volume (mm 3 ) Mok Dy 7 Dy 14 Dy 21 Dy 28 Dy 35 Dy 42 d T8113 Mok Tumor volume (mm 3 ) 3, 2,5 2, 1,5 1, 5 Mok Dy 7 Dy 14 Dy 21 Dy 28 Dy 35 Dy 42 Mok Figure 5 Redued T8113 nd tumor volumes in nude mie injeted with. () After six-time injetion of sline solution (.1 ml), (.1 ml), nd (.1 ml), on dy 42, photogrphs of representtive mie nd tumors re shown. (,) Tumor size ws mesured using vernier liper nd tumor volume ws determined s desried in Mterils nd Methods setion for 42 dys. Eh dt point is the men vlue of five to six primry tumors. (d) GFP expression of tumor tissues trnsdued with nd. GFP expression of tumor tissues in different groups were oserved, ounted, nd photogrphed under n inverted fluoresene mirosope. Sle r = μm. Error rs indite men ± SD; P <.1. in vivo, the poptosis of T8113 nd ells with TUNEL ssy nd the Ki-67 protein expression with immunohistohemistry were exmined. The results show tht the numer of poptoti ells signifintly inresed nd Ki-67 protein expression signifintly deresed in tumors treted with ompred with those in the Mok nd groups. These dt indite tht RNAi-medited CXCR4 gene silening ould inhiit tumor growth nd indue poptosis of OSCC ells oth in vitro nd in vivo. Finlly, to identify the potentil moleulr mehnism of effets of CXCR4 downregultion on tumor growth inhiition, mirorry nlysis tehnology ws used to detet the gene expression profile of T8113 nd ells treted with CXCR4 reominnt lentivirl vetor nd ontrol lentivirl vetor. A totl of 1,53 genes with ltered expression levels (y >twofold) were identified. A totl of 467 genes were downregulted in T8113 nd ells treted with ompred with T8113 nd ells treted with 1, whih were minly involved in ell yle regultion, JAK/STAT signling, nd ECM protein regultion. In ddition, 289 genes were upregulted in T8113 nd ells treted with ompred with those treted with 1, whih were minly involved in poptosis, p53 signling, nd metstsis suppressor. Susequently, RT-PCR ws performed to onfirm the CXCR4-dependent expression of over 3 genes identified in the mirorry nlysis. The expression of mny genes is known to hve importnt role in tumor progression. CCND1, lso known s ylin D1, is overexpressed in mny humn tumors tht re indued y growth ftors nd our t multiple levels inluding inresed trnsription, trnsltion, nd protein stility. Cylin D1, kinse-independent funtion, plys importnt role for G 1 phse trnsition, y sequestering ylin-dependent kinses (Cdks) inhiitors suh s CDKN1A (p21) nd CDKN1B (p27) for effiient tivtion of CDK2-ontining omplexes. 25,26 Bsed on the study of p53 influene on poptosis nd ell yle, the expression of the key moleule of p53 pssge, p21, ws further onfirmed in n ttempt to explore the ssoited moleulr mehnism of CXCR4 on OSCC ells. p21 medites p53-dependent G 1 growth Moleulr Therpy vol. 2 no. 2 fe
7 d Numer of TUNEL-positive T8113 ells T8113 T8113 T Mok Mok Mok Mok Mok Mok Mok Figure 6 CXCR4 nd Ki-67 IHC s well s TUNEL ssy. () CXCR4- positive stining ws loted in the tumor nulei nd ytoplsm, nd more positive ells ould e seen in Mok nd ells thn tht in the T8113 nd ells. () Ki-67-positive stining ws loted in the tumor nulei, nd more positive ells ould e seen in the Mok nd ells thn those in the T8113 nd ells. () In the TUNEL ssy, positive ells were loted in the tumor nulei. (d) The numer of poptoti ells signifintly inresed in T8113 ells ompred with those in the Mok nd ells. (e) The numer of poptoti ells signifintly inresed in the ells ompred with those in the Mok nd ells. Sle r = 5 μm. Error rs indite men ± SD; P <.1 IHC, immunohistohemistry. rrest. 27 Erlier studies reported tht p21 suppresses tumor growth y promoting ell yle rrest in response to vrious stimuli. Sustntil evidene from iohemil nd geneti studies hs e Numer of TUNEL-positive ells Mok indited tht p21 ts s mster effetor of multiple tumor suppressor pthwys for promoting ntiprolifertive tivities tht were independent of the lssil p53 tumor suppressor pthwy. 28 p27 is n typil tumor suppressor tht regultes G to S phse trnsitions y inding to nd regulting the tivity of Cdks. 26,29 In G nd erly G 1 phses, p27 trnsltion nd protein stility re mximl, nd p27 inds, s well s inhiits, ylin E-CDK2. The progressive derese in p27 during G 1 phse llows ylin E-CDK2 nd ylin A-CDK2 to tivte the trnsription of genes tht re required for the G 1 S trnsition nd prtiipte in the initition of DNA replition. 3 Severl retrospetive multivrite studies in hed nd nek ners hve shown tht redued p27 is ssoited with n dverse outome. Redued p27 orrelted strongly with dvned disese stge nd inresed tumor size. 31,32 Bl-2 fmily funtions s life/deth swith tht integrtes diverse inter- nd intrellulr ues to determine whether the stress poptosis pthwy should e tivted. 33 p53 gene ould preisely regulte ell poptosis vi tivting the poptosis promoter of Bl-2 fmily, suh s x nd id, or inhiiting the ntipoptosis moleules, suh s Bl Additionlly, the following genes tht hve roles in tumor progression were lso nlyzed: β1,6 N-etylgluosminyltrnsferse V (MGAT5) nd CD44, 35,36 ell dhesion nd promote tumor invsion; trnsforming growth ftors β1 nd β2 (TGFB1, TGFB2), 37,38 stimulte invsion; mtrix metlloproteses 9 nd 13 (MMP9, MMP13), 9,39,4 degrde ECM nd promote metstsis; nd deltlike 1 (DLL1) nd ERBB2 (HER-2 or NEU), 41,42 Noth signling nd tumor growth. Notly, CXCR4 upregulted genes involved in JAK/STAT signling, suh s erythropoietin reeptor, s well s Jnus kinses 2 nd 3 (JAK2, JAK3), signl trnsduer nd tivtor of trnsriptions 5A nd 5B (STAT5A, STAT5B). Previous studies hve suggested role for erythropoietin/erythropoietin reeptor signling in the prolifertion nd survivl of ner ells. 43 The overexpression of erythropoietin n reruit JAK2 nd tivte STAT ftors, STAT5A nd STAT5B, leding to distint trnsriptionl regultion events to promote tumor quisition of ggressive phenotypes. 44,45 Additionlly, CXCR4 expression lso repressed the metstsis suppressor genes NM23 nd KAI1. 46 Tken together, in this study, CXCR4 knokdown signifintly deresed the tumor growth of OSCC through regulting downstrem ell yle, poptosis, nd multiple signling-relted genes. This study my provide new evidene for CXCR4 s promising gene therpeuti trget for ner. MATERIALS AND METHODS Cell lines nd regents., SCC-4, nd T8113 humn tongue squmous ell rinom ell lines were otined from ATCC nd Stte Key Lortory of Orl Diseses t Sihun University. The primry nd seondry ntiodies to humn CXCR4, Ki-67, nd β-tin were purhsed from Snt Cruz Biotehnology (Snt Cruz, CA). Cell prolifertion nd ytotoxiity ssy kits were from Dojindo Lortories (Tokyo, Jpn). Annexin V-FITC/PI Apoptosis kit ws purhsed from KeyGEN BioTECH (Nnjing, Chin). Constrution of lentivirl vetor for knokdown of humn CXCR4 expression. Two sirnas were designed sed on the CXCR4 sequene (NM_854): sirna 1: 5 -GGTGGTCTATGTTGGCGTCTG-3 or sirna 2: 5 -GGCAGTCCATGTCATCTAC-3. Oligonuleotides with sequene predited to indue effiient RNAi of CXCR4 (ontining 44 vol. 2 no. 2 fe. 212
8 CCNE1 SKP2 CXCL3 CDH11 LAMR1 MTSS1 MAP2K4 STAT5A RPS6KA5 ANGPTL4 PTX3 EML2 BCL-2 MALT1 WNT5A WNT7B DIXDC1 BAG1 TCF7L1 NOTCH2 DLLI DTX1 CFDP1 INHBA GSN EML2 BMP4 467 genes ITGA7 CASP1 CDKN1B CDKN2A CCL2 DEDD2 CASP8AP2 DAPK1 PDCD6 TNFRSF1B PRKCA FST PCBP4 EDG2 GRAP2 CDH4 MAGEB2 HOXB2 PLAC1 TRAIL NGFR PLAGL1 APAF1 MX1 SB 289 genes T8113 down non Cell yle CCND1, RPA3, SUM1, MCM3, et. JAK / STAT signling JAK2, IFNAR1, JAK3, SMAD3, et. MAPK signling MAPK1, MAPK3, MEF2C, MAPKAPK2, et. Chemokines nd reeptors CXCR4, EPHB2, CXCL12, FGFR4, et. Noth signling ERBB2, NR4A2, JAG1, et. ECM protein MMP13, AGTPBP1, MMP9, et. Cell dhesion MGAT5, MCAM, CD44, et. TGF- signling TGFB1, TGFB2, ACVR1, et. 5 Impt ftor 5 Impt ftor up Apoptosis CDKN1A, BAX, BRCA1, FOXO3, et. p53 signling TP53, FASLG, PCBP4, GML, et. Metstsis suppressor NM23, ABCC1, CDH1, KAI1, et. mtor signling PTEN, DDIT4, TSC2, et. Cytokines CD4, IL12A, PF4, et. Reltive level (% of ) Reltive level (% of ) CCND1 MCM3 MAPK3 MGAT5 CD44 CXCR4 BCL2 ERBB2 MMP13 TGFB1 MMPg JAK2 TGFB2 CDH11 DLL1 STAT5A CDH11 CCND1 MCM3 MAPK3 MGAT5 CD44 CXCR4 BCL2 ERBB2 MMP13 TGFB1 MMPg JAK2 TGFB2 T8113 EPOR JAK3 CDKN1A BAX FOXO3 TP53 BRCA1 CDKN1B NM23 KA11 ABCC1 PTEN CD4 HOXB2 TRAIL PLAGL1 DLL1 STAT5A EPOR JAK3 CDKN1A BAX FOXO3 TP53 BRCA1 CDKN1B NM23 KA11 ABCC1 PTEN CD4 HOXB2 TRAIL PLAGL1 Figure 7 Unsupervised lustering (Cluster 3. softwre) of differentilly expressed genes etween ontrol sirna nd CXCR4 sirna1 ells from oth T8113 nd ells. A totl of 467 CXCR4-tivted genes nd 289 CXCR4-repressed genes re mrked y doule-heded rrows. Representtive CXCR4-tivted (red) nd repressed genes (green) re listed either vertilly or under eh moleulr pthwy. Impt ftor strength of CXCR4-tivted (red rs) nd repressed (green rs) genes is shown. () Quntittive nlysis of trnsript levels of over 3 genes identified y mirorry nlysis, reltive to -tin, determined y qrt-pcr nd ompred with T8113 ells trnsdued with. () Quntittive nlysis of trnsript levels of over 3 genes identified y mirorry nlysis, reltive to -tin, determined y qrt-pcr nd ompred with ells trnsdued with. Error rs indite men ± SD; n = 3 experiments. qrt-pcr, quntittive rel-time polymerse hin retion sense nd ntisense sequenes) were synthesized (sirna 1 sense: 5 -GA TCCCGGGTGGTCTATGTTGGCGTCTGGAAGCTTGCAGACGCC AACATAGACCACCTTTTTT-3, ntisense: 5 -CTAGAAAAAAGGTGG TCTATGTTGGCGTCTGCAAGCTTCCAGACGCCAACATAGACCAC CCGG-3 ; sirna 2 sense: 5 -GATCCCGGGCAGTCCATGTCATCTACG AAGCTTGGTAGATGACATGGACTGCCTTTTTT-3, ntisense: 5 -CT AGAAAAAAGGCAGTCCATGTCATCTACCAAGCTTCGTAGAT GACATGGACTGCCCGG-3 ). These oligonuleotides were nneled in sodium hloride-tris-edta uffer t 94 C for 5 minutes nd ooled grdully. The doule-strnded produts were loned downstrem to the humn U6 promoter of the prnat/u6 vetor. The produts were designted s CXCR4-shRNA1 nd CXCR4-shRNA2. A ontrol vetor (NC-shRNA) ws onstruted (5 -GAAGCAGCACGACTTCTTC-3 ) with no signifint homology to ny mmmlin gene sequene nd, therefore, served s nonsilening ontrol. Different shrnas were sreened y otrnsfetion with humn CXCR4 DNA plsmid into 293 T ells with Lipofetmine LTX nd plus (Invitrogen, Crlsd, CA). The sequene of shrna ws then loned into plsmid pgcl-gfp, whih enodes n HIV-derived lentivirl vetor ontining multiple loning sites for insertion of shrna onstruts to e driven y n upstrem U6 promoter nd downstrem ytomeglovirus promoter-gfp fluoresent protein (mrker gene) ssette flnked y loxp sites. The resulting lentivirl vetor ontined two humn CXCR4 shrnas, nd CXCR4-LV2. A negtive ontrol lentivirl vetor ontining NC-shRNA ws onstruted y similr proess (). The reominnt lentivirus of sirna trgeting CXCR4, s well s the ontrol lentivirus, ws prepred nd titered to 1 9 trnsfetion units/ml. T8113, SCC-4, nd ells were infeted y the ddition of lentivirus into the ell ulture t n MOI of ~5. Cell ulture nd tretment. The ells were ultured t 37 C in 5% CO 2 in Duleo s modified Egle s medium (DMEM) ontining 1% fetl ovine serum (Gio, Rokville, MD), 2 mmol/l glutmine, 1 mmol/l sodium pyruvte, 1 mmol/l 4-(2-hydroxyethyl)-1-piperzineethnesulfoni id (HEPES), U/ml peniillin G, mg/ml streptomyin, nd 5 ng/ml SDF-1 (Sigm, St. Louis, MO). The ell lines were treted with TN13 (5 μmol/l) for 4, 8, 16, nd 24 hours. For trnsdution ssy, the ells were seeded onto 6-well plte with onentrtion of per well. After 24 hours, the ells were trnsdued in Opti-MEM I medium with lentivirl vetors in ordne with the mnufturer s instrutions. Cultured for nother 72 hours, fluoresene-tivted ell sorting ws performed for quntittion of infetion effiieny. Ptients. Five ptients with OSCC who reeived surgil tretment in the West Chin Hospitl of Stomtology, Sihun University, were rndomly hosen for this study. All ptients hd surgery s their first tretment nd did not undergo preopertive rdiotherpy nd hemotherpy. Moleulr Therpy vol. 2 no. 2 fe
9 Quntittive RT-PCR. Totl RNA ws isolted from frozen tumor tissue or ells with the TRIzol regent (Invitrogen, Rokville, MD). Totl RNA ws susequently reverse trnsried to DNA using the SuperSript First- Strnd Synthesis System (Invitrogen, Rokville, MD). Quntittive RT-PCR ws performed using the SYBR premix Ex Tq II Kit (Tkr, Kyoto, Jpn). Speifi primers re listed in Supplementry Tle S1. The omprtive threshold yle method ws used to lulte mplifition fold. β-tin gene ws used s referene ontrol gene to normlize the expression vlue of trget genes. Triple replites were performed for eh gene, nd the verge expression vlue ws omputed for susequent nlysis. The reltive expression level of the genes ws lulted using the 2 ΔΔCt method. 47 Western lot. The ells were lysed in lysis uffer (phosphte-uffered sline ontining 1% Triton X-, protese inhiitor oktil, nd 1 mmol/l phenylmethylsulfonyl fluoride) t 4 C for 3 minutes. Equl quntities of protein were sujeted to sodium dodeyl sulfte polyrylmide gel eletrophoresis (SDS-PAGE). After the trnsfer to immoilon-p trnsfer memrne, suessive inutions with nti-cxcr4 nd β-tin ntiody, s well s horserdish peroxidse-onjugted seondry ntiody, were onduted. Immunoretive proteins were then deteted using the enhned hemoluminesene (ECL) system. Bnds were snned using densitometer (GS-7; Bio-Rd, Herules, CA), nd quntifition ws performed using Quntity One softwre. Cell yle ssy. Cells (1 1 6 ) were otined from the pproprite smples, nd nulei were stined with propidium iodide. Flow ytometry ws performed using n FACSCliur (BD Biosienes, Sn Jose, CA), nd the frtion of ells in eh phse of ell yle ws determined using the ell yle nlysis pltform in the FlowJo softwre (Tree Str, Ashlnd, OR). Apoptosis ssy. Cells (1 1 6 ) were olleted, wshed, nd resuspended in phosphte-uffered sline, Annexin V-fluoresein isothioynte (FITC; 5 μl/ml). Then, propidium iodide (KeyGEN, Nnjing, Chin) ws dded nd the ells were inuted for 2 minutes t 4 C. Cells were nlyzed using FACSn flow ytometer (Beton Dikinson, Sn Jose, CA) with FlowJo softwre. The TUNEL ssy ws performed using In Situ Cell Deth Detetion Kit, POD (Rohe Applied Siene, Bsel, Switzerlnd), ording to the mnufturer s protool. The setions were oserved in right-field mirosope, nd the numer of poptoti ells in the tumor tissue in eh setion ws ounted in 1 different mirosopi fields. Cell prolifertion ssy. Cell prolifertion ssys were performed using Cell Counting Kit-8 (Dojindo, Kummoto, Jpn). Cells were plted in 96-well pltes t ells per well nd inuted for 5 dys. Ten miroliters of Cell Counting Assy Kit-8 solution ws dded to eh well dily. The ells were inuted for nother 2 hours. The vlue of optil density ws mesured t wvelength of 45 nm using miroplte reder (VARI OSKAN FLASH 31; Thermo, Mriett, OH). The mount of the formzn dye generted y the tivities of dehydrogenses in ells is diretly proportionl to the numer of living ells. Additionlly, the plte olony formtion ssy ws performed to evlute the olony formtion ility of tumor ells. The tumor ells were ultured t 1, ells/5 ml with DMEM medium nd 1% fetl ovine serum in 6-well plte. After 1 dys in ulture, the ells were fixed with methnol for 1 minutes nd stined with 1% rystl violet solution for 2 minutes to visulize olonies for ounting. Tumor xenogrfts model nd CXCR4 reominnt lentivirl vetor tretment. The onstrution of the tumor xenogrfts model ws onduted t the Lortory Animl Center of Sihun University (Chengdu, Chin). The niml experiment ws uthorized y West Chin Hospitl Ethis Committees. Fifty-four 4-week-old nude mie were red in n septi ondition. The nimls were kept t onstnt humidity nd temperture (25 28 C) with 12-hour light/drk yle. After 1 week of limtiztion,.1 ml of T8113, SCC-4, nd ell suspension t onentrtion of ells/ml ws suutneously injeted into the right lterl of xill region. Tumor xenogrfts were stged for 7 dys nd rehed ~15 mm 3 in size. Then, sme volumes (.1 ml) of sline solution (Mok), ontrol vetor (), nd CXCR4-speifi lentivirl vetor () were injeted into multiple sites intrtumorlly in three different groups, respetively, every 7 dys. The size of tumors ws mesured with vernier lipers, nd the volume of tumor ws determined using the simplified formul of rottionl ellipsoid (L W 2.5). On dy 42, mie were euthnized nd the tumors were removed for further study. Immunohistohemistry. Five-mirometer setions of formlin-fixed, prffin-emedded tissue were ut onto silnized glss slides, deprffinized in xylene, rehydrted in grded ethnol onentrtions (%, 95%, 7%, nd 5%), nd finlly sumerged in phosphte-uffered sline. The setions were loked for endogenous peroxidse with 3% hydrogen peroxide solution for 15 minutes nd pled in n utolve with.1 mol/l sodium itrte solution t 121 C for 3 minutes for ntigen retrievl. Setions were inuted with the CXCR4 nd Ki-67 primry ntiody overnight t 4 C nd then inuted with iotin-leled seondry ntiody t room temperture for 1 hour. Negtive ontrols were performed y repling the primry ntiody with phosphte-uffered sline. Diminoenzidine tetrhydrohloride ws used s hromogen. All setions were then ounterstined with hemtoxylin nd then oserved in right-field mirosope. Mirorry nlysis. The 44K Humn Genome Oligo Mirorry, inluding 44, 6-mer oligonuleotide proes representing 41, unique genes nd trnsripts, ws purhsed from Agilent Tehnologies (Plo Alto, CA). In rief, totl RNA from T8113 nd ells trnsdued with nd, respetively, were hrvested using TRIzol nd the RNesy kit (Qigen, Germny). The mplifition nd leling of 5 ng of totl RNA were performed ording to the Agilent Quik Amp leling kit s protool using Cy3. Hyridiztion ws performed for 16 hours t 5 C. After hyridiztion nd wshing, the proessed slides were snned with the Agilent DNA mirorry snner (prt numer G255B; Agilent, Snt Clr, CA). The resulting text files extrted from Agilent Feture Extrtion Softwre (version ) were imported into the Agilent GeneSpring GX softwre (version 1.) for further nlysis. To identify the differentilly expressed genes, fold-hnge sreening etween the two groups otined from the experiment ws performed. The threshold used to sreen up- or downregulte genes is fold hnge >2. Hierrhil lustering nd tree digrm were generted y Cluster 3. softwre. Sttistil nlysis. Dt re expressed s men ± SD (stndrd devition), when normlly distriuted. The sttistil signifine of differenes ws determined y Student s two-tiled t-test in two groups nd one wy ANOVA in multiple groups. Differenes t proility of less thn.5 were onsidered sttistilly signifint. All dt were nlyzed with SPSS 15. softwre. SUPPLEMENTARY MATERIAL Figure S1. GFP expression of T8113 nd ells trnsdued y reominnt retrovirl vetor. Figure S2. The CXCR4 protein expression in T8113 nd ells treted with TN13. Figure S3. Cell yle nlysis of T8113 nd ells whih were treted with CXCR4 ntgonist TN13. Figure S4. Inhiition of CXCR4 protein expression in SCC-4 ells treted with. Figure S5. Quntittive rel-time polymerse hin retion nlysis. Tle S1. Genes nd Primer Sequenes for the quntittive Rel-Time RT-PCR. ACKNOWLEDGMENTS We thnk Xioyu Li, Yurong Liu, nd Min Zhou from Stte Key Lortory of Orl Diseses, Sihun University for their tehnil ssistne. This projet ws supported y Ntionl Nturl Siene Foundtion of Chin (Grnt ) nd Dotorl Fund of Ministry of Edution of Chin (Grnt ). The uthors delre no onflit of interest vol. 2 no. 2 fe. 212
10 REFERENCES 1. Yu, T, Wng, XY, Gong, RG, Li, A, Yng, S, Co, YT et l. (9). The expression profile of mirornas in model of 7,12-dimethyl-enz[]nthrne-indued orl rinogenesis in Syrin hmster. J Exp Clin Cner Res 28: Xi, S nd Grndis, JR (3). Gene therpy for the tretment of orl squmous ell rinom. J Dent Res 82: Teiher, BA nd Friker, SP (21). CXCL12 (SDF-1)/CXCR4 pthwy in ner. Clin Cner Res 16: Brieri, F, Bjetto, A, Stumm, R, Pttrozzi, A, Porile, C, Zon, G et l. (8). Overexpression of stroml ell-derived ftor 1 nd its reeptor CXCR4 indues utorine/prrine ell prolifertion in humn pituitry denoms. Clin Cner Res 14: Gssmnn, P, Hier, J, Shlüter, K, Domikowsky, B, Wendel, C, Wiesner, U et l. (9). CXCR4 regultes the erly extrvstion of metstti tumor ells in vivo. Neoplsi 11: Sung, B, Jhurni, S, Ahn, KS, Mstuo, Y, Yi, T, Guh, S et l. (8). Zerumone downregultes hemokine reeptor CXCR4 expression leding to inhiition of CXCL12- indued invsion of rest nd pnreti tumor ells. Cner Res 68: Blkwill, F (4). Cner nd the hemokine network. Nt Rev Cner 4: Müller, A, Homey, B, Soto, H, Ge, N, Ctron, D, Buhnn, ME et l. (1). Involvement of hemokine reeptors in rest ner metstsis. Nture 41: Yu, T, Wu, Y, Helmn, JI, Wen, Y, Wng, C nd Li, L (211). CXCR4 promotes orl squmous ell rinom migrtion nd invsion through induing expression of MMP-9 nd MMP-13 vi the ERK signling pthwy. Mol Cner Res 9: Tmmur, H, Hori, A, Knzki, N, Hirmtsu, K, Mizumoto, M, Nkshim, H et l. (3). T14 nlogs s CXCR4 ntgonists identified s nti-metstti gents in the tretment of rest ner. FEBS Lett 55: Bertolini, F, Dell Agnol, C, Mnuso, P, Rsio, C, Burlini, A, Monestiroli, S et l. (2). CXCR4 neutrliztion, novel therpeuti pproh for non-hodgkin s lymphom. Cner Res 62: Uhid, D, Onoue, T, Kuriyshi, N, Tomizuk, Y, Tmtni, T, Ngi, H et l. (211). Blokde of CXCR4 in orl squmous ell rinom inhiits lymph node metstses. Eur J Cner 47: Burger, JA nd Peled, A (9). CXCR4 ntgonists: trgeting the miroenvironment in leukemi nd other ners. Leukemi 23: Allen, CD, Ansel, KM, Low, C, Lesley, R, Tmmur, H, Fujii, N et l. (4). Germinl enter drk nd light zone orgniztion is medited y CXCR4 nd CXCR5. Nt Immunol 5: Burger, JA nd Stewrt, DJ (9). CXCR4 hemokine reeptor ntgonists: perspetives in SCLC. Expert Opin Investig Drugs 18: Novin, CD nd Shrp, PA (4). The RNAi revolution. Nture 43: Msiero, M, Nrdo, G, Indrolo, S nd Fvro, E (7). RNA interferene: implitions for ner tretment. Mol Aspets Med 28: Peter, M nd Herskowitz, I (1994). Joining the omplex: ylin-dependent kinse inhiitory proteins nd the ell yle. Cell 79: Hong, JS, Pi, HK, Hong, KO, Kim, MA, Kim, JH, Lee, JI et l. (9). CXCR-4 knokdown y smll interfering RNA inhiits ell prolifertion nd invsion of orl squmous ell rinom ells. J Orl Pthol Med 38: Meng, X, Wuyi, L, Yuhong, X nd Xinming, C (21). Expression of CXCR4 in orl squmous ell rinom: orreltions with liniopthology nd pivotl role of prolifertion. J Orl Pthol Med 39: Jres, P, Colomer, D nd Cmpo, E (7). Geneti nd moleulr pthogenesis of mntle ell lymphom: perspetives for new trgeted therpeutis. Nt Rev Cner 7: Jin, M, Inoue, S, Umemur, T, Moriy, J, Arkw, M, Ngshim, K et l. (1). Cylin D1, p16 nd retinolstom gene produt expression s preditor for prognosis in non-smll ell lung ner t stges I nd II. Lung Cner 34: Brnes, DM nd Gillett, CE (1998). Cylin D1 in rest ner. Brest Cner Res Tret 52: Brtkov, J, Luks, J, Müller, H, Struss, M, Gusterson, B nd Brtek, J (1995). Anorml ptterns of D-type ylin expression nd G1 regultion in humn hed nd nek ner. Cner Res 55: Polyk, K, Kto, JY, Solomon, MJ, Sherr, CJ, Mssgue, J, Roerts, JM et l. (1994). p27kip1, ylin-cdk inhiitor, links trnsforming growth ftor-et nd ontt inhiition to ell yle rrest. Genes Dev 8: Sherr, CJ nd Roerts, JM (1999). CDK inhiitors: positive nd negtive regultors of G1-phse progression. Genes Dev 13: Deng, C, Zhng, P, Hrper, JW, Elledge, SJ nd Leder, P (1995). Mie lking p21cip1/waf1 undergo norml development, ut re defetive in G1 hekpoint ontrol. Cell 82: As, T nd Dutt, A (9). p21 in ner: intrite networks nd multiple tivities. Nt Rev Cner 9: Hengst, L nd Reed, SI (1998). Inhiitors of the Cip/Kip fmily. Curr Top Miroiol Immunol 227: Nigg, EA (1993). Trgets of ylin-dependent protein kinses. Curr Opin Cell Biol 5: Pruneri, G, Pigntro, L, Croni, N, Buff, R, Di Finizio, D, Cesn, BM et l. (1999). Clinil relevne of expression of the CIP/KIP ell-yle inhiitors p21 nd p27 in lryngel ner. J Clin Onol 17: Fujied, S, Inuzuk, M, Tnk, N, Sung, H, Fn, GK, Ito, T et l. (1999). Expression of p27 is ssoited with Bx expression nd spontneous poptosis in orl nd orophryngel rinom. Int J Cner 84: Adms, JM nd Cory, S (7). The Bl-2 poptoti swith in ner development nd therpy. Onogene 26: Hupt, S, Berger, M, Golderg, Z nd Hupt, Y (3). Apoptosis - the p53 network. J Cell Si 116(Pt 2): Lgn, A, Goetz, JG, Cheung, P, Rz, A, Dennis, JW nd Ni, IR (6). Gletin inding to Mgt5-modified N-glyns regultes fironetin mtrix remodeling in tumor ells. Mol Cell Biol 26: Muri, T, Mruym, Y, Mio, K, Nishiym, H, Sug, M nd Sto, C (211). Low holesterol triggers memrne mirodomin-dependent CD44 shedding nd suppresses tumor ell migrtion. J Biol Chem 286: Fu, H, Hu, Z, Wen, J, Wng, K nd Liu, Y (9). TGF-et promotes invsion nd metstsis of gstri ner ells y inresing fsin1 expression vi ERK nd JNK signl pthwys. At Biohim Biophys Sin (Shnghi) 41: Bumnn, F, Leukel, P, Doerfelt, A, Beier, CP, Dettmer, K, Oefner, PJ et l. (9). Ltte promotes gliom migrtion y TGF-et2-dependent regultion of mtrix metlloproteinse-2. Neuro-onology 11: Wng, X, Lu, H, Urvlek, AM, Li, T, Yu, L, Lmr, J et l. (211). KLF8 promotes humn rest ner ell invsion nd metstsis y trnsriptionl tivtion of MMP9. Onogene 3: Storz, P, Döppler, H, Coplnd, JA, Simpson, KJ nd Toker, A (9). FOXO3 promotes tumor ell invsion through the indution of mtrix metlloproteinses. Mol Cell Biol 29: Zyzfoon, M, Adulkdir, SA nd MDonld, JM (4). Noth signling nd ERK tivtion re importnt for the osteomimeti properties of prostte ner one metstti ell lines. J Biol Chem 279: Hirose, H, Ishii, H, Mimori, K, Oht, D, Ohkum, M, Tsujii, H et l. (21). Noth pthwy s ndidte therpeuti trget in Her2/Neu/ErB2 reeptor-negtive rest tumors. Onol Rep 23: As, G, As, P, Bekwith, SM, Pitts, RL, Clements, E, Wong, K et l. (1). Erythropoietin nd erythropoietin reeptor expression in humn ner. Cner Res 61: Li, SY, Childs, EE, Xi, S, Coppelli, FM, Gooding, WE, Wells, A et l. (5). Erythropoietin-medited tivtion of JAK-STAT signling ontriutes to ellulr invsion in hed nd nek squmous ell rinom. Onogene 24: Hw, V, Little, B, Kofoed, EM nd Rosenfeld, RG (4). Trnsriptionl regultion of insulin-like growth ftor-i y interferon-gmm requires STAT-5. J Biol Chem 279: Steeg, PS (3). Metstsis suppressors lter the signl trnsdution of ner ells. Nt Rev Cner 3: Livk, KJ nd Shmittgen, TD (1). Anlysis of reltive gene expression dt using rel-time quntittive PCR nd the 2(-Delt Delt C(T)) Method. Methods 25: Moleulr Therpy vol. 2 no. 2 fe
SUPPLEMENTARY INFORMATION
DOI: 1.138/n358 TLR2 nd MyD88 expression in murine mmmry epithelil supopultions. CD24 min plus MRU Myo-epithelil Luminl progenitor (CD61 pos ) Mture luminl (CD61 neg ) CD49f CD61 Reltive expression Krt5
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nture862 humn hr. 21q MRPL39 murine Chr.16 Mrpl39 Dyrk1A Runx1 murine Chr. 17 ZNF295 Ets2 Znf295 murine Chr. 1 COL18A1 -/- lot: nti-dscr1 IgG hevy hin DSCR1 DSCR1 expression reltive to hevy
More informationAlimonti_Supplementary Figure 1. Pten +/- Pten + Pten. Pten hy. β-actin. Pten - wt hy/+ +/- wt hy/+ +/- Pten. Pten. Relative Protein level (% )
Alimonti_Supplementry Figure 1 hy 3 4 5 3 Neo 4 5 5 Proe 5 Proe hy/ hy/ /- - 3 6 Neo β-tin d Reltive Protein level (% ) 15 1 5 hy/ /- Reltive Gene Expr. (% ) 15 1 5 hy/ /- Supplementry Figure 1 Chrteriztion
More informationSUPPLEMENTARY INFORMATION
DOI: 1.138/n2977 Numer of ells per field 6 4 2 P =.1 Orthotopi eum Normlized ventrl photon flux 1E7 1E6 1E5 1E4 1E3 1E2 n=8 n=9 1 2 3 4 5 6 Dys Dy54 1.5E5 2.4E7 d Mie with lymph node metstsis (%) 1 8 6
More informationSUPPLEMENTARY INFORMATION
DOI: 1.13/n7 Reltive Pprg mrna 3 1 1 Time (weeks) Interspulr Inguinl Epididyml Reltive undne..1.5. - 5 5-51 51-1 1-7 7 - - 1 1-1 Lipid droplet size ( m ) 1-3 3 - - - 1 1-1 1-1 1-175 175-3 3-31 31-5 >5
More informationEFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS
EFFECT OF DIETARY ENZYME ON PERFORMANCE OF WEANLING PIGS Finl report sumitted to Dniso Animl Nutrition E. vn Heugten nd B. Frederik North Crolin Stte University, Deprtment of Animl Siene Summry The urrent
More informationRole of HCP5-miR-139-RUNX1 Feedback Loop in Regulating Malignant Behavior of Glioma Cells
originl rtile The Amerin Soiety of Gene & Cell Therpy Role of HCP-miR-19-RUNX1 Feedk Loop in Regulting Mlignnt Behvior of Gliom Cells Ho Teng 1,2, Ping Wng, Yixue Xue, Xioi Liu 1,2, Jun M, Heng Ci 1,2,
More informationTitle of Experiment: Author, Institute and address:
Title of Experiment: Trsfetion of murine mrophge RAW264.7 ells with METAFECTENE PRO. Author, Institute n ress: Ptrizi Pellegtti n Frneso Di Virgilio. Deprtment of Experimentl n Dignosti Meiine, Setion
More informationLHb VTA. VTA-projecting RMTg-projecting overlay. Supplemental Figure 2. Retrograde labeling of LHb neurons. a. VTA-projecting LHb
SUPPLEMENTARY INFORMATION Supplementl Figure 1 doi:10.1038/nture09742 Lterl 1.0 mm from midline mpfc BNST mpfc BNST Lterl 2.1 mm from midline LHA LHA Lterl 2.7 mm from midline SUPPLEMENTAL INFORMATION
More informationSupplementary Figure S1
Supplementry Figure S1 - UTR m - 3HA - 2-1 hgh - 1 Uiquitin *! *! lk distl promoter m K3R/ K121R-3HA UTR hgh founder lines - HA - - founder lines TG- E1 L A2 B1 F9 G6 H4 H6 B C D2 G1 H3 J2 L - 7 IP: lk
More informationSUPPLEMENTARY INFORMATION
oi:1.138/nture1138 Supplementl Figure 1 Inflmmtory Monoytes Host ells CCR2 CCL2 Disseminting Tumor Cells Metstsis Assoite Mrophges VEGF Extrvstion & Metstti Seeing Supplementl Figure 1 The t from this
More informationInsulin-like Growth Factor-binding Protein-7 (IGFBP7): A Promising Gene Therapeutic for Hepatocellular Carcinoma (HCC)
originl rtile The Amerin Soiety of Gene & Cell Therpy Insulin-like Growth Ftor-inding Protein-7 (IGFBP7): A Promising Gene Therpeuti for Heptoellulr Crinom (HCC) Dong Chen 1, Ayesh Siddiq 2, Luni Emdd
More informationCos7 (3TP) (K): TGFβ1(h): (K)
IP#2: IP#1: Totl Lystes luiferse tivity (K): 6-4 - (K): luiferse tivity luiferse tivity (K): 2 1 RL-: - + + + + + Sm4-3F: + - + + + + MYC-Sm3: - - - - + + TβRI-HA(T204D): - - - + - + α-ha Luiferse Ativity
More informationP AND K IN POTATOES. Donald A Horneck Oregon State University Extension Service
P AND K IN POTATOES Donld A Hornek Oregon Stte University Extension Servie INTRODUCTION Phosphorous nd potssium re importnt to grow high yielding nd qulity pottoes. Muh of the northwest hs hd trditionlly
More informationMicroRNA 125b promotes tumor metastasis through targeting tumor protein 53 induced nuclear protein 1 in patients with non small cell lung cancer
Li et l. Cner Cell Int (15) 15:8 DOI 1.118/s1935-15-33-x PRIMARY RESEARCH MiroRNA 15 promotes tumor metstsis through trgeting tumor protein 53 indued nuler protein 1 in ptients with non smll ell lung ner
More information(% of adherent cells) *** PBL firm adhesion. Frequency (% ) 4 1 L 2 CXCR3 DP-2
Chemotxis (% of dded ells) PBL totl dhesion (N ells/mm 2 /1.1 6 PBL) Frequeny (% ) PBL firm dhesion Supplementry Figure 1 4 4 3 3 2 2 1.1-4 1-3 1.1.2. 1 1 8 6 4 2 Adiponetin ( g/ml) - + Adiponetin ( g/ml)
More informationThe Hippo/YAP pathway interacts with EGFR signaling and HPV oncoproteins to regulate cervical cancer progression
Reserh Artile The Hippo/ pthwy interts with EGFR signling nd HPV onoproteins to regulte ervil ner progression Chuno He 1,, Dgn Mo 1,3, Guohu Hu 1,, Xingmin Lv 1, Xingheng Chen, Peter C Angeletti 5, Jixin
More informationTNF-a Downregulates Filaggrin and Loricrin through c-jun N-terminal Kinase: Role for TNF-a Antagonists to Improve Skin Barrier
ORIGINAL ARTICLE TNF- Downregultes Filggrin nd Loririn through -Jun N-terminl Kinse: Role for TNF- Antgonists to Improve Skin Brrier Byung Eui Kim, Mihel D. Howell,, Emm Guttmn,, Ptrii M. Gilleudeu, Irm
More informationYAP transcriptionally regulates COX-2 expression and GCCSysm-4 (G-4), a dual YAP/COX-2 inhibitor, overcomes drug resistance in colorectal cancer
Li et l. Journl of Experimentl & Clinil Cner Reserh (7) 36:44 DOI.86/s346-7-6-3 RESEARCH Open Aess trnsriptionlly regultes expression nd GCCSysm-4 (G-4), dul / inhiitor, overomes drug resistne in oloretl
More informationThe microrna mir-31 inhibits CD8 + T cell function in chronic viral infection
A rt i l e s The mirorna mir-3 inhiits CD8 + T ell funtion in hroni virl infetion Howell F Moffett, Adm N R Crtwright, Hye-Jung Kim, Jernej Gode, Json Pyrdol, Trmo Äijö 3, Gustvo J Mrtinez,6, Anjn Ro,
More informationSupplementary Figure 1
doi: 1.138/nture6188 SUPPLEMENTARY INFORMATION Supplementry Figure 1 c CFU-F colonies per 1 5 stroml cells 14 12 1 8 6 4 2 Mtrigel plug Neg. MCF7/Rs MDA-MB-231 * * MCF7/Rs-Lung MDA-MB-231-Lung MCF7/Rs-Kidney
More informationActivation of Akt as a Mechanism for Tumor Immune Evasion
The Amerin Soiety of Gene Therpy originl rtile Ativtion of Akt s Mehnism for Tumor Immune Evsion Kyung Hee Noh 1, Te Heung Kng 1, Jin Hee Kim 1, Sr I Pi 2, Ken Y Lin 3, Chien-Fu Hung 4, T-C Wu 4 7 nd Te
More informationSupplementary Figure 1. Scheme of unilateral pyramidotomy used for detecting compensatory sprouting of intact CST axons.
() BDA 2 weeks fter Py () AAVs Cre or GFP t P1 BDA 2 weeks fter Py CSMN CST () Py t P7 or 2 months () Py t 2 months Supplementry Figure 1. Sheme of unilterl pyrmidotomy used for deteting ompenstory sprouting
More informationSUPPLEMENTARY INFORMATION
{ OI: 1.138/n31 Srifie n nlyze APs on week 1 s of iet 1 4 6 High-ft iet BrU High-ft iet BrU 4 High-ft iet BrU 6 High-ft iet BrU Lin - Lin - : C34 + : C9 + 1 1 3 1 4 1 5 C45 1 C34 1 1 1 1 3 1 4 1 5 S-1
More informationRESEARCH ARTICLE. Supplemental Figure 5
11.5 2 2 11. RESEARCH ARTICLE RBC ( 1 12 /L) 1.5 1. 9.5 PLT ( 1 9 /L) 1 16 14 HGB (g/l) 19 1 17 16 9. 12 4 4 46 Cellulr & Moleulr Immunology dvne online pulition, PCV (%) 44 MCV (fl) 46 44 ; doi:1.13/mi.214.16
More informationSUPPLEMENTARY INFORMATION
Prentl doi:.8/nture57 Figure S HPMECs LM Cells Cell lines VEGF (ng/ml) Prentl 7. +/-. LM 7. +/-.99 LM 7. +/-.99 Fold COX induction 5 VEGF: - + + + Bevcizum: - - 5 (µg/ml) Reltive MMP LM mock COX MMP LM+
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.18/nture129 ontrol-dna -DNA CD49 Blood Lung e.98 +/-.9.71 +/-.2.29+/-.1 2.9 +/-.6 Bsophils (x1 )/ml 4 Bsophils ( x1 ) d f 45. 22.5 15 75 ontrol-dna ontrol-dna -DNA -DNA
More informationInhibitory effect of p38 mitogen-activated protein kinase inhibitors on cytokine release from human macrophages
British Journl of Phrmology (26) 149, 393 44 & 26 Nture Pulishing Group All rights reserved 7 1188/6 $3. www.rjphrmol.org RESEARCH PAPER Inhiitory effet of p38 mitogen-tivted protein kinse inhiitors on
More informationSUPPLEMENTARY INFORMATION
doi:.8/nture98 : hr NEMO :5 hr IKK IKK NF-κB p65 p5 p65/-rel NF-κB p65 p5 p65/-rel Cytoplsm Cytoplsm p65/p5 Nuleus Nuleus NEMO IKK IKK d : hr > : hr p65/-rel NF- p65 p5 Cytoplsm Cytoplsm p65/p5 p65/-rel
More informationProtein tyrosine phosphatase 1B deficiency or inhibition delays ErbB2-induced mammary tumorigenesis and protects from lung metastasis
Protein tyrosine phosphtse 1B defiieny or inhiition delys ErB2-indued mmmry tumorigenesis nd protets from lung metstsis Sofi G Julien 1,5, Ndi Dué 1,6, Mihelle Red 1, Jnie Penney 1, Mrilene Pquet 2, Yongxin
More informationRoles of the PI-3K and MEK pathways in Ras-mediated chemoresistance in breast cancer cells
ritish Journl of Cner (23) 89, 18 191 & 23 Cner Reserh UK All rights reserved 7 92/3 $2. www.jner.om Roles of the PI-3K nd MEK pthwys in Rs-medited hemoresistne in rest ner ells W Jin 1,LWu 1, K Ling 1,
More informationF-FDG PET/CT for Monitoring the Response of Breast Cancer to mir-143-based Therapeutics by Targeting Tumor Glycolysis
Cittion: Moleulr Therpy Nulei Aids () 5, e57; doi:.8/mtn..7 Offiil journl of the Amerin Soiety of Gene & Cell Therpy www.nture.om/mtn F-FDG PET/CT for Monitoring the Response of Brest Cner to -Bsed Therpeutis
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:.8/nture89 4 4 Ilr -/- Ilr -/- Ilr -/- Cspse- -/- As -/- Nlrp -/- Il8 -/- Ilr -/- Supplementl figure. Inresed severity of NASH in inflmmsome-defiient mie, ut not in Ilr-defiient
More informationThe soy isoflavone genistein promotes apoptosis in mammary epithelial cells by inducing the tumor suppressor PTEN
Crinogenesis vol. no.1 pp.1793 183, 5 doi:1.193/rin/gi131 dvne ess pulition My 19, 5 The soy isoflvone genistein promotes poptosis in mmmry epithelil ells y induing the tumor suppressor huvnesh Dve 1,,
More informationTargeting TSLP With shrna Alleviates Airway Inflammation and Decreases Epithelial CCL17 in a Murine Model of Asthma
Cittion: Moleulr Therpy Nulei Aids (216), e316; doi:1.138/mtn.216.29 Offiil journl of the Amerin Soiety of Gene & Cell Therpy www.nture.om/mtn Trgeting TSLP With shrna Allevites Airwy Inflmmtion nd Dereses
More informationJeffrey D. Coleman, 1 Jerry T. Thompson, 1 Russell W. Smith III, 1 Bogdan Prokopczyk, 2,3 and John P. Vanden Heuvel 1,3,4. 1.
PPAR Reserh Volume 213, Artile ID 121956, 11 pges http://dx.doi.org/1.1155/213/121956 Reserh Artile Role of Peroxisome Prolifertor-Ativted Reeptor β/δ nd B-Cell Lymphom-6 in Regultion of Genes Involved
More informationMiR-29a Assists in Preventing the Activation of Human Stellate Cells and Promotes Recovery From Liver Fibrosis in Mice
originl rtile The Amerin Soiety of Gene & Cell Therpy MiR-9 Assists in Preventing the Ativtion of Humn Stellte Cells nd Promotes Reovery From Liver Firosis in Mie Yoshinri Mtsumoto,,3, Sori Itmi, Mshiko
More informationThe GCN5-CITED2-PKA signalling module controls hepatic glucose metabolism through a camp-induced substrate switch
Reeived 6 Apr 216 Aepted 8 Sep 216 Pulished 22 Nov 216 DOI: 1.138/nomms13147 OPEN The GCN5-CITED2-PKA signlling module ontrols hepti gluose metolism through AMP-indued sustrte swith Mshito Ski 1, Tomoko
More informationInterplay of LRRK2 with chaperone-mediated autophagy
Interply of with hperone-medited utophgy Smnth J Orenstein,, Sheng-Hn Kuo,, Inmuld Tsset,,, Espernz Aris,, Hiroshi Kog,, Irene Fernndez-Crs, Etty Cortes,5, Lwrene S Honig,5, Willim Duer 6, Antonell Consiglio,7,
More informationSUPPLEMENTARY INFORMATION
DOI:.3/n95 Thymus Kiney (kd) TA T7 T TA T7 T Hert TA T7 T: +Dox Cylin B (kd) Thymus Kiney Hert TA T5 T TA T5 T TA T5 T: +Dox Cylin B Poneu S Poneu S CnB T7 CnB T Thymus (kd) + Liver Colon + + (kd) Thymus
More informationRaina Devi Ramnath, Jia Sun, and Madhav Bhatia. Department of Pharmacology, National University of Singapore, Singapore
-3565/9/39-48 48$. THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Vol. 39, No. Copyright 9 y The Amerin Soiety for Phrmology nd Experimentl s 48684/346663 JPET 39:48 48, 9 Printed in U.S.A.
More informationInhibiting Stat3 signaling in the hematopoietic system elicits multicomponent antitumor immunity
2 Nture Pulishing Group http://www.nture.om/nturemediine Inhiiting Stt3 signling in the hemtopoieti system eliits multiomponent ntitumor immunity Mrin Kortylewski 1,4, Miej Kujwski 1,4, Tinhong Wng 2,
More informationARTICLES. Mediators of vascular remodelling co-opted for sequential steps in lung metastasis
Vol 1 April 7 doi:1.13/nture57 ARTICLES Meditors of vsulr remodelling o-opted for sequentil steps in lung metstsis Gorv P. Gupt 1, Don X. Nguyen 1, Anne C. Ching 1,, Pul D. Bos 1, Juliet Y. Kim 1, Cristin
More informationMelatonin, a novel selective ATF-6 inhibitor, induces human hepatoma cell apoptosis through COX-2 downregulation
Submit Mnusript: http://www.wjgnet.om/esps/ Help Desk: http://www.wjgnet.om/esps/helpdesk.spx DOI: 10.3748/wjg.v23.i6.986 World J Gstroenterol 2017 Februry 14; 23(6):986-998 ISSN 1007-9327 (print) ISSN
More informationSUPPLEMENTARY INFORMATION
2 weeks high holesterol diet 2 weeks high holesterol diet 2 weeks high holesterol diet 2 μm Mrophges Crystls Hoehst μm Mrophges Crystls Hoehst Hoehst Crystls Mrophges 2 μm 2 μm Supplementry Fig. 1: Erly
More informationSUPPLEMENTARY INFORMATION
% ells with ili (mrke y A-Tu) Reltive Luiferse % ells with ili (mrke y Arl13) % ells with ili DOI: 1.138/n2259 A-Tuulin Hoehst % Cilite Non-ilite -Serum 9% 8% 7% 1 6% % 4% +Serum 1 3% 2% 1% % Serum: -
More informationOsteoblasts secrete Cxcl9 to regulate angiogenesis in bone
Reeived 2 De 215 Aepted 9 Nov 216 Pulished 14 De 216 DOI: 1.138/nomms13885 OPEN Osteolsts serete to regulte ngiogenesis in one Bin Hung 1,, Wenho Wng 1,, Qinghu Li 1,, Zhenyu Wng 1,BoYn 1, Zhongmin Zhng
More informationProgestin effects on cell proliferation pathways in the postmenopausal mammary gland
Wood et l. Brest Cner Reserh 213, 15:R62 http://rest-ner-reserh.om/ontent/15/4/r62 RESEARCH ARTICLE Open Aess Progestin effets on ell prolifertion pthwys in the postmenopusl mmmry glnd Chrles E Wood 1,
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION CD169 + MACROPHAGES PRESENT LIPID ANTIGENS TO MEDIATE EARLY ACTIVATION OF INVARIANT NKT CELLS IN LYMPH NODES Ptrii Brrl, Polo Polzell, Andres Brukuer, Nio vn Rooijen, Gurdyl S.
More informationAnti-Inflammatory Activity of Methanol Extract and Fractions from Alchemilla kiwuensis Engl. on LPS Activated Macrophages
Aville online on www.ijppr.om Interntionl Journl of Phrmognosy nd Phytohemil Reserh 217; 9(4); 473-481 DOI numer: 1.25258/phyto.v9i2.8117 Reserh Artile ISSN: 975-4873 Anti-Inflmmtory Ativity of Methnol
More informationNew signals from the invasive front Gerhard Christofori 1
NATURE Vol 441 25 My 2006 doi:10.1038/nture04872 New signls from the invsive front Gerhrd Christofori 1 Approximtely 90% of ll ner deths rise from the metstti spred of primry tumours. Of ll the proesses
More informationAntitumor Effects of Chimeric Receptor Engineered Human T Cells Directed to Tumor Stroma
The Amerin Soiety of Gene & Cell Therpy originl rtile Antitumor Effets of Chimeri Reeptor Engineered Humn T Cells Direted to Tumor Strom Sunith Kkrl 1,2,3, Kevin KH Chow 1,2,3, Melind Mt 1,2,4, Donld R
More informationLETTERS. Chfr is required for tumor suppression and Aurora A regulation
25 Nture Pulishing Group http://www.nture.om/nturegenetis Chfr is required for tumor suppression nd Auror A regultion Xiohun Yu 1, Ktherine Minter-Dykhouse 1, Liviu Mlurenu 2, Wei-Meng Zho 3, Dongwei Zhng
More informationEFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE
Swine Dy 22 Contents EFFECTS OF AN ACUTE ENTERIC DISEASE CHALLENGE ON IGF-1 AND IGFBP-3 GENE EXPRESSION IN PORCINE SKELETAL MUSCLE B. J. Johnson, J. P. Kyser, J. D. Dunn, A. T. Wyln, S. S. Dritz 1, J.
More informationThe Disappearance of Lymph Node Metastasis from Neuroendocrine Carcinoma after Endoscopic Ultrasound-guided Fine Needle Aspiration
CASE REPORT The Dispperne of Lymph Node Metstsis from Neuroendorine Crinom fter Endosopi Ultrsound-guided Fine Needle Aspirtion Msyuki Shit 1, Hiroyuki Mtsuyshi 1, Akiko Todk 2, Hnko Kuri 3, Noyuki Tsutsumi
More informationAyman Hyder 1, Sabrina Ehnert 2, Hebke Hinz 1, Andreas K Nüssler 2, Fred Fändrich 1 and Hendrik Ungefroren 1,3*
Hyder et l. Cell Communition nd Signling 212, 1:23 http://www.biosignling.om/ontent/1/1/23 RESEARCH Open Aess EGF nd HB-EGF enhne the prolifertion of progrmmble ells of monoyti origin (PCMO) through tivtion
More informationa3 Chains of type V collagen regulate breast tumour growth via glypican-1
Reeive 5 Aug 16 Aepte De 16 Pulishe 19 Jn 17 3 Chins of type V ollgen regulte rest tumour growth vi glypin-1 Guorui Hung 1, Goxing Ge 1,w, Vlerio Izzi & Dniel S. Greenspn 1 DOI: 1.138/nomms1351 OPEN Periellulr
More information13-cis Retinoic Acid Induces Apoptosis and Cell Cycle Arrest in Human SEB-1 Sebocytes
ORIGINAL ARTILE See relted ommentry on pge 15 13-is Retinoi Aid Indues Apoptosis nd ell yle Arrest in Humn SEB-1 Seoytes Amnd M. Nelson 1, Kthryn L. Gillilnd 1, Zhoyun ong 1 nd Dine M. Thioutot 1, Isotretinoin
More informationFates-shifted is an F box protein that targets Bicoid for degradation and regulates developmental fate determination in Drosophila embryos
ARTICLES Ftes-shifted is n F ox protein tht trgets Bioid for degrdtion nd regultes developmentl fte determintion in Drosophil emryos Juno Liu 1 nd Jun M 1,2,3 Bioid (Bd) is morphogeneti protein tht instruts
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi: 1.138/nnno.211.41 Sili nd titnium dioxide nnoprtiles use pregnny omplitions in mie Kohei Ymshit, Ysuo Yoshiok, Kzum Higshisk, Kzuy Mimur, Yuki Morishit, Mstoshi Nozki, Tokuyuki
More informationANGPTL binding ANGPTL binding ANGPTL4 GST ANGPTL5 ANGPTL6 ANGPTL7. A5+LILRB2 Fc. A5+Tie-2 Fc 10,000 7,500. Tie-2 Fc LILRB2 Fc. 5,000 K d = 5.
doi:1.138/nture1195 ; Inhiitory reeptors ind ANGPTLs nd support < lood stem ells nd leukemi development Junke Zheng 1,2, Msto Umikw 1,3, Chngho Cui 1, Jiyun Li 1, Xioli Chen 1, Chozheng Zhng 1, HongDinh
More informationSupplementary Information
Supplementry Informtion Non-nonil prevents skeletl ging n inflmmtion y inhiiting NF-κB Bo Yu, Ji Chng, Yunsong Liu, Jiong Li, Kreen Kevork, Khli Al Hezimi, Dn T. Grves, No-Hee Prk, Cun-Yu Wng Supplementry
More informationBRAF Inhibition Generates a Host Tumor Niche that Mediates Therapeutic Escape
See relted ommentry on pg 9 ORIGINAL ARTICLE BRAF Inhiition Genertes Host Tumor Nihe tht edites Therpeuti Espe Inn V. Fedorenko 1, Jennifer A. Wrgo, Keith T. Flherty, Jne L. essin nd Keirn S.. Smlley 1,
More informationSupplementary Figure S1_Cottini
Supplementry Figure S1_Cottini γ-h2a.x Krp OCIMy5 KMS11 Krps62 RPMI8226 INA6-1 µm Cleve C3 γ-h2a.x DAPI Merge OCIMy5 H929 JJN3 UTMC2 KMS11 KMS12PE KMS18 KMS2 RPMI8226 INA6 U266 KMS34 Krps62 1 2 3 4 5 6
More informationSupplementary Figure 1
Roles of endoplsmic reticulum stress-medited poptosis in -polrized mcrophges during mycocteril infections Supplementry informtion Yun-Ji Lim, Min-Hee Yi, Ji-Ae Choi, Jung-hwn Lee, Ji-Ye Hn, Sung-Hee Jo,
More informationTbp. Per Relative mrna levels Circadian Time. Liver weight/ body weight (%) n.s. Pernull
Liver weight/ ody weight (%) Dy Body weight (g) Reltive mrna levels Reltive mrna levels Reltive mrna levels Reltive mrna levels Dy Per1 Per2 Per3 Tp 8 2 8 2. 6 2 8 12162 Cirdin Time 3 2 1 2 1 1 8 12162
More informationEffects of Plant Sphingolipids on Inflammatory Stress in Differentiated Caco-2 Cells
Journl of Oleo Siene Copyright 2017 y Jpn Oil Chemists Soiety doi : 10.5650/jos.ess17171 J. Oleo Si. 66, (12) 1337-1342 (2017) NOTE Effets of Plnt Sphingolipids on Inflmmtory Stress in Differentited Co-2
More informationEpiphyseal growth plate growth hormone receptor signaling is decreased in chronic kidney disease related growth retardation
http://www.kidney-interntionl.org & 213 Interntionl Soiety of Nephrology Epiphysel growth plte growth hormone reeptor signling is deresed in hroni kidney disese relted growth retrdtion Ariel Troi 1, Dniel
More informationEffects of Enzyme Inducers in Therapeutic Efficacy of Rosiglitazone: An Antidiabetic Drug in Albino Rats
Asin J. Exp. Si., Vol. 21, No. 2, 2007, 00-00 Effets of Enzyme Inuers in Therpeuti Effiy of Rosiglitzone: An Antiieti Drug in Alino Rts Ann Chursi,#* P.K. Krr** A. S. Mnn* & M.D. Khry* * Deprtment of Phrmeutil
More informationErucin Exerts Anti-Inflammatory Properties in Murine Macrophages and Mouse Skin: Possible Mediation through the Inhibition of NFκB Signaling
Int. J. Mol. Si. 213, 14, 2564-2577; doi:1.339/ijms1412564 Artile OPEN ACCESS Interntionl Journl of Moleulr Sienes ISSN 1422-67 www.mdpi.om/journl/ijms Eruin Exerts Anti-Inflmmtory Properties in Murine
More informationHydrodynamic Delivery of mil10 Gene Protects Mice From High-fat Diet-induced Obesity and Glucose Intolerance
originl rtile The Amerin Soiety of Gene & Cell Therpy Hydrodynmi Delivery of mil Gene Protets Mie From High-ft Diet-indued Oesity nd Gluose Intolerne Mingming Go, Chuno Zhng, Yongjie M, Le Bu, Linn Yn
More informationToolkit for evaluating genes required for proliferation and survival using tetracycline-regulated RNAi
Toolkit for evluting genes required for prolifertion nd survivl using tetryline-regulted RNAi Johnnes Zuer,5, Ktherine MJunkin,,5, Christof Fellmnn,4, Luks E Dow, Meredith J Tylor, Gregory J Hnnon 3 &
More informationARTICLES. Host-reactive CD8 + memory stem cells in graft-versushost. Yi Zhang, Gerard Joe, Elizabeth Hexner, Jiang Zhu & Stephen G Emerson
Host-retive CD8 + memory stem ells in grft-versushost disese Yi Zhng, Gerrd Joe, Elizeth Hexner, Jing Zhu & Stephen G Emerson Grft-versus-host disese (GVHD) is used y lloretive donor T ells tht trigger
More informationMOLECULAR PROFILE AND CELL CYCLE IN MCF-7 CELLS RESISTANT TO CISPLATIN AND DOXORUBICIN
Experimentl Onology 31, 87 91, 29 (June) 87 Exp Onol 29 Originl ontriutions 31, 2, 87 91 MOLECULAR PROFILE AND CELL CYCLE IN MCF-7 CELLS RESISTANT TO CISPLATIN AND DOXORUBICIN N.Yu. Lukynov*, N.V. Rusetsky,
More informationInvolvement of thioredoxin-interacting protein (TXNIP) in glucocorticoid-mediated beta cell death
Dietologi (12) 55:148 157 DOI 1.7/s125-11-2422-z ARTICLE Involvement of thioredoxin-interting protein (TXNIP) in gluoortioid-medited et ell deth E. Reih & A. Tmry & R. Vogt Sionov & D. Melloul Reeived:
More informationOocytes determine cumulus cell lineage in mouse ovarian follicles
133 Reserh tile Ooytes determine umulus ell linege in mouse ovrin folliles Frniso J. Diz, Kren Wigglesworth nd John J. Eppig* The Jkson Lortory, 6 Min Street, Br Hror, ME 469, USA *Author for orrespondene
More informationOvercoming Immune Tolerance Against Multiple Myeloma With Lentiviral Calnexin-engineered Dendritic Cells
The Amerin Soiety of Gene Therpy originl rtile Overoming Immune Tolerne Aginst Multiple Myelom With Lentivirl Clnexin-engineered Dendriti Cells Shuhong Hn 1, Bei Wng 1, Mtthew J Cotter 1, Li-Jun Yng 2,
More informationSonic Hedgehog promotes proliferation of Notch-dependent monociliated choroid plexus tumour cells
Soni Hedgehog promotes prolifertion of Noth-dependent monoilited horoid plexus tumour ells Li Li, Ktie B. Grusm,2, Jun Wng 3, Melody P. Lun 4,5, Jsmin Ohli 6, Hrt G. W. Lidov 4, Moni L. Clihio 4, Erling
More informationSUPPLEMENTARY INFORMATION
DOI:./n BJ RAS:ER Herrnz et l Supplementry Figure HFFF RAS:ER.. mrna Expression..... ILα ILβ IL IL CCL INH VEGF mrna Expression..... ILα ILβ IL IL CCL INH VEGF + OHT Torin NVP-BEZ + OHT shmtor. shmtor.
More informationHeparanase promotes tumor infiltration and antitumor activity of CAR-redirected T- lymphocytes
Supporting Online Mteril for Heprnse promotes tumor infiltrtion nd ntitumor ctivity of -redirected T- lymphocytes IgnzioCrun, Brr Svoldo, VlentinHoyos, Gerrit Weer, Ho Liu, Eugene S. Kim, Michel M. Ittmnn,
More informationAJ PUTT. Hematology. Chemistry. Species: Canine Gender: Female Year of Birth: 2013 Client: PUTT
Speies: Cnine Gender: Femle Yer of Birth: 2013 Client: PUTT Requisition #: 9034-12 Aession #: W2152816 Aount Code: 72364 Veterinrin: CARTER Pnel/Profile: Tik Pnel Add-on Senior Profile with L 4Dx Plus
More informationFAK integrates growth-factor and integrin signals to promote cell migration
integrtes growth-ftor nd integrin signls to promote ell migrtion rtiles Dvid J. Sieg*, Christof R. Huk*, Dusko Ili, Cndie K. Klingeil*, Erik Shefer, Croline H. Dmsky nd Dvid D. Shlepfer* *Deprtment of
More information... Activated T cells regulate bone loss and joint destruction in adjuvant arthritis through osteoprotegerin ligand. immunology letters to nature
Supplementry informtion is ville in Nture s World-Wide We site (http:// www.nture.om) or s pper opy from the London editoril offie of Nture. Aknowledgements Supported in prt y grnts from the NIH (A.A.,
More informationRapamycin toxicity in MIN6 cells and rat and human islets is mediated by the inhibition of mtor complex 2 (mtorc2)
Dietologi (212) 55:1355 1365 DOI 1.17/s125-12-2475-7 ARTICLE myin toxiity in MIN6 ells nd rt nd humn islets is medited y the inhiition of mtor omplex 2 (mtorc2) A. D. Brlow & J. Xie & C. E. Moore & S.
More informationA1/Bfl-1 expression is restricted to TCR engagement in T lymphocytes
(3) 1, 19 17 & 3 Nture Pulishing Group All rights reserved 13-97/3 $. www.nture.om/dd /Bfl-1 expression is restrited to TCR enggement in T lymphoytes C Vershelde 1, T Wlzer, P Gli 1, M-C Biémont 1, L Quemeneur
More informationAnti-angiogenic potential of three triterpenic acids in human liver cancer cells
Anti-ngiogeni potentil of three triterpeni ids in humn liver ner ells 7 8 9 10 11 CHUN-CHE LIN ø,,#, CHUN-YIN HUANG,#, MEI-CHIN MONG, CHIEN-YI CHAN, MEI-CHIN YIN,,* ø Deprtment of Internl Mediine, Chung
More informationARTICLE. E. O. List & A. J. Palmer & D. E. Berryman & B. Bower & B. Kelder & J. J. Kopchick
Dietologi (2009) 52:1647 1655 DOI 10.1007/s00125-009-1402-z ARTICLE Growth hormone improves ody omposition, fsting lood gluose, gluose tolerne nd liver triylglyerol in mouse model of diet-indued oesity
More information1. Introduction. Universidade de São Paulo, São Paulo, Brazil. Correspondence should be addressed to Ana Claudia Latronico;
BioMed Reserh Interntionl, Artile ID 936031, 7 pges http://dx.doi.org/10.1155/2014/936031 Reserh Artile Amplifition of the Insulin-Like Growth Ftor 1 Reeptor Gene Is Rre Event in Adrenoortil Adenorinoms:
More informationBTLA is a lymphocyte inhibitory receptor with similarities to CTLA-4 and PD-1
BTLA is lymphoyte inhiitory reeptor with similrities to CTLA-4 nd PD-1 Norihiko Wtne 1,5, My Gvrieli 1, John R Sedy 1, Jinfei Yng 1,5, Frnes Fllrino 2, Susn K Loftin 1, Mihelle A Hurhl 1, Ntlie Zimmermn
More informationAutocrine IL-2 is required for secondary population expansion of CD8 + memory T cells
Autorine IL-2 is required for seondry popultion expnsion of CD8 + memory T ells Soni Feu, Rmon Arens,2, Susn Togher & Stephen P Shoenerger 2 Nture Ameri, In. All rights reserved. Two ompeting theories
More informationDifferential expression of cyclin G2, cyclin dependent kinase inhibitor 2C and peripheral myelin protein 22 genes during adipogenesis..
The Ohio Stte University From the SeletedWorks of Jiin Zhng Summer My 5, 214 Differentil expression of ylin G2, ylin dependent kinse inhiitor 2C nd peripherl myelin protein 22 genes during dipogenesis..pdf
More information% cells forming Neurospheres 81 ± 6 % 0 % 2.6 ± 0.7 % 76 ± 8 % 0 % 3.4 ± 0.6 % 83 ± 5 % 0 % 2.4 ± 0.9 % 89 ± 5 % 3 ± 1.5 % Total 10, ± 6 % 0 %
Bo et l., Suppl. Tle 1 Supplementl Tle 1. Neurosphere formtion nd tumorigencity is enriched within the tumour cell popultions derived from humn primry glioms nd gliom xenogrfts. GBM smples or Gliom xenogrfts
More informationBraf V600E cooperates with Pten loss to induce metastatic melanoma
Brf V6E oopertes with Pten loss to indue metstti melnom Dvid Dnkort 1,5,6, Dvid P Curley 2,6, Roert A Crtlidge 1, Betsy Nelson 2, Anthony N Krnezis 3, Willim E Dmsky, Jr 2, Mingjin J You 4,5, Ronld A DePinho
More informationGSK-3 is a master regulator of neural progenitor homeostasis
GSK-3 is mster regultor of neurl progenitor homeostsis Woo-Yng Kim 1, Xinshuo Wng 1, Yohong Wu 1, Brdley W Dole 2, Stish Ptel 3, Jmes R Woodgett 3 & Willim D Snider 1 The development of the rin requires
More informationREVIEW Study of the Formation of trans Fatty Acids in Model Oils (triacylglycerols) and Edible Oils during the Heating Process
JARQ 46 (3), 215 220 (2012) http://www.jirs.ffr.go.jp REVIEW Study of the Formtion of trns Ftty Aids in Model Oils (triylglyerols) nd Edible Oils during the Heting Proess Wkko TSUZUKI* Food Resoure Division,
More informationTransient Removal of CD46 Is Safe and Increases B-cell Depletion by Rituximab in CD46 Transgenic Mice and Macaques
The Amerin Soiety of Gene & Cell Therpy originl rtile Trnsient Removl of CD46 Is Sfe nd Inreses B-ell Depletion by Rituximb in CD46 Trnsgeni Mie nd Mques Ines Beyer 1,6, Hu Co 1, Jons Persson 1, Hongjie
More informationResearch Article TNF-α and IFN-s-Dependent Muscle Decay Is Linked to NF-κB- and STAT-1α-Stimulated Atrogin1 and MuRF1 Genes in C2C12 Myotubes
Hindwi Pulishing Corportion Meditors of Inflmmtion Volume 213, Artile ID 171437, 18 pges http://dx.doi.org/1.1155/213/171437 Reserh Artile nd IFN-s-Dependent Musle Dey Is Linked to NF-κB- nd STAT-1α-Stimulted
More informationARTICLE. Keywords Lipotoxicity. MicroRNA. Pancreatic beta cells. Stearic acid
Dietologi (6) 59:7 57 DOI.7/s5639 ARTICLE Elevted irulting steri id leds to mjor lipotoxi effet on mouse pnreti et ells in hyperlipidemi vi mir35pmedited PERK/p53dependent pthwy Huimin Lu & Liuyi Ho &
More informationThymidylate synthase gene polymorphism determines response and toxicity of 5-FU chemotherapy
The Phrmogenomis Journl (2001) 1, 65 70 2001 Nture Pulishing Group All rights reserved 1470-269X/01 $15.00 www.nture.om/tpj ORIGINAL ARTICLE Thymidylte synthse gene polymorphism determines response nd
More informationDHRS3, a retinal reductase, is differentially regulated by retinoic acid and lipopolysaccharide-induced inflammation in THP-1 cells and rat liver
Am J Physiol Gstrointest Liver Physiol 33: G78 G88, 212. First pulished July 12, 212; doi:1.112/jpgi.23.212. DHRS3, retinl redutse, is differentilly regulted y retinoi id nd lipopolyshride-indued inflmmtion
More information