Differentially expressed genes in ATZ treated testes, cut-off value 2
|
|
- Justin Hill
- 6 years ago
- Views:
Transcription
1 Table S1 Differentially expressed genes in ATZ treated testes, cut-off value 2 Gene Name FC Gene full name/ function Entpd4 0.4 Ectonucleoside triphosphate diphosphohydrolase 4, role in salvaging of nucleotides, localizes to lysosomal/autophagic vacuoles Kif18b 0.5 Kinesin family member 18B, role in spindle formation during mitosis L09Rik 0.5 RIKEN cdna L09 gene, cysteine proteinase inhibitor ND6 2.3 NADH dehydrogenase subunit 6, oxidative phosphorylation Complex I Acsm2 2.1 Acyl-CoA synthetase medium-chain family member 2, xenobiotic/mediumchain fatty acid:coa ligase Speer7-ps1 2.1 Spermatogenesis associated glutamate (E)-rich protein 7, pseudogene 1 Speer4e 2.0 Spermatogenesis associated glutamate (E)-rich protein 4e Xpo7 2.0 Exportin 7, Ran GTPase binding, nuclear transport receptor Gm Predicted gene 17019
2 Differential H3K4me3 peaks, cut-off value 2 Table S2 chr start end FC Nearest genes Function chr Ncoa2 Gene encodes nuclear receptor coactivator 2, which aids in the function of nuclear hormone receptors, gene is essential for mouse reproductive function chr Synb The protein plays a major role in placental development and trophoblast fusion and essential for reproduction chr Entpd4 This gene encodes a member of the apyrase protein family, which may play a role in salvaging nucleotides from lysosomes and contribute cell death chr Pabpc1 Pabpc1 protein may plays role in translational regulation of gene expression during spermatogenesis chr Vgll3 Vgll3 expression is associated with a tumor suppressor phenotype in epithelial ovarian cancer, plays role in transcription regulation chr Ropn1 Ropporin, a sperm-specific binding protein of rhophilin, that is localized in the fibrous sheath of sperm flagella chr Loxl2* This gene encodes a member of the lysyl oxidase gene family, cell growth control. LOXL2 promotes tumor progression possibly by activating multiple signal pathways, oxidoreductase chr Ank3* Ankyrins play key roles in activities such as cell motility, activation, proliferation, contact, and the maintenance of specialized membrane domains chr A17R RIKEN cdna A17 gene ik chr Speer7-ps1 Spermatogenesis associated glutamate (E)-rich protein 4C, opposite strand transcript chr Speer4e Spermatogenesis associated glutamate (E)-rich protein 4e chr Speer8-ps1 Spermatogenesis associated glutamate (E)-rich protein 8, pseudogene 2 chr Speer8-ps1 Spermatogenesis associated glutamate (E)-rich protein 8, pseudogene 1 chr Gm7120 predicted gene 7120 chr Speer4d* Spermatogenesis associated glutamate (E)-rich protein chr Tmem181b-ps Transmembrane protein 181B, pseudogene chr Speer4d Spermatogenesis associated glutamate (E)-rich protein 4D chr Gm9758 Predicted gene 9758 chr Gm17019 Predicted gene chr Tmem181b-ps Transmembrane protein 181B, pseudogene chr Pcdhb3 Pcdhb3 may play a critical role in the establishment and function of specific cell-cell connections, cell adhesion chr Speer4e Spermatogenesis associated glutamate (E)-rich protein 4e chr Dynlt1b* Dynlt1b plays a key role in the dynein-independent function of Tctex-1 chr Hhat Skinny hedgehog encodes an enzyme that acts within the secretory pathway to catalyze amino-terminal palmitoylation of 'hedgehog' chr Speer4e Spermatogenesis associated glutamate (E)-rich protein 4e chr Speer8-ps1 Spermatogenesis associated glutamate (E)-rich protein 8, pseudogene 1 chr Trim45* The encoded protein may function as a transcriptional repressor of the mitogen-activated protein kinase pathway chr Speer8-ps1 Spermatogenesis associated glutamate (E)-rich protein 8, pseudogene 1 chr Tmem181b-ps Transmembrane protein 181B, pseudogene chr F02R RIKEN cdna F02 gene ik chr Dhh Desert Hedgehog/Patched 1 signaling specifies fetal Leydig cell fate in testis organogenesis, combinatorial expression of the paracrine factor Dhh and nuclear transcription factor Sf1 is required for Leydig cell development chr Plcb4* Plcb4 has a role in phosphatidylinositol phospholipase C activity chr Sgol2b Shugoshin like 2b (S. pombe) may play role in cell cycle chr Cyp4f18 Cyp4f18 is necessary for omega oxidation of leukotriene B4 in neutrophils, oxidoreductase activity chr Gm17019 Predicted gene chr Nps Nps plays role GPCR signalling chr Syt17 Syt17 (Synaptotagmin XVII) play role in transporter activity chr Tmem181b-ps Transmembrane protein 181B, pseudogene chr Tmem181b-ps Transmembrane protein 181B, pseudogene chr Hgf Hepatocyte growth factor regulates cell growth, cell motility, and morphogenesis by activating a tyrosine kinase signaling cascade after binding to the proto-oncogenic c-met receptor chr Nedd1 Nedd1 play role in cell cycle chr Lingo2 Lingo2 play role in early development chr March1 March1 is a member of membrane-bound E3 ubiquitin ligases chr Stxbp6 Stxbp6 plays role in vesicle-mediated transport, phosphatidylinositol-4,5- bisphosphate binding chr Gm10375 Predicted gene * Peaks are located within TSS
3 Functional classification of genes located nearby ncrnas Table S3 GO term number GO term name Genes are in cluster P-Value GO: adherens junction Ptprc, Tln2, Dlg5, Flnb Cdc42se2, Elmo1, Elmod1 GO: phagocytosis GO: intracellular protein transport Slc25a13, Erbb2ip, Stam, Arfip1, Tnpo1, Hook mitochondrial inner Nat8b, Fech, Slc25a13, Au GO: GO: membrane protein amino acid phosphorylation Irak4, Ptprc, Ick, Csnk1e, C19Rik, Pim1 0.05
4 Table S4 Functional annotation of genes with putative Nr5a2 binding site Go Term number GO term name Genes are in cluster P-Value GO: enzyme inhibitor activity Cst13, Cst8, Cst9, Spock GO: activation of immune response Ptprc, Cd55, Daf GO: locomotory behavior Nrp2, Ccl21c, Ccl21b, Gm1987, Klhl GO: lipoprotein metabolic process Apol10A, Apol9A, Apol7B 0.03
5
6
7
8
9
10
11 Suppplementary file 1. Differential H3K4me3 peaks are not associated with DSBs Fold_ Chan H3K4 me3_ Accu - mulat H3K4me3_Within ed _ genes H3K4me3_neare st_ upstream_gene Distance_ to_nearest _upstream _gene H3K4me3_neares t_downstream_g ene Distance to nearest_downs tream_gene Chrom osome Start End ge chr ATZ Speer7- ps O03Rik H02Rik chr ATZ Speer4e Gm Speer8- ps chr ATZ Speer8- ps1 Speer4e Gm chr ATZ NA Speer8- ps1 82 Gm chr cont Ncoa2 Prdm Tram chr ATZ Speer4d Gm O03Rik chr ATZ NA Tmem181b- ps Dynlt1f chr ATZ Speer4d Gm O03Rik chr ATZ NA Gm Speer4e chr cont Synb Slc25a Gm chr ATZ Gm17019 Speer8- ps Speer4d chr ATZ Pcdha4- g Pcdhb3 Pcdhb Pcdhb chr cont NA Synb Gm chr ATZ Speer4e Gm Speer8- ps chr ATZ Dynlt1b Dynlt1a Tmem181b- ps 8372 chr ATZ Speer4e Gm Speer8- ps chr ATZ Trim45 Vtcn Ttf chr ATZ NA Hhat J18Rik chr ATZ NA Tmem181b- ps Dynlt1f chr ATZ Speer8- ps1 Speer4e Gm chr ATZ NA Speer4e 6059 Speer8- ps1 497 chr ATZ NA Tmem181b- ps Dynlt1f chr ATZ NA Rhebl Dhh 1934 chr ATZ NA F02Rik Haus chr ATZ NA H03Rik Plcb chr ATZ NA Tmem181b- ps Dynlt1f chr ATZ NA Spock Gm chr ATZ Gm17019 Speer8- ps Speer4d chr ATZ NA G07Rik Nps 9096 chr cont NA Pabpc Ywhaz chr cont Vgll3 Chmp2b Cadm chr ATZ NA Tmem181b- ps Dynlt1f chr ATZ Syt K01Rik Itpripl chr ATZ Hgf Cacna2d Speer4f chr cont Ropn1 Kalrn Ccdc chr cont Loxl2 Entpd R3hcc chr cont Ank3 Cdk Ccdc chr ATZ March1 BC Tma chr ATZ NA Lingo N14Rik chr ATZ NA F09Rik Gm chr cont NA Dmrt A17Rik chr ATZ NA Btbd Pwp chr ATZ NA Zpbp F15Rik 3343 chr cont Fgfbp3 Tnks Btaf chr ATZ NA NA NA Olfr chr ATZ NA Atoh Sftpb 54148
12 chr ATZ NA Epha Cenpc chr ATZ Mob1b Grsf Dck chr ATZ NA Shisa L19Rik chr ATZ NA Tmem181b- ps Dynlt1f chr ATZ NA Slc39a Tmeff chr ATZ NA Hnrpll Galm chr ATZ NA Bub Gpr chr ATZ NA Cyr Ddah chr ATZ NA Htr1a Ipo chr ATZ NA Ly Rreb chr ATZ NA Myc Pvt chr ATZ Lrrc69 Slc26a Otud6b chrx ATZ NA C20Rik G05Rik chr ATZ Rad18 Oxtr Srgap chr ATZ NA O14Rik Mir chr ATZ NA Cat 3106 Abtb chr ATZ NA Runx B23Rik chr ATZ Mycbp2 Fbxl Scel chr ATZ Basp1 Cdh Gm chr ATZ Lemd1 Mir135b Klhdc8a chr ATZ NA Gm Speer1- ps chr ATZ Mir684-1 Rbms1 Itgb Gm chr ATZ NA Olfr Olfr chr ATZ NA Ccdc Ppfia chr ATZ NA Lmo Kctd chr ATZ Pkd1l2 Gcsh 8887 Bcmo chr ATZ Txndc11 Snn Zc3h7a chr ATZ Acyp A04Rik Psme chr ATZ Mier1 Wdr Slc35d chr ATZ Zfp60 C030039L03Rik Gm chr ATZ Daf2 Thsd7b Cd chr ATZ C17Rik Cnbd Epb4.1l chr ATZ NA Dok P15Rik chr ATZ NA Tmem181b- ps Dynlt1f chr ATZ NA Gclc Elovl chr ATZ NA L21Rik 585 Klhl chr ATZ Fam83a Wdr M01Rik chr ATZ Rnf17 Atp12a Cenpj chr ATZ NA Gpr Myo3a chr cont Entpd4 Gm16677 Synb Loxl chr ATZ NA Kif Zfp chr ATZ NA Gm Foxn chr ATZ Speer8- ps1 Speer4e 6718 Gm chr ATZ Pla1a Popdc Adprh chr ATZ Smek1 Ccdc88c D130020L05Rik chr ATZ NA Thumpd Acsm chr ATZ Ncoa2 Prdm Tram chr ATZ NA J06Rik Fndc3a chr ATZ NA Dcun1d Mccc chr ATZ BC Pkd D930016D06Rik 12125
13 chr ATZ Eml4 Pkdcc Cox7a2l chr ATZ J09Rik Ednrb Pou4f chr ATZ NA Ttll Lphn chr ATZ Chrnb2 Adar 7172 Ube2q chr ATZ NA Lcorl Slit chr ATZ NA Celf G06Rik chr ATZ NA Stard3nl Epdr chr ATZ NA J07Rik Tshz chr ATZ NA Olfr Olfr chr ATZ NA Hsbp1l Pqlc1 868 chr ATZ Gabrb3 Gabra Atp10a chr ATZ NA Gm Atp11b chr cont K07Rik Gm Gm chr ATZ NA Zfp Erap chr ATZ Dynlt1b Dynlt1a Tmem181b- ps 8661 chr ATZ NA Gm Aga chr ATZ Agbl3 Cald Tmem chr cont Slc25a37 Nkx Synb 3871 chr ATZ NA Snrpn B230209E15Rik chr ATZ NA Pdcd6ip 434 Clasp chr cont Skor2 Smad Ier3ip chr ATZ Zfp735 Olfr Olfr chr ATZ NA Vmn1r Ppm1k chr ATZ NA Vmn1r Ppm1k chr ATZ Gm5114 Gm Zfp chr ATZ NA Klhl Dach chr ATZ NA Lrrc4c B230118H07Rik chr ATZ Jazf1 Tax1bp Gm chr ATZ Mir684-1 Cobll Slc38a chr ATZ Olfr127 Olfr Olfr chr ATZ Rab4a F02Rik Ccsap chr ATZ NA Kif Zfp chr ATZ NA Cdh Cdh chr ATZ NA J09Rik Pou4f chr ATZ NA Emp Grin2b chr ATZ NA Pyy Nags chr ATZ Cyth3 Fam220a Usp chr ATZ Adam6a Adam6b Zfp chr ATZ NA Gria Casp chr ATZ D16Rik Trim Fhdc chr ATZ NA Gm Rps chr ATZ NA Stk Npy chr ATZ Acaca Gm Aatf chr ATZ NA P15Rik Atrnl chr ATZ Adnp E130018N17Rik Dpm chr ATZ Ccdc7 Itgb F21Rik chr ATZ NA Cox7c Edil chr ATZ NA Prok Rybp chr ATZ NA Atp10b Mir chr ATZ Cntnap2 Tpk Cul chr ATZ Gm10640 Gramd1a Scgb1b chr ATZ Cacna2d H02Rik Hgf
14 chr ATZ Tnrc6b Fam83f Mir chr ATZ NA Mgat4a C02Rik chr ATZ Gm I11Rik Gm chr ATZ NA Zfp Mirlet7d 9349 chr ATZ BC Gdi Asb chr ATZ Tmco5b Ryr Fmn chr ATZ Aqr C130080G10Rik Zfp chr cont Mast4 Cd Srek chr ATZ Spire1 Slmo Cep chr ATZ Lpar1 Mir Olfr chr ATZ NA Clnk D17Rik chr ATZ NA Gm Gm chr ATZ Tmtc2 Gm20765 Gm Gm chr ATZ Lmbrd2 Skp Ugt3a chr ATZ NA Ghr Fbxo chrx ATZ NA Zic L24Rik chr ATZ Gpatch2l Gm Esrrb chr ATZ NA Slc24a Mllt chr ATZ Ankrd7 Naa Kcnd chr ATZ Nol4 Asxl Dtna chr ATZ Prss58 Moxd P13Rik chr ATZ NA Csmd Trps chr ATZ Scaper Isl Rfpl3s chr ATZ NA E12Rik Igsf chr ATZ P13Rik Prss J06Rik chr ATZ Gm4787 Slc8a Adam chr ATZ Oxr1 Zfpm Abra chr ATZ Gm16432 Adss Desi chr ATZ NA Dnahc7b Slc39a chr ATZ NA Pde4b Sgip chr ATZ A330093E20Rik Kcnn Trim chr ATZ NA Zfp Zfp chr ATZ NA Rfpl3s Gm chr ATZ NA Cox4i Irf chr ATZ Lpp A730098P11Rik A230028O05Rik chr ATZ NA I23Rik 932 Nvl chr ATZ Letm2 Fgfr Whsc1l chr ATZ NA Gm Ear chr ATZ NA Kcnv A22Rik chr ATZ NA Rgs Rgs chr ATZ NA Cmc G23Rik chr ATZ E02Rik E13Rik Fancl chr ATZ NA Ptger Cth chr ATZ Rsph3b Mir Tagap chr ATZ J16Rik MAtp5g Lnp chr ATZ Lrp1b Mir684-1 Ppp6c Kynu chr ATZ NA Gm Gm chr ATZ NA Gm Fam207a chr ATZ Fto Rpgrip1l Irx chr ATZ NA Inpp4b Il chr ATZ Clnk Zfp518b D17Rik chr ATZ Cdk14 Fzd F17Rik
15 chr ATZ Ralgapa2 A930019D19Rik D12Rik chr ATZ NA Nek Lrrc3b chr cont Bicc1 D630013N20Rik C730027H18Rik chr ATZ Kcnc1 Myod Sergef chr ATZ NA Slc25a Shfm chr ATZ NA Zpbp F15Rik chr ATZ NA Bnc Cntln chr ATZ BC E10Rik Gm chr ATZ Adamts17 Cers Lysmd chr ATZ NA Rad Aard chr ATZ NA Lrfn Fscb chr ATZ Magi2 Gnai Phtf chr ATZ N04Rik G03Rik Cers chr ATZ Mir684-1 Cobll Slc38a chr ATZ NA Tecrl Epha chr ATZ NA Tln C2cd4b chr ATZ NA Zfp Vmn2r chr ATZ Gpbp1 Actbl Mier chr ATZ Gm1527 Rpl22l Egfem chr ATZ NA L24Rik Grin2a chr ATZ NA Pea15b Lphn chr ATZ March1 BC Tma chr ATZ Dis3 Bora Pibf chr ATZ P13Rik Prss J06Rik chr ATZ NA Abcc Zfp chr ATZ Olfr761 Olfr Olfr chr ATZ Manba Ube2d Nfkb chr ATZ Ube2g1 Spns Ankfy chr ATZ Akirin2 Spaca Orc chr ATZ NA Nudt Efna chr ATZ Ap3b1 Gm Tbca chr ATZ Bicc1 D630013N20Rik C730027H18Rik chr ATZ NA Gm Gm chr ATZ Smg6 Srr 5436 Hic chr cont NA Prmt Tspan chr ATZ NA Odc Hpcal chr ATZ Wdr37 Adarb Idi chr ATZ NA Plxdc L03Rik 1190 chr ATZ NA Gpr Cldn chr ATZ NA Iars Gm chr ATZ NA Ttc Mctp chr ATZ Adam22 Sri Dbf chr ATZ Coro7 Vasn 7654 Dnaja chr ATZ NA Olfr Zfp chr ATZ Galnt7 Hmgb AW chr ATZ NA Slc6a Ubl4b 4928 chr ATZ NA Dusp Nup chr ATZ NA Gtf2i Gtf2ird chr ATZ NA G07Rik Nps chr ATZ NA Kcnma Dlg chr ATZ E12Rik Cntn Phxr chr ATZ Clasp1 Mki67ip B14Rik 22445
16 chr ATZ Hfm1 Zfp Cdc chr ATZ N21Rik Csn Cabs1 603 chr ATZ NA Pafah1b Mettl chr ATZ Pgbd1 Zkscan Zscan chr ATZ Adam26b Zfp Adam26a chr ATZ NA Ube2e Gm chr ATZ NA Hmgn Lca chr ATZ NA Speer Gbe chr ATZ Herc6 Ppm1k Pyurf chr ATZ Scamp1 Lhfpl Gm chr ATZ NA Thy Usp chr ATZ Gatsl2 Auts Wbscr chr ATZ NA Pou3f Mms22l chr ATZ Zfp780b G17Rik Gm chr ATZ Pxk Rpp Pdhb chr ATZ Usp46 Spata Dancr chr ATZ Ercc5 Bivm Mettl21e chr ATZ NA A05Rik Zpld chr ATZ Clasp1 Mki67ip B14Rik chr ATZ Myo16 Tnfsf13b B930025P03Rik chr ATZ Supt C03Rik Cdc5l chr ATZ NA Sorcs Sorcs chr ATZ Sorbs2 Tlr D330022K07Rik chr ATZ NA Atp1b Dpt chr ATZ NA Dram Gnptab chr ATZ NA Rbm Lhx chr ATZ NA A07Rik Slitrk chr cont Ccl21b Ccl21c GmCcl27a Gm chr ATZ NA Pole Hk chr ATZ NA Heatr3 946 Papd chr ATZ NA Ghitm Nrg chr ATZ Thsd7a Gm Tmem106b chr ATZ NA Nefl Nefm chr ATZ Jmjd1c Reep Nrbf chrx ATZ L19Rik M19Rik Actrt chr ATZ NA Ghitm Nrg chr ATZ N04Rik Arglu L07Rik chr ATZ NA Fam Rbfox chr ATZ NA Gm J19Rik chr ATZ NA D03Rik Mstn chr ATZ NA Scfd Coch chr ATZ Rtdr1 Gnaz 1542 Rab chr ATZ Fbxo47 B230217C12Rik Plxdc chr ATZ NA C20Rik Sorl chr ATZ NA Dram Gnptab chr ATZ NA Mc2r C10Rik chr ATZ St6galnac5 Pigk St6galnac chr ATZ Erbb2ip Srek Nln chr ATZ NA Atp10a Ube3a chr ATZ Emb Gm Hcn chr ATZ Tmem131 Zap Cnga chr ATZ K20Rik Gdf O12Rik
17 chr ATZ NA Cdh Acot chr ATZ NA Sgcd Gnb2l chr ATZ NA Ankrd Kcnd chr ATZ NA Dnpep Des chr ATZ NA Trhde Tph chr ATZ NA Gckr Zfp chr ATZ NA Gpr Myo3a Mir181a- 1 chr ATZ Mir181b- 1 Nr5a Ptprc chr ATZ NA Pex P02Rik chr ATZ Cyp19a1 Tnfaip8l A03Rik chr ATZ Lrp1b Mir684-1 Ppp6c Kynu chr ATZ Gm4922 D10Bwg1379e F02Rik chr cont NA Synb Gm chr ATZ NA A18Rik P14Rik chr ATZ NA Ehbp Tmem chr ATZ Gm4787 Slc8a Adam chr ATZ NA Gm Amy2b chr ATZ NA Zfp Vmn1r chr ATZ Gid8 Dido Slc17a chr ATZ March1 BC Tma chr ATZ NA Bod1l Gm chr ATZ NA Rasgef1b A930011G23Rik chr ATZ NA M22Rik Galc chr ATZ NA Slc7a Kcnmb chr ATZ NA Vmn2r Pot1b 3846 chr ATZ NA L01Rik Hsfy chr ATZ Greb1 Ntsr E2f chr ATZ Mgat4a C11Rik C02Rik chr ATZ NA Slc39a Cacnb chr ATZ Il16 Stard D08Rik chr ATZ NA Atxn7l3b Trhde chr ATZ Cep170 Pld Mir chrx ATZ NA Gm D18Rik 7117 chr ATZ NA Naalad Ubtfl chr ATZ NA Fancc 2594 Ptch chr ATZ Pcdha1 Gm Pcdha chr ATZ NA J07Rik Tshz chr ATZ NA Olfr1372- ps Olfr chr ATZ Cacna2d3 Lrtm Selk chr ATZ NA Cnga Cckbr chr ATZ NA Agtpbp A230056J06Rik chr ATZ NA I08Rik Sh2d4b chr ATZ NA Syn B01Rik chr ATZ D10Bwg1379e Hebp Gm chr ATZ F24Rik Gm Arpc1a chr ATZ Mir684-1 Cobll Slc38a chr ATZ Fam50b Pxdc Prpf4b chr ATZ NA Cd Gm chr ATZ NA Wac Fzd chr ATZ Ckap5 Lrp Snord chr ATZ NA Krtap Krtap
18 chr ATZ NA Rasgef1b A930011G23Rik chr ATZ NA Atp2a Ift chr ATZ Nrde2 Psmc Gm chr ATZ Tln2 Mir C2cd4b chr ATZ NA Slc39a Cacnb chr ATZ G11Rik Svip 8729 Luzp chrx ATZ Akap4 Ccnb Clcn chr ATZ G17Rik Cml Cml chr ATZ NA Slc39a Tmeff chr ATZ Prdm16 Arhgef L14Rik chr ATZ E13Rik Zfp Gykl chr ATZ Ctns Tax1bp Shpk 3080 chrx ATZ Cylc1 Pou3f Rps6ka chr ATZ NA L10Rik 1243 Kdm5b 9629 chr ATZ NA E07Rik Fstl chr ATZ NA D24Rik Pex chr ATZ Slc17a9 Gid Bhlhe chr ATZ NA Fam92a Triqk chr ATZ Scfd1 G2e Coch chr ATZ NA Plk C05Rik chr ATZ Igf2bp3 Malsu Tra2a chr ATZ Pard3b F06Rik Nrp chr ATZ NA Gm Sptssa chr ATZ NA Mettl21c Tex chr ATZ NA L24Rik Grin2a chr ATZ Ptplad2 Focad Ifnb chr ATZ D17Rik Sox B19Rik chr ATZ NA Skint Trabd2b chr ATZ G14Rik O13Rik Csmd chr ATZ Epcam Calm Msh chr ATZ Sec63 Ostm Scml chr cont NA Irf Enpp chr ATZ Rapgef6 Fnip Cdc42se chr ATZ N21Rik Csn Smr3a chr ATZ NA G16Rik Spred chr ATZ NA Eapp Snx chr ATZ G20Rik Usp Mir99a chr ATZ NA Nrxn Adcyap chr ATZ NA Xkr Rp chr ATZ NA G16Rik Spred chr ATZ Rfc1 Wdr Klb chr ATZ G19Rik Fat Intu chr ATZ NA Cyp3a Cyp3a chr ATZ Asap1 Fam49b Adcy chr ATZ NA Cldn Gtpbp10 67 chr ATZ NA Suco K02Rik chr ATZ NA Ap1ar B09Rik 9921 chr ATZ NA Kcnh Efhb chr ATZ NA Ppp1r Ston chr ATZ NA Iqcf Iqcf6 808 chr ATZ NA Tmprss Ncam chr ATZ NA Klf Pitrm
19 chr ATZ NA Lingo N14Rik chr ATZ NA Speer Gbe chr ATZ Mtdh Tspyl Laptm4b chr ATZ NA Gm Ear chr ATZ Catsperd Lonp Ranbp chr ATZ NA Cyp3a Cyp3a chr ATZ NA Slitrk Slitrk chr ATZ NA Wdr Camk chr ATZ L21Rik Cul Dock chr ATZ NA Tdrd Pcdh chr ATZ NA Ppp2r2a Ebf chr cont NA Cd Lphn chr ATZ NA Rnf Smox chr ATZ Clvs2 Trdn Gm chr ATZ Blzf F23Rik Nme chr ATZ NA Ccdc28a Nhsl chr ATZ F24Rik NGhitm I08Rik chr ATZ Dydc2 Fam213a Dydc chr ATZ Gpd2 Mir B11Rik Galnt chr ATZ Stk4 Tomm Kcns chr ATZ NA Rnaset2b Fgfr1op 109 chr ATZ Dpp F24Rik Speer4b chr ATZ D17Rik Clnk Hs3st chr ATZ NA G01Rik Map3k chr ATZ Nrxn1 Gm K15Rik 2703 chr ATZ Abca9 Abca8a Abca chr ATZ NA Ptchd Ubiad chr ATZ NA Golga Sfrp chr ATZ J16Rik Kcnc Atxn7l3b chr ATZ Ptprn2 Ncapg Gm chr ATZ NA Fgfr Ate chr ATZ G23Rik G06Rik Pik3c chr ATZ NA Grm K19Rik chr ATZ NA D17Rik Ptpn chr ATZ Wdr64 Opn Exo chr ATZ NA Irgm Zfp chr ATZ BC Gdi Asb chr ATZ NA Ankrd Lama chr ATZ C02Rik Tmem184c Ednra chr ATZ Hpse2 Hps Cnnm chr ATZ Dock2 Fam196b Spdl chr ATZ Trim59 Smc Kpna chr ATZ Elmo1 Gpr Aoah chr ATZ Pdzrn4 Cntn Gxylt chr ATZ NA Cxcr Cops chr ATZ Acyp A04Rik Psme chr ATZ Mro Me Mapk chr ATZ Cab39l Setdb Cdadc chr ATZ NA Cyyr Adamts chr ATZ Ak K17Rik Dnajc chr ATZ G23Rik Ptpn Cep chr ATZ NA A930017M01Rik Kcnv
20 chr ATZ NA Rictor 34 Osmr chr ATZ NA Ptp4a E330017L17Rik chr ATZ Gnai1 Gnat Magi chr ATZ NA Acta Fas chr ATZ Adss C15Rik Gm chr ATZ H13Rik Zfp Csnk1g chr ATZ NA Aktip Rpgrip1l chr ATZ Zfp101 Zfp Actl chr ATZ NA D16Ertd472e Chodl chr cont NA Rassf Tmem chr ATZ Gm13152 Znf41- ps Gm chr ATZ Spink10 Fbxo Spink chr ATZ NA Fam179a 7411 BC chr ATZ Cntn1 Muc Pdzrn chr ATZ NA Larp1b Pgrmc chr ATZ Mical3 Bid Pex chr ATZ Crem Vmn1r Gm chr ATZ NA A330050F15Rik Dlgap chr ATZ Smap1 B3gat L19Rik chr ATZ Gxylt2 Shq Ppp4r chr ATZ NA Sult1c Sult1c chr ATZ NA Zfp Bcl7c chr ATZ C17Rik Zfand Olfr chr ATZ NA Armc Foxo chr ATZ NA Srprb 1907 Trf 4276 chr ATZ Jmjd1c Reep Nrbf chr ATZ Tbc1d5 Plcl C330011F03Rik chr ATZ NA Adss Gm chr ATZ Tnpo1 Fcho P04Rik chr ATZ A15Rik Tnp Pinc chr ATZ Pdzrn3 Ppp4r Gm chr ATZ NA Vmn1r Ppm1k chr ATZ Usp49 Med Tomm chr ATZ Gm101 Tmem Sctr chr ATZ NA Orc A930003O13Rik chr ATZ Gm6639 Gm Atp11b chr ATZ Tmem117 Twf LOC chr ATZ NA Rab Ppp4r chry ATZ Zfy2 Usp9y Gm16501 Gm chr ATZ NA A11Rik Rad chr ATZ NA Olfr Olfr chr ATZ NA Fhl Nck chr ATZ NA Sdc Cpq chr ATZ Cntnap5b Slco6d Gm chr ATZ NA Lect Tgfbi chr ATZ A15Rik Tnp Pinc chr ATZ NA E11Rik Ctnna chr ATZ NA Atp10b Mir chr ATZ NA Ank Larp chr cont Bcan Nes Hapln chr ATZ Pnp2 Pnp 3011 Rnase chr ATZ NA H23Rik Olig
21 chr ATZ March1 BC Tma chr ATZ NA Cldn Sox chr ATZ NA Vmn1r Abcg chr ATZ Speer7- ps O03Rik H02Rik chr ATZ NA Gm Gm chr ATZ NA Pex P02Rik chr ATZ H24Rik Zfp Gpn chr ATZ Scfd1 G2e Coch chr ATZ NA Tdrd Nudt chr ATZ Rbfox1 Fam O21Rik chr ATZ NA Npy1r Naf chr ATZ Dock5 Gnrh Nefl chr ATZ Trnt1 Il5ra Crbn 3372 chr ATZ Olfr128 Olfr Olfr chr ATZ NA App Cyyr chr ATZ Appbp H20Rik D630032N06Rik chr ATZ NA Zfp Prr chr ATZ Morn1 Rer Ski chr ATZ Cog5 Gpr Hbp chr ATZ Nebl L03Rik H2afb chr ATZ NA Wac Fzd chr ATZ NA Fam132a B3galt chr ATZ E21Rik Tmem Cpa chr ATZ NA Ppp2r2a Ebf chr ATZ Slc44a5 Acadm Lhx chr ATZ Cap2 Rbm C chr ATZ NA Rit Syt chr ATZ NA Cdh L20Rik 279 chr ATZ NA Fcho Zfp chr ATZ Kpna6 Txlna Tmem39b chr ATZ NA E330034G19Rik Polr3a chr ATZ NA Gzma Gzmk chr ATZ Gpd2 Mir B11Rik Galnt chr ATZ NA Sel1l Flrt chr ATZ Phactr1 Edn Tbc1d chr ATZ Flnb Gm Dnase1l chr ATZ Ctnna E11Rik Lrrtm chr ATZ NA Ednra Ttc chr ATZ Gm14461 Mir68Cwc Ube2e chr ATZ NA Fgd Pim chr ATZ B01Rik Tmco5b Grem chr ATZ NA Acot Cdh chr ATZ NA D630013N20Rik Bicc chr ATZ Gigyf2 Kcnj O15Rik chr ATZ NA Siglec Hspa12b chr ATZ NA D430019H16Rik Bdkrb chr ATZ NA Lrriq D15Rik chr ATZ NA App Cyyr chr ATZ Fbxw7 Dear G14Rik chr ATZ Cntnap5b Slco6d Gm chr ATZ Mir684-1 Galnt Ttc21b chr ATZ NA Kcnh Efhb
22 chr ATZ NA Tagap1 158 Rnaset2b chr ATZ Mir684-1 Stk G03Rik chr ATZ Hecw1 Arid4b Mrpl chr ATZ NA J02Rik Slco6d chr ATZ Hook3 Fnta Rnf chr ATZ Sox6 A730082K24Rik G18Rik chr ATZ NA Fut Manea chr ATZ C20Rik Bai Gm chr ATZ NA C13Rik Trib chr ATZ NA Slc23a Tmem chr ATZ Gak Cplx Tmem chr ATZ NA Zfp Vmn2r chr ATZ Specc1l Bcr Adora2a chr ATZ NA Mreg 8401 Pecr chr ATZ Plbd1 Atf7ip Gucy2c chr ATZ H06Rik Arid5b L02Rik chr ATZ Gpbp1 Actbl Mier chr ATZ Glcci1 A430035B10Rik Ica chr ATZ NA Serp F19Rik chr ATZ Kcnq5 Khdc1b Rims chr ATZ NA Cdh Cdh chr ATZ NA Olfr Olfr chr ATZ NA Nup Kif13a 7138 chr ATZ Slc17a9 Gid Bhlhe chr ATZ NA Etaa Meis chr ATZ NA Tenm Gm chr ATZ Fat4 Ankrd G19Rik chr ATZ Trabd2b Skint Gm chr ATZ Gm M02Rik Smim chr ATZ NA Slc13a Iqub chr cont Spint5 Spint Wfdc chr ATZ NA J19Rik C19Rik chr ATZ NA Gm Tbx chr ATZ Nfatc1 Gm Atp9b chr cont Hist1h4j Hist1h2bm Hist1h4k chr ATZ NA Pithd Tceb chr ATZ Dnajb7 Xpnpep3St Rbx chr ATZ O22Rik K14Rik Rpl chr ATZ NA Cyp19a A03Rik 22 chr ATZ Pifo Ovgp Chia chr ATZ Aknad1 Gpsm Stxbp3a chr ATZ Mir684-1 Csrnp Galnt chr ATZ Mir684-1 Kcnj Nr4a chr ATZ Cspp1 Cops Arfgef chr ATZ NA Rcn Pax6os chr ATZ NA Steap Zfp804b chr ATZ A22Rik Kcnv O13Rik chr ATZ Rab27b Ccdc Dynap chr ATZ Fam71f2 Hilpda 3949 Fam71f chr ATZ Tmem50a Rhd D4Wsu53e chr ATZ Lingo O21Rik Mir chr ATZ NA Klhl Dach
23 chr ATZ NA Tmem Alg chr ATZ NA Dynll Srsf chr ATZ NA Tbx Rbm chr ATZ Gxylt2 Shq Ppp4r chr ATZ NA Dio Cep chr ATZ NA Mir125b E330011O21Rik chr ATZ NA Acsl Kcne chr ATZ Apol7b Apol9a Apol10a chrx ATZ A11Rik Hccs G530011O06Rik chr ATZ NA Pde Asb chr ATZ NA Tcerg1l Mapk1ip chr ATZ C21Rik Sipa1l Dpf chr ATZ Zhx3 Plcg Lpin chr ATZ Lat2 Rfc Eif4h 9201 chr ATZ NA Capza St chr ATZ NA K08Rik 5899 BC chr ATZ NA D03Rik Mstn chr ATZ NA Ttc N09Rik chr ATZ NA E11Rik Ctnna chr ATZ NA G14Rik Csmd chr ATZ Dnajc13 Acad Acpp chr ATZ NA Gm Cdh chr ATZ NA G06Rik Vgll chr ATZ Spata31d1c Spata Hiatl chr ATZ NA Adra1b Il12b chr ATZ M20Rik Arfgap Lrp chr ATZ Gsk3b BC Nr1i chr ATZ NA K14Rik Med13l chr ATZ NA J07Rik Tshz chr ATZ Adss C15Rik Gm chr ATZ NA Gm Ear chr ATZ Cpq J12Rik A05Rik chr ATZ G20Rik Usp Mir99a chr ATZ Paip2b Nagk Zfml chr ATZ NA Robo Robo chr ATZ NA Csnk1g G02Rik chr ATZ G24Rik Etfdh 1326 Rxfp chr ATZ N18Rik Samsn Nrip chr ATZ Hs6st3 Uggt F04Rik chr ATZ NA Pop Gm chr ATZ NA Fam181b Tenm chr ATZ Sphkap Wdr Pid chr ATZ NA Rrp D1Pas chr ATZ Srcin1 Arhgap L11Rik chr ATZ NA Ube2e Gm chr ATZ NA Dnahc7b Slc39a chr ATZ Rgs I17Rik Zfp chr ATZ E21Rik Wdr Onecut chr ATZ Rnf19a Spag Ankrd chr ATZ NA Pdcd C22Rik chr ATZ NA Smarcal Ankar 425 chr ATZ Ranbp9 Nol Ccdc90a
devseek (Sequence(Analysis(Panel(for(Neurodevelopmental(Disorders
ACSL4 Mental/retardation,/XBlinked/63 XLBR ADSL Adenylosuccinase/Deficiency AR AFF2 Mental/retardation,/XBlinked,/FRAXE/type XLBR ALG6 Congenital/disorder/of/glycosylation/type/Ic AR ANK3 Mental/retardation,/autosomal/recessive/37
More informationThe Genetics of Alcoholism. Robert Hitzemann, Ph.D. Departments of Behavioral Neuroscience & Psychiatry Oregon Health & Science University
The Genetics of Alcoholism Robert Hitzemann, Ph.D. Departments of Behavioral Neuroscience & Psychiatry Oregon Health & Science University Genetics, Genomics and Alcoholism Robert Hitzemann, Ph.D. Departments
More informationQuantitative Real Time PCR (RT-qPCR) Differentiation of human preadipocytes to adipocytes
Quantitative Real Time PCR (RT-qPCR) First strand cdna was synthesized and RT-qPCR was performed using RT2 first strand kits (Cat#330401) and RT2 qpcr Master Mix (SABioscience, Frederick, MD). Experiments
More informationTable S1. CDE Sequences and Globin Reporter mrna Half-Lives in NIH3T3 Cells, Related to Figures 1 and 2 Construct Sequence t1/2 ± SD (hrs)
Table S1. CDE Sequences and Globin Reporter mrna Half-Lives in NIH3T3 Cells, Related to Figures 1 and 2 Construct Sequence t 1/2 ± SD (hrs) n TNF -CDE 37 -V2 AGATCCTTCAGACAGACATGTTTTCTGTGAAAACGGAGCTGAGCTAGATCT
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature11986 relative IL-6 expression Viable intracellular Bp per well 18 16 1 1 5 5 3 1 6 +DG 8 8 8 Control DG Time (h) hours B. pertussis IL-6 (pg/ml) 15 Control DG
More informationSupplementary Figures. Supplementary Figure 1. Dinucleotide variant proportions. These are described and quantitated. for each lesion type.
Supplementary Figures Supplementary Figure 1. Dinucleotide variant proportions. These are described and quantitated for each lesion type. a b Supplementary Figure 2. Non-negative matrix factorization-derived
More informationTargeted Genes and Methodology Details for Epilepsy/Seizure Genetic Panels
Targeted s and Methodology Details for Epilepsy/Seizure tic Panels Reference transcripts based on build GRCh37 (hg19) interrogated by Epilepsy/Seizure tic Panels Epilepsy Expanded Panel Epilepsy Expanded
More informationDifferential gene expression profiling of the sciatic nerve in type 1 and type 2 diabetic mice
BIOMEDICAL REPORTS 9: 291-304, 2018 Differential gene expression profiling of the sciatic nerve in type 1 and type 2 diabetic mice YU GU *, ZHUO-LIN QIU *, DE-ZHAO LIU, GUO-LIANG SUN, YING-CHAO GUAN, ZI-QING
More informationSupplementary Information
Supplementary Information Index of Supplementary Materials Supplementary Figure. Distribution of methylation levels, characteristics of cis-meqtls and association plots for meqtls in methylation-related
More informationSupplementary Table 1. Information on the 174 single nucleotide variants identified by whole-exome sequencing
Supplementary Table 1. Information on the 174 single nucleotide s identified by whole-exome sequencing Chr Position Type AF exomes Database 1 10163148 A/G UBE4B missense 0.000326 1534 2 98 1 4.44 Damaging
More informationSupplementary information: Forstner, Hofmann et al.
Supplementary information: Forstner, Hofmann et al., Genome-wide analysis implicates micrornas and their target genes in the development of bipolar disorder Table of contents Supplementary Figure 1: Regional
More informationSupplemental Figures/Tables. Methylation forward GTCGGGGCGTATTTAGTTC. Methylation reverse AACGACGTAAACGAAAATATCG
Supplemental Figures/Tables Supplementary Tables Table S1. Primer sequences MSP Primers SPARC2 Unmethylation forward TTTTTTAGATTGTTTGGAGAGTG Unmethylation reverse AACTAACAACATAAACAAAAATATC Methylation
More informationWT-TP53 DLBCL WT-TP53 GCB-DLBCL
SUPPLEMENTAL TABLES AND FIGURES Supplemental Table S1. Summary of gene expression profiling analysis results listing counts of significant differentially expressed transcripts between defined two groups
More informationA genome-wide association study identifies vitiligo
A genome-wide association study identifies vitiligo susceptibility loci at MHC and 6q27 Supplementary Materials Index Supplementary Figure 1 The principal components analysis (PCA) of 2,546 GWAS samples
More informationTable 1A. Genes enriched as over-expressed in DPM treatment group
Table 1A. s enriched as over-expressed in DPM treatment group Affy Probeset mrna Accession Description 10538247 Npy NM_023456 Mus musculus neuropeptide Y (Npy), mrna. 2.0024 10598062 --- NC_005089 gi 34538597
More information** *** population. (A) Representative FACS plots showing the gating strategy for T N
Sca-1 (MFI) CD122 (MFI) CD44 A CD8 + gated: resting spleen CD8 + gated: T Mem -derived CD8 + gated: T N -derived, expanded alone B CD62L CD44 low CD62L +, resting CD44 high, T Mem -derived CD44 low CD62L
More informationSupplementary Figure 1 A. Relative mrna level for cells. Number of Wells. treated with different sirnas
Supplementary Figure 1 A Relative mrna level for cells treated with different sirnas 1 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 Control FRS2 PTEN PTPR FGFR1 CDH5 ACTN1 RAC2 Gene targeted and probed C Number
More informationTable S3. List of genes that display exclusive expression in selected structures TISSUE Template ID RefSeq accession Gene symbol CENTRAL NERVOUS
Table S3. List of genes that display exclusive expression in selected structures TISSUE Template ID RefSeq accession Gene symbol CENTRAL NERVOUS SYSTEM Cerebral cortex T1569 NM_023906 Asb3 Cerebral cortex
More informationSupplemental Table 1. List of genes and mature shrna sequences identified from the shrna screen in BRCA2-mutant PEO1 cells.
Guillemette_Supplemental Table 1 Gene Mature Sequence Gene Mature Sequence ATTCATAGGATGTCAGCAG LOC157193 TATGCGTAAGTAATAAATTGCT TTAGTTCTGTCTTGGAGG LOC152225 CGCATATATGTTCTGACTT ALDH2 CACTTCAGTGTATGCCT
More informationComprehensive genetic testing for hearing and vision loss
Comprehensive genetic testing for hearing and vision loss Hearing and vision loss can result from both genetic and non-genetic etiologies In general, there is a genetic basis for up to 50% of prelingual
More informationSupplementary Table 1. Candidate loci that were associated with diabetes- and/or obesity-related traits.
Supplementary Table 1. Candidate loci that were associated with diabetes- and/or obesity-related traits. All With Fst in the With long With SNP(s) at the 5' top 5% bracket haplotypes regulatory region
More informationLions and Tigers and Bears.Oh My!
Lions and Tigers and Bears.Oh My! TAKING THE FEAR OUT OF GENETIC TESTING Lisa Butterfield, MS, CGC Genetic Counselor Clinical Assistant Professor University of Kansas Health System Why is Genetic Testing
More informationSupplementary Material. Table S1. Summary of mapping results
Supplementary Material Table S1. Summary of mapping results Sample Total reads Mapped (%) HNE0-1 99687516 80786083 (81.0%) HNE0-2 94318720 77047792 (81.7%) HNE0-3 104033900 84348102 (81.1%) HNE15-1 94426598
More informationEditorial Type 2 Diabetes and More Gene Panel: A Predictive Genomics Approach for a Polygenic Disease
Cronicon OPEN ACCESS EC DIABETES AND METABOLIC RESEARCH Editorial Type 2 Diabetes and More Gene Panel: A Predictive Genomics Approach for a Polygenic Disease Amr TM Saeb* University Diabetes Center, College
More informationSupplementary information. Dual targeting of ANGPT1 and TGFBR2 genes by mir-204 controls
Supplementary information Dual targeting of ANGPT1 and TGFBR2 genes by mir-204 controls angiogenesis in breast cancer Ali Flores-Pérez, Laurence A. Marchat, Sergio Rodríguez-Cuevas, Verónica Bautista-Piña,
More informationInvestigation of genes in chronic and acute morphine-treated mice using microarray datasets
Investigation of genes in chronic and acute morphine-treated mice using microarray datasets L. Ding 1, J.L. Zhang 2, S.H. Yu 1 and L.F. Sheng 1 1 Department of Anesthesiology, The People s Hospital of
More informationNature Biotechnology: doi: /nbt # m
Supplementary Figure 1. Cell seeding in microwells. Cells were stained with SYBR green and visualized under a microscope. Arrows point to single cells (green). Each image is a different position within
More informationA peer-reviewed version of this preprint was published in PeerJ on 18 September 2014.
A peer-reviewed version of this preprint was published in PeerJ on 18 September 2014. View the peer-reviewed version (peerj.com/articles/575), which is the preferred citable publication unless you specifically
More informationSupplementary information, Table S2. Genes belonging to groups in Supplementary information, Figure S8
Supplementary information, Table S2. Genes belonging to groups in Supplementary information, Figure S8 Genbank NM_012054 NM_153508 NM_011305 NM_011884 NM_013892 NM_008595 NM_008860 NM_212457 NM_009514
More informationSample Metrics. Allele Frequency (%) Read Depth Ploidy. Gene CDS Effect Protein Effect. LN Metastasis Tumor Purity Computational Pathology 80% 60%
Supplemental Table 1: Estimated tumor purity, allele frequency, and independent read depth for all gene mutations classified as either potentially pathogenic or VUS in the metatastic and primary tumor
More informationSupplemental Table 1 - Complete set of genes differentially expressed > 2-fold among strains in E11.5 XY gonads.
Supplemental Table 1 - Complete set of genes differentially expressed > 2-fold among strains in E11.5 XY gonads. Genes differentially expressed between C57BL/6J (B6) and 129S1/SvImJ (129). Note: Positive
More informationSupporting Information
Supporting Information Materials and Methods Isolation of primary hepatocytes and adenovirus infection. Primary hepatocytes were isolated from male C57BL/6J mice at 8-12 weeks of age according to the procedure
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:1.138/nature12912 Figure S1. Distribution of mutation rates and spectra across 4,742 tumor-normal (TN) pairs from 21 tumor types, as in Figure 1 from Lawrence et al. Nature
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10860 Supplementary Discussion It remains unclear why H3K9 demethylation appeared to be more sensitive to suppression than at least some other histone methylation marks as a result of
More informationSupplementary Online Content
Supplementary Online Content Lyall DM, Celis-Morales C, Ward J, et al. Association of body mass index with cardiometabolic disease in the UK Biobank: a mendelian randomization study. JAMA Cardiol. Published
More informationNature Immunology: doi: /ni.3837
Supplementary Figure 1 T FR cell responses. (A) B6 mice were infected with PR8 and serial cryosections from the mln on day 3 were stained with anti- B22 (blue), anti-foxp3 (green) and anti-cd35 (red) or
More informationSupplemental Data for Toischer et al., Cardiomyocyte proliferation prevents failure in
Supplemental Data, Page 1 Supplemental Data for Toischer et al., Cardiomyocyte proliferation prevents failure in pressure but not volume overload. Contents: Page 3: Supplemental Figure 1 - Echocardiographic
More informationTable SІ. List of genes upregulated by IL-4/IL-13-treatment of NHEK
Supplemental legends Table SІ. List of genes upregulated by IL-4/IL-13-treatment of NHEK Table SП. List of genes in cluster 1 identified using two-dimensional hierarchical clustering analysis Table SШ.
More informationInfluence of genetic ancestry and socioeconomic status on type 2 diabetes in the diverse Colombian populations of Chocó and Antioquia
Supplementary Information For: Influence of genetic ancestry and socioeconomic status on type 2 diabetes in the diverse Colombian populations of Chocó and Antioquia Aroon T. Chande 1,2,3, Jessica Rowell
More informationSupplementary Note. (Quesada et al., Exome-Sequencing Identifies Recurrent Mutations of the Splicing Factor SF3B1 in Chronic Lymphocytic Leukemia)
Supplementary Note (Quesada et al., Exome-Sequencing Identifies Recurrent Mutations of the Splicing Factor SF3B1 in Chronic Lymphocytic Leukemia) The clinical and biological characteristics of the 105
More informationPol Andrés Benito 1, Jesús Moreno 1, Ester Aso 1, Mónica Povedano 2 1, 3, 4, 5. , Isidro Ferrer. Research Paper ABSTRACT INTRODUCTION
dominant but also recessive and X-linked in some families. However, about 13% of sals cases bear a gene mutation linked to fals. Main pathological features in sals are loss of myelin and axons in the pyramidal
More informationRNA sequencing of cancer reveals novel splicing alterations
RNA sequencing of cancer reveals novel splicing alterations Jeyanthy Eswaran, Anelia Horvath, Sucheta Godbole, Sirigiri Divijendra Reddy, Prakriti Mudvari, Kazufumi Ohshiro, Dinesh Cyanam, Sujit Nair,
More informationPalindromic amplification of the ERBB2 oncogene in human primary breast tumors. A common pattern of copy number transition of chromosome 17 in HER2-
Supplemental Figures Table of Contents Palindromic amplification of the ERBB2 oncogene in human primary breast tumors Michael Marotta 1,5, Taku Onodera 3,5, Jeffrey Johnson 4, Thomas Budd 2, Takaaki Watanabe
More informationCopyright Warning & Restrictions
Copyright Warning & Restrictions The copyright law of the United States (Title 17, United States Code) governs the making of photocopies or other reproductions of copyrighted material. Under certain conditions
More informationCOMPLETE A FORM FOR EACH SAMPLE SUBMITTED ETHNIC BACKGROUND REPORTING INFORMATION
DATE SAMPLE DRAWN: SAMPLE TYPE: BLOOD OTHER (SPECIFY): COMPLETE A FORM FOR EACH SAMPLE SUBMITTED PATIENT FIRST NAME: LAST NAME: DOB: SEX: M F UNKNOWN ADDRESS: HOME PHONE: ( ) WORK: ( ) EUROPEAN CAUCASIAN
More informationSALSA MLPA Probemix P014-B1 Chromosome 8 Lot B and B
SALSA MLPA Probemix P014-B1 Chromosome 8 Lot B1-0916 and B1-0713. Copy number changes of the human chromosome 8 are common in many types of tumours. In most cases, losses of 8p sequences and gains of 8q
More informationSupplemental Table 1: Enriched GO categories per cluster
Supplemental Table 1: Enriched GO categories per cluster Cluster Enriched with #genes Raw p-value Corrected p-value Frequency in set (%) Cluster 1 immune response - GO:0006955 32 2.36E-14 0.001 13.5 Cluster
More informationSupplemental Table 1. 3 types of signals that are involved in T cell activation
Supplemental Table 1. 3 types of signals that are involved in T cell activation Syn-T cells Allo-T cells CD3/28- T cells First signal MHC-TCR-CD3 pathway Not engaged MHC-alloantigen- TCR-CD3 Engaged CD3-Engaged
More informationSupplementary Figure 1. Microarray data mining and validation
Supplementary Figure 1. Microarray data mining and validation Microarray (>47,000 probes) Raw data Background subtraction NanoString (124 genes) Set cut-off and threshold values Raw data Normalized to
More informationU118MG. Supplementary Figure 1 U373MG U118MG 3.5 A CCF-SSTG
A172 CCF-SSTG1 15 - - - 1 1 1 2 2 3 4 6 7 8 10101112131617192022-1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22 T98G U373MG - - - 1 1 1 2 2 3 4 6 7 8 10 10 11 12 13 16 17 19 20 22-1 1 1 2 2 3 4 6 7
More informationIntegrative Radiation Biology
Dr. Kristian Unger Integrative Biology Group Research Unit of Radiation Cytogenetics Department of Radiation Sciences Helmholtz-Zentrum München 1 Key Questions Molecular mechanisms of radiation-induced
More informationPOT1 mutations cause telomere dysfunction in chronic lymphocytic leukemia
POT1 mutations cause telomere dysfunction in chronic lymphocytic leukemia Andrew J. Ramsay, Víctor Quesada, Miguel Foronda, Laura Conde, Alejandra Martínez-Trillos, Neus Villamor, David Rodríguez, Agnieszka
More informationGenetics Forward and Back: strategies for mapping and cloning mutations
Genetics Forward and Back: strategies for mapping and cloning mutations Dr Paul K Potter Head of Disease Model Discovery Mammalian Genetics Unit Overview A few definitions Mapping: concepts and strategies
More informationHTG EdgeSeq Immuno-Oncology Assay Gene List
A2M ABCB1 ABCB11 ABCC2 ABCG2 ABL1 ABL2 ACTB ADA ADAM17 ADGRE5 ADORA2A AICDA AKT3 ALCAM ALO5 ANA1 APAF1 APP ATF1 ATF2 ATG12 ATG16L1 ATG5 ATG7 ATM ATP5F1 AL BATF BA BCL10 BCL2 BCL2L1 BCL6 BID BIRC5 BLNK
More informationJocelyn Chapman, MD Division of Gynecologic Oncology. Julie S. Mak, MS, MSc Genetic Counselor Hereditary Cancer Clinic
Jocelyn Chapman, MD Division of Gynecologic Oncology Julie S. Mak, MS, MSc Genetic Counselor Hereditary Cancer Clinic Genetics underlies all cancers Somatic or tumor genetics Germline or inherited genetics
More informationDeconvolution of Heterogeneous Wound Tissue Samples into Relative Macrophage Phenotype Composition via Models based on Gene Expression
Electronic Supplementary Material (ESI) for Integrative Biology. This journal is The Royal Society of Chemistry 2017 Supplementary Information for: Deconvolution of Heterogeneous Wound Tissue Samples into
More informationChIP-seq Identification of Weakly Conserved Heart Enhancers
ChIP-seq Identification of Weakly Conserved Heart Enhancers Matthew J. Blow, David J. McCulley, Zirong Li, Tao Zhang, Jennifer A. Akiyama, Amy Holt, Ingrid Plajzer-Frick, Malak Shoukry, Crystal Wright,
More informationVariant prioritization
Variant prioritization University of Cambridge Marta Bleda Latorre Cambridge, UK mb2033@cam.ac.uk 30th September 2014 Research Assistant at the Department of Medicine University of Cambridge Cambridge,
More informationNature Immunology: doi: /ni Supplementary Figure 1 33,312. Aire rep 1. Aire rep 2 # 44,325 # 44,055. Aire rep 1. Aire rep 2.
a 33,312 b rep 1 rep 1 # 44,325 rep 2 # 44,055 [0-84] rep 2 [0-84] 1810043G02Rik Pfkl Dnmt3l Icosl rep 1 [0-165] rep 2 [0-165] Rps14 Cd74 Mir5107 Tcof1 rep 1 [0-69] rep 2 [0-68] Id3 E2f2 Asap3 rep 1 [0-141]
More informationSupplementary Information
1 Supplementary Information Human TSC2 Null Fibroblast-Like Cells Induce Hair Follicle Neogenesis and Hamartoma Morphogenesis Shaowei Li 1, Rajesh L. Thangapazham 1, Ji-an Wang 1, Sangeetha Rajesh 1, Tzu-Cheg
More informationg. RA Bardot et al., 2016 Supplementary Figure 1 RV LV E15.5 E6.5 E18.5 E7.5 VE RV LV E8.5 RV LV E10.5 Brightfield Foxa2Cre:YFP Brightfield
Bardot et al., 216 Supplementary Figure 1 a. VE e. RA LA LA RV LV E15.5 E6.5 b. E7.5 VE f. RA E18.5 LA c. E8.5 ML N CM g. RA RV LV LA P7 PHT RV LV d. E1.5 Brightfield Foxa2Cre:YFP H Brightfield Foxa2Cre:YFP
More informationFigure S1. Cos-7. Cos-7 GFP. pjnk C2C12 C2C12 GFP * 60. pjnk. WT lamin A. H222P lamin A
Figure S1 A Cos-7 C NT WT lamin A Cos-7 H222P lamin A 100 % JNK nucleus / positives GFP GFP pjnk 80 60 ** 40 20 0 NT D C2C12 NT WT lamin A GFP pjnk H222P lamin A C2C12 H222P lamin A 100 % JNK nucleus /
More informationNature Neuroscience: doi: /nn.4295
Supplementary Figure 1 Gene expression profiling of EGFRvIII-expressing human brain tumor stem cells (BTSCs) and mouse astrocytes (a) The protein lysates of human BTSCs were analyzed by immunoblotting
More informationGene Isoform OMIM A4GALT NM_ AAAS NM_ AAGAB NM_ AANAT NM_ AARS NM_
Gene Isoform OMIM A4GALT NM_017436.4 607922 AAAS NM_015665.5 605378 AAGAB NM_024666.4 614888 AANAT NM_001088.2 600950 AARS NM_001605.2 601065 AARS2 NM_020745.3 612035 AASS NM_005763.3 605113 ABAT NM_020686.5
More informationAustralia/New Zealand HPP Team
Australia/New Zealand HPP Team Macquarie University Mark Baker, Shoba Ranganathan, Javed Khan, Mark Molloy, Nicki Packer, Bill Hancock, Ed Breen, Simon Foote, Ben Herbert, Brett Cooke, Helena Nevalainen,
More informationSupplementary Figures and Tables. An inflammatory gene signature distinguishes neurofibroma Schwann cells and
Supplementary Figures and Tables An inflammatory gene signature distinguishes neurofibroma Schwann cells and macrophages from cells in the normal peripheral nervous system Kwangmin Choi 1, Kakajan Komurov
More informationEpigenetic Regulation by Chromatin Activation Mark H3K4me3 in Primate Progenitor
Epigenetic Regulation by Chromatin Activation Mark H3K4me3 in Primate Progenitor Cells within Adult Neurogenic Niche Richard S. Sandstrom 1, Michael R. Foret 2, Douglas A. Grow 2,3, Eric Haugen 1, Christopher
More informationMoyamoya disease susceptibility gene RNF213 links inflammatory and angiogenic
Supplementary Information for Moyamoya disease susceptibility gene RNF213 links inflammatory and angiogenic signals in endothelial cells Kazuhiro Ohkubo 1,, Yasunari Sakai 1,*,, Hirosuke Inoue 1, Satoshi
More informationGene expression of muscular and neuronal pathways is cooperatively dysregulated in patients
Gene expression of muscular and neuronal pathways is cooperatively dysregulated in patients with idiopathic achalasia Orazio Palmieri 1, Tommaso Mazza 2, Antonio Merla 1, Caterina Fusilli 2, Antonello
More informationSI_05 Supplementary Table 5
Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines Systems Biology and Cancer Metabolism, Program for Quantitative
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our
More informationb kb
Supplementary Figure S1 COX7RP mrna/gapdh COX activity (OD 45 nm/mg protein) Relative DNA amount COX7RP mrna/gapdh a c pcxn2-flag-cox7rp CAG Flag CMV enhancer Chiken b-actin promoter 1..8.6 COX7RP Muscle
More informationRequisition for DNA Testing. Reason for Referral: Patient Information: INCOMPLETE REQUESTS WILL BE BANKED. Test Requests: Sample Collection:
Reason for Referral: Diagnostic Testing: Affected Unaffected Carrier testing/known Family Mutation Name of index case in the family (include copy of report): Date of Birth: Relationship to this patient:
More informationSupplemental Tables and Figures
Supplemental Tables and Figures Post-zygotic de novo changes in glutamate and dopamine pathways may explain discordance of monozygotic twins for schizophrenia Castellani, CA., Melka, MG., Gui, JL., Gallo,
More informationAnalyzing the NCI-60 Cancer Cell Lines using Data Obtained from Genome-Wide ChIP-X Experiments. Jayanth (Jay) Krishnan. Mahopac High School
1 Analyzing the NCI-60 Cancer Cell Lines using Data Obtained from Genome-Wide ChIP-X Experiments Jayanth (Jay) Krishnan Mahopac High School January 25, 2010 2 Analyzing the NCI-60 Cancer Cell Lines using
More informationSupplementary Figure S1: Validation of amplicons using fluorescence in situ
Supplementary Material Supplementary Figure S1: Validation of amplicons using fluorescence in situ hybridisation with probes for 19q13.2 (A, B), 20q13.13 (C, D) and 20q13.31-q13.32 (E, F). Ovarian clear
More informationSymbol Name Con Simva Atorva ANOVA Simvastatin - Downregulated Simvastatin - Upregulated
Symbol Name Con Simva Atorva ANOVA Simvastatin - Downregulated Asb13 ankyrin repeat and SOCS box-containing protein 13 115 +/- 12 91 +/- 13 116 +/- 16 0.00041 Ascc3 activating signal cointegrator 1 complex
More informationSupplementary appendix
Supplementary appendix This appendix formed part of the original submission and has been peer reviewed. We post it as supplied by the authors. Supplement to: Ellingford JM, Sergouniotis PI, Lennon R, et
More informationHO-1 inhibits preadipocyte proliferation and differentiation at the onset of obesity via ROS dependent activation of Akt2
SUPPLEMENTAL INFORMATION referring to: HO-1 inhibits preadipocyte proliferation and differentiation at the onset of obesity via ROS dependent activation of Akt2 Gabriel Wagner 1, Josefine Lindroos-Christensen
More informationWhat Do We Know About Individual Variability and Its
What Do We Know About Individual Variability and Its Contribution to Disease? Nathaniel Rothman, MD, MPH, MHS Occupational and Environmental Epidemiology Branch, Division of Cancer Epidemiology and Genetics,
More informationUKGTN Testing Criteria
UKGTN Testing Criteria Approved name and symbol of disease/condition(s): Retinal Degeneration panel test Approved name and symbol of gene(s): a panel of 105 genes, variants of which have been shown to
More informationRequest for expedited Result
London Health Sciences Centre Molecular Genetics Laboratories Requisition for DNA Testing DACC002 REV 20170815 AUTHORIZED SIGNATURE IS REQUIRED INCOMPLETE REQUESTS WILL BE BANKED Molecular Genetics Laboratory
More informationChromoFic, Chromosome SNP Microarray 750K, High Resolution
SPECIMEN Peripheral blood ChromoFic, Chromosome SNP Microarray 750K, High Resolution CLINICAL INDICATION Failure to thrive, dysmorphism, triangular face, long philtrum, congenital heart disease, increased
More informationPrinciples of cell signaling Lecture 4
Principles of cell signaling Lecture 4 Johan Lennartsson Molecular Cell Biology (1BG320), 2014 Johan.Lennartsson@licr.uu.se 1 Receptor tyrosine kinase-induced signal transduction Erk MAP kinase pathway
More informationPartial carotid ligation and flow pattern validation by high resolution ultrasound
Partial carotid ligation and flow pattern validation by high resolution ultrasound All animal studies were performed with Male C57Bl/6 mice according to the approved IACUC protocol by Emory University.
More informationSupplementary Information for nature05543: Foxp3-dependent programme of regulatory T-cell differentiation
Supplementary Information for nature5543: Foxp3-dependent programme of regulatory T-cell differentiation Supplementary Methods Mice. The Foxp3 gfpko targeting vector was generated by inserting the stop
More informationMutant p53 promotes ovarian cancer cell adhesion to mesothelial cells via integrin β4 and Akt signals
Mutant p53 promotes ovarian cancer cell adhesion to mesothelial cells via integrin β4 and Akt signals Jong-Gyu Lee 1,2, Ji-Hye Ahn 1,2, Tae Jin Kim 3, Jae Ho Lee 4, and Jung-Hye Choi 1,2 Table S1. Primer
More informationUniversity of Groningen. Towards the mechanism of early-life programming Pruis, Genoveva Maurien Mirella
University of Groningen Towards the mechanism of early-life programming Pruis, Genoveva Maurien Mirella IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish
More informationSupplementary Table 4A - Gene Ontology analysis of up-regulated genes
Supplementary Table 4A - Gene Ontology analysis of up-regulated genes Function Systematic Common Genbank Map Apoptosis Regulator NM_001168.1_PROBE1 BIRC5 NM_001168 17q25 Apoptosis Regulator NM_002192.1_PROBE1
More informationnormalized to Arbp, and adipocyte expression set to 100 for each mrna. Significant fold
Figure S1. Ppar 1 and Ppar 2 Expression during 3T3-L1 Cell Differentiation. Ppar 1 and Ppar 2 mrna levels were examined at days 0, 1 and 10 of 3T3-L1 differentiation. Values were normalized to Arbp, and
More informationTable S1. Differentially expressed transcripts between hepatic inkt cells. sorted form WT and plck-hcd1d tg mice. Differentially expressed
Supplementary Information Table S1. Differentially expressed transcripts between hepatic inkt cells sorted form and plck-hcd1d tg mice. Differentially expressed transcripts identified by gene expression
More informationLarge-Scale Discovery of Enhancers from Human Heart Tissue
Large-Scale Discovery of Enhancers from Human Heart Tissue Dalit May, Matthew J. Blow, Tommy Kaplan, David J. McCulley, Brian C. Jensen, Jennifer A. Akiyama, Amy Holt, Ingrid Plajzer-Frick, Malak Shoukry,
More informationFetal-maternal alignment of regulatory T cells correlates with Interleukin 10 mediated Bcl-
Fetal-maternal alignment of regulatory T cells correlates with Interleukin 10 mediated Bcl- 2 upregulation in pregnancy B. Santner-Nanan, K. Straubinger, P. Hsu, G. Parnell, B. Tang, B. Xu, A. Makris,
More informationSupplementary Fig. 1 The third litter from Addict F0 showed higher cocaine consumption compared with the third litter from NonAddict F0 rats.
Supplementary Fig. The third litter from Addict F0 showed higher cocaine consumption compared with the third litter from NonAddict F0 rats. The Addict F (3 rd litter) showed higher cocaine intake than
More informationSupplemental Information. lncrna Epigenetic Landscape Analysis Identifies EPIC1 as an Oncogenic lncrna that Interacts with MYC
Cancer Cell, Volume 33 Supplemental Information lncrna Epigenetic Landscape Analysis Identifies as an Oncogenic lncrna that Interacts with and Promotes Cell-Cycle Progression in Cancer Zehua Wang, Bo Yang,
More informationSloane Kathryn Tilley
ANALYSIS OF BLADDER CANCER TUMOR CPG METHYLATION AND GENE EXPRESSION WITHIN THE CANCER GENOME ATLAS IDENTIFIES GRIA1 AS A PROGNOSTIC BIOMARKER FOR BASAL-LIKE BLADDER CANCER Sloane Kathryn Tilley A thesis
More informationSUPPLEMENTARY INFORMATION
FULL METHODS Animals. Male, Bmal1 -/-, Per Luc, and Per Luc ; mice were produced and maintained on a C57BL/6J background at the Northwestern University Center for Comparative Medicine. Bmal1 flx/flx mice
More informationIdentification by genetics of. expressed in the brain as potential novel
Identification by genetics of neurotransmitter and other transporters expressed in the brain as potential novel targets for schizophrenia 13 rd November 2014, Drug Transporters symposium, target of avoid?
More informationAutism/ID Xpanded Panel Gene List (~2000)
Autism/ID Xpanded Panel Gene List (~2000) Approximately 84% of the genes are covered >99% at 10X and the average coverage of a gene at 10X for this panel is >98%. A2M A2ML1 AAAS AARS AARS2 AASS ABAT ABCA1
More information