GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG

Transcription

1 Lecture 6

2 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG GGGGAGTCTCCGGCGCACGCGGCCCCTTGGCCCCGCCCCCAGTC ATTCCCGGCCACTCGCGACCCGAGGCTGCCGCAGGGGGCGGGCT GAGCGCGTGCGAGGCGATTGGTTTGGGGCCAGAGTGGGCGAGGC GCGGAGGTCTGGCCTATAAAGTAGTCGCGGAGACGGGGTGCTGGT TTGCGTCGTAGTCTCCTGCAGCGTCTGGGGTTTCCGTTGCAGTCCT CGGAACCAGGACCTCGGCGTGGCCTAGCGAGTTATGGCGACGAAG GCCGTGTGCGTGCTGAAGGGCGACGGCCCAGTGCAGGGCATCAT CAATTTCGAGCAGAAGGCAAGGGCTGGGACGGAGGCTTGTTTGCG AGGCCGCTCCCACCCGCTCGTCCCCCCGCGCACCTTTGCTAGGAG CGGGTCGCCCGCCAGGCCTCGGGGCCGCCCTGGTCCAGCGCCCG GTCCCGGCCCGTGCCGCCCGGTCGGTGCCTTCGCCCCCAGCGGT GCGGTGCCCAAGTGCTGAGTCACCGGGCGGGCCCGGGCGCGGG GCGTGGGACCGAGGCCGCCGCGGGGCTGGGCCTGCGCGTGGCG GGAGCGCGGGGAGGGATTGCCGCGGGCCGGGGAGGGGCGGGGG CGGGCGTGCTGCCCTCTGTGGTCCTTGGGCCGCCGCCGCGGGTC TGTCGTGGTGCCTGGAGCGGCTGTGCTCGTCCCTTGCTTGGCCGT GTTCTC

3 DNA is only half the story Variations in DNA alone may not entirely account for variations in phenotypic traits Organisms with identical DNA often exhibit distinct phenotypes Plants Insects Mammals agouti mice

4 Outline Introduction DNA sequence is only half the story Detecting DNA methylation Methylation and Demethylation Function of DNA methylation

5 McGrath and Solter 1983, 1984; Surani and Barton 1983; Surani et al The two parental genomes in a cell are not the same Both maternal and paternal genomes are required for embryo development

6 The two parental genomes in a cell are not the same Both maternal and paternal genomes are required for embryo development Many genes are expressed in a parent-of-origin specific manner (a phenomenon known as imprinting) ~80 human genes are known to be imprinted ~140 mouse genes are known to be imprinted Recent work from Gregg et al. (Science 2010) found over 1000 imprinted genes IGF2 IGF2 Barlow et al. 1991; Ferguson-Smith et al Bartolomei et al H1 9 H1 9

7 The two parental genomes in a cell are not the same Both maternal and paternal genomes are required for embryo development Many genes are expressed in a parent-of-origin specific manner (a phenomenon known as imprinting) Defects in imprinted genes underlie a number of human genetic disorders (reviewed by Bartolomei & Ferguson-Smith, 2011) Beckwith-Wiedemann syndrome Prader-Willi syndrome Angelman s syndrome

8 The two parental genomes in a cell are not the same Both maternal and paternal genomes are required for embryo development Many genes are expressed in a parent-of-origin specific manner (imprinted) Imprinting is controlled by differential DNA methylation at imprinted control regions (ICR) IGF2 IGF2 CTCF ICR H1 9 H1 9

9 The two parental genomes in a cell are not the same Both maternal and paternal genomes are required for embryo development Many genes are expressed in a parent-of-origin specific manner (imprinted) Imprinting is controlled by differential DNA methylation at imprinted control regions (ICR) Less than 30 differentially methylated regions are known in the mammalian genome.

10 Outline Introduction DNA sequence is only half the story Detecting DNA methylation Methylation and Demethylation Function of DNA methylation

11 How to detect DNA methylation patterns in vivo? Bisulfite sequencing MethylC IP (MeDIP) Use of methylation sensitive restriction enzymes

12 How to detect DNA methylation patterns in vivo? Bisulfite sequencing MethylC IP (MeDIP) Use of methylation sensitive restriction enzymes

13 Genome-wide mapping of DNA methylation ligate methylated adapters m m m m ATCGACTCTCACGAA Genomic DNA bp Pre-bisulfite library (size select) bisulfite convert DNA C U PCR AT m m m m CGAUTCTCACGAA deep sequencing Amplified bisulfite library Lister et al., Nature 2009, 462 pp bisulfite converted library

14 Genome-wide mapping of DNA methylation MECP2 Hypomethylation (H1) Hypermethylation (IMR90)

15 How to detect DNA methylation patterns in vivo? Bisulfite sequencing MethylC IP (MeDIP) Use of methylation sensitive restriction enzymes

16 How to detect DNA methylation patterns in vivo? Bisulfite sequencing MethylC IP (MeDIP) Use of methylation sensitive restriction enzymes

17 How to detect DNA methylation patterns in vivo? Bisulfite sequencing MethylC IP (MeDIP) Use of methylation sensitive restriction enzymes

18 How to detect DNA methylation patterns in vivo? Bisulfite sequencing MethylC IP (MeDIP) Use of methylation sensitive restriction enzymes Sharma Amy, Heuck Christoph J., Fazzari Melissa J., Mehta Jayesh, Singhal Seema, Greally John M., Verma Amit. DNA methylation alterations in multiple myeloma as a model for epigenetic changes in cancer. WIREs Syst Biol Med 2010, 2: doi: /wsbm.89

19 How to detect DNA methylation patterns in vivo? Bisulfite sequencing MethylC IP (MeDIP) Use of methylation sensitive restriction enzymes Illumina Infinium Bead Array

20 How to detect DNA methylation patterns in vivo? Bisulfite sequencing MethylC IP (MeDIP) Use of methylation sensitive restriction enzymes Illumina Infinium Bead Array

21 Genomic distribution of DNA methylation DNA methylation occurs mostly in CG context, but also non- CG sequences. Lister et al., Nature 2009

22 Genomic distribution of DNA methylation DNA methylation occurs mostly in CG context, but also non- CG sequences. DNA methylation is generally depleted from promoters, and enriched within gene bodies Lister et al., Nature 2009

23 CpG islands and patterns of DNA methylation in mammalian genome

24 Genomic distribution of DNA methylation DNA methylation occurs mostly in CG context, but also non- CG sequences. DNA methylation is generally depleted from promoters, and enriched within gene bodies Lister et al., Nature 2009

25 Genomic distribution of DNA methylation DNA methylation occurs mostly in CG context, but also non-cg sequences. DNA methylation is generally depleted from promoters, and enriched within gene bodies DNA methylation is partially depleted from enhancers Lister et al., Nature 2009

26 Stradler et al. Nature 480, 490 (2011). doi: /nature10716 Genomic distribution of DNA methylation DNA methylation occurs mostly in CG context, but also non-cg sequences. DNA methylation is generally depleted from promoters, and enriched within gene bodies DNA methylation is partially depleted from enhancers

27 Outline Introduction DNA sequence is only half the story Detecting DNA methylation Methylation and Demethylation Function of DNA methylation

28 The two parental genomes in a cell are not the same There are two waves of DNA methylation and demethylation during lifetime of a mammal What are responsible for the methylation and demethylation of DNA? ICR Reik et al. Science 2001

29 Mechanisms of DNA methylation and demethylation Tet1,2, 3 TDG Allis et al., Epigenetic

30 Mechanisms of DNA methylation and demethylation Zhizhong Gong and Jian-Kang Zhu, Cell Res. 2011

31 Detecting 5hmC Song et al., Nature Biotechnology 29, (2011)

32 Detecting 5hmC Pastor et al., Nature 473, 394 (2011). doi: /nature10102

33 Detecting 5hmC 5hmC 5mC Pastor et al., Nature 473, 394 (2011). doi: /nature10102

34 Mammalian DNA methyltransferases

35 Function of DNA methylation Function of DNA methylation varies depending on sequence context Promoter: often silencing Gene body: not clear Enhancer: often repressive ICR: regulating imprint repeat DNA: silencing But.. ES cells can survive without any DNA methylation, with only a few hundred genes upregulated in KO cells