Characterization of HIV-1 integrase N-terminal mutant viruses

Transcription

1 Virology 360 (2007) Characterization of HIV-1 integrase N-terminal mutant viruses Aliza G. Lloyd, Yen Shing Ng, Mark A. Muesing, Viviana Simon 1, Lubbertus C.F. Mulder,1 The Aaron Diamond AIDS Research Center 455 First Avenue, New York, NY 10016, USA Received 4 August 2006; returned to author for revision 19 September 2006; accepted 3 October 2006 Available online 14 November 2006 Abstract During infection, human immunodeficiency virus type 1 integrase engages a number of molecules and mechanisms, both of viral and cellular origin. In one of such instances, integrase is thought to be degraded by the N-end rule proteasome pathway a process that targets the N-terminal residue of its substrates. Here we describe the properties of HIV-1 viruses in which the first amino acid residue of integrase has been substituted to render it resistant to the N-end rule pathway. As result of this exchange, we observe a set of class I and class II defects that result in a large decrease of viral replication efficiency. Specifically, reverse transcription and integration are the steps that appear to be affected. We propose that the severe deficiency of these mutants exert a strong selective pressure that leads to the near total conservation of the N-terminal residue of integrase in HIV-1, HIV-2 and SIV Elsevier Inc. All rights reserved. Keywords: HIV-1; Integrase; EGFP; N-end rule Introduction Human immunodeficiency virus type 1 (HIV-1), as part of the retrovirus family, reverse transcribes its RNA genome and inserts the resulting cdna into the chromosomal DNA of its host. This last process is mediated by the viral enzyme integrase (IN), in concert with cellular factors. In several studies (Engelman et al., 1995; Lu et al., 2005a, 2005b, 2005c; Wiskerchen and Muesing, 1995), the mutagenesis of conserved regions within IN has determined its importance in the various reactions that lead to integration (class I mutants) as well as in other steps of the viral life cycle (class II mutants) (Engelman, 1999). IN is the retroviral protease-dependent proteolytic product of the Gag-Pol polyprotein, and also one of the few known substrates for the ubiquitin/proteasome pathway known as N- end rule (Mulder and Muesing, 2000). The N-end rule determines the half-life of its substrates by the identity of their first residue (Bachmair et al., 1986). In yeast, Rad6 and UBR1 are respectively the E2 conjugating enzyme and E3 ligase of this Corresponding author. Fax: addresses: lmulder@adarc.org, lubbertus.mulder@mssm.edu (L.C.F. Mulder). 1 Present address: Department of Medicine at Mount Sinai School of Medicine, New York, NY 10029, USA. pathway (Bartel et al., 1990; Dohmen et al., 1991; Madura et al., 1993). In mammalian cells, there are two Rad6 alleles, Rad6A and Rad6B (Koken et al., 1991), and at least 7 orthologs of UBR1 (Tasaki et al., 2005). Mammalian UBR1 2 and 4 have been shown to be involved in the degradation of ectopically expressed HIV-1 IN (Tasaki et al., 2005). The first residue of HIV-1 IN is invariably a phenylalanine (Phe). Phe ranks as a primary instability determinant in the N- end rule hierarchy that classifies the N-terminal residues based on the (in)stability they provide to the rest of the protein (Varshavsky, 1997). In this report, we determine the relevance of the first residue of HIV-1 IN in viral infection. Results Replication and infectivity In order to assess the importance of IN N-terminal residue in HIV-1 infection, we mutated position 1 from Phe to Met, which enhances IN half-life in an isolated system (Mulder and Muesing, 2000). In addition, since changing the first residue of IN also alters the reverse transcriptase (RT)-IN cleavage site recognized by the viral protease, we made a second type of mutant by introducing a potentially compensatory substitution, from Leu to Met, at the C-terminal position of RT. This latter /$ - see front matter 2006 Elsevier Inc. All rights reserved. doi: /j.virol

2 130 A.G. Lloyd et al. / Virology 360 (2007) change results in a Met Met combination, which is also found in HIV-1 at the junction between p2 and p7 and therefore more likely to be processed compared to the Leu Met junction. As control for the Met Met mutant, we constructed a virus carrying a Met Phe combination. Viral replication was monitored by infecting PBMC from two different donors with equal amounts of either WT or mutant HIV-1 R7/3 viruses (Fig. 2A upper), and monitoring p24 values over a period of 21 days. As can be seen in Fig. 1A starting from day 6 post-infection, viruses with mutant IN have 10- to 100- fold lower replication rates than WT. To assess if the mutant viruses have a replication defect in the early phases of infection, TZM cells were infected with single round vesicular stomatitis virus glycoprotein (VSV-G) pseudotyped WT and mutant R7/3 CMV EGFP viruses (Fig. 2A middle). Fig. 1B shows that irrespective of the last residue of RT, viruses bearing a Met N-terminal residue in IN (Met-IN) are at least 8-fold (t-test p-value < 0.05) less infectious than WT. To assess if mutant viruses contain quantities of IN similar to wild type and can support a correct processing of the Gag-Pol polyprotein, equal amounts of concentrated virions were analyzed by western blot. As is shown in Fig. 1C, WT and mutant viruses contain comparable levels of IN, and Gag-Pol processing was equivalent in all the viral clones. Of note, though unlikely to play a major role, is that both viruses carrying mutant IN present a faint band at the level of the RT-IN polyprotein (Fig. 1C first panel). In order to determine if this small amount of RT- IN could influence infectivity, we decided to take advantage of a Fig. 1. Mutations of integrase N-terminal residue affect HIV-1 replication. (A) PBMCs stimulated with PHA were infected with 50 ng p24/well of R7/3 YU2 EGFP and IN mutants, p24 values were assessed over a period of 21 days post-infection. (B) TZM cells plated at 40,000 cells/well in 24 well plates, were infected with 100ng/well and three 5-fold serial dilutions, of the WT and IN mutants of R7/3 CMV EGFP VSV-G pseudotyped virus. Infections were carried out overnight in the presence of 8 μg/ml of polybrene. Infectivity was measured by flow cytometry and indicated as percentage of EGFP positive cells h post-infection. (C) 490 ng p24 of WT and IN mutant R7/3 CMV EGFP viruses were concentrated over a 20% sucrose cushion and half the amount loaded on a 10% polyacrylamide gel. Integrase was detected with monoclonal antibody 6G5 and HIV-1 proteins with patient anti-hiv serum.

3 A.G. Lloyd et al. / Virology 360 (2007) complementation system, described in (Fletcher et al., 1997), which allows to uncouple the proteolytic cleavage of RT-IN from the kinetic processing of HIV-1 polyproteins and from reverse transcription. In this system, the plr2p-r-pc-in plasmid (Fig. 2A lower) is used to ectopically express IN in the virus producer cell as a fusion with Vpr, which mediates proper incorporation and a short C-terminal stretch of RT encoding the RT-IN cleavage site. We complemented R7/3 CMV EGFP viruses lacking IN with the plr2p-r-pc-in plasmid encoding WT IN or its mutants. Fig. 2B shows that, although infectivity is generally low, viruses with Met-IN are 4- to 5-fold (t-test p-values and 0.017, respectively) less infectious than the WT IN carrying controls. Also in this case, the quantities of IN present in the different virions are comparable (Fig. 2C). Taken together, these results show that the identity of the N- terminal residue of IN plays a significant role in HIV-1 infectivity, and that its influence exceeds that dictated by the optimal composition of the RT-IN proteolytic cleavage site. Effect of IN N-terminal residue on reverse transcription In order to determine which step between entry and integration is affected by the identity of the N-terminal residue of IN, we quantified the reverse transcription product of the different viruses at distinct time points. Viral cdna was measured by fluorescent quantitative PCR (qpcr) using primers specific for late reverse transcription products. Fig. 3 shows that Met-IN bearing viruses consistently exhibit a 2.5- to 5-fold (t-test p- value<0.01) reduced amount of late reverse transcription product than Phe-IN bearing viruses. These results suggest that the identity of the N-terminal residue of IN influences the synthesis or the accumulation of viral cdna. Effect of IN N-terminal residue on integration We next asked whether viruses with mutant INs are competent for integration or if a defect in this process could be an additional cause for their overall lower infectivity. We used an R7/3 CMV EGFP virus carrying an IN with a D116A active site substitution and complemented it with the plr2p-r-pc-in vector or its N-terminal mutants. Fig. 4A shows that IN N- terminal mutants are only partially able to complement the catalytically inactive IN molecule of the backbone virus, with a 2- to 3-fold lower number of cells harboring the integrated provirus. Given that D116A IN mutant viruses are fully proficient for reverse transcription and that recombinant HIV-1 IN with an N-terminal Met is competent to perform concerted integration reactions in vitro, these results could arise from two causes: the most direct is that IN N-terminal mutants are less proficient in the integration reaction in vivo, but it is also Fig. 2. Reduced replication of integrase N-terminal mutant viruses is not due to a RT-IN cleavage defect. (A) Diagrams of the constructs used in this work. (B) Concentrated R7/3 CMV EGFP ΔIN VSV-G pseudotyped viruses complemented with plr2p-r-pc-in and IN mutants were used to infect 40,000 TZM cells/well. Infectivity was measured by flow cytometry and indicated as percentage of EGFP positive cells h post-infection. (C) Concentrated R7/3 CMV EGFP Δ IN VSV-G pseudotyped virions complemented with plr2p-r-pc-in and IN mutants were separated on a 10% polyacrylamide gel. Integrase was detected with monoclonal antibody 6G5.

4 132 A.G. Lloyd et al. / Virology 360 (2007) have been identified. Lens epithelium-derived growth factor (LEDGF) p75 has been identified as a primary IN binding protein (Cherepanov et al., 2003). The binding is lentiviral specific (Busschots et al., 2005; Llano et al., 2004) and LEDGF appears to tether IN to the host chromosomal DNA (Vanegas et al., 2005), thereby playing a role in site selection (Ciuffi et al., 2005) as well as facilitating integration (Vandekerckhove et al., 2006). We have shown that HIV-1 IN interacts with DNA repair protein Rad18 (Mulder et al., 2002), and that cells lacking Rad18 are more permissive to viral infection (Lloyd et al., 2006). HIV-1 IN is a substrate of the N-end rule proteasome pathway, in which the stability of a protein is determined by the identity of its N-terminal residue (Bachmair et al., 1986). HIV-1 IN is the product of the proteolytic cleavage of Gag-Pol and has at its N-terminus a Phe, a highly destabilizing residue in the N-end Fig. 3. Integrase N-terminal mutant viruses have a defect in the accumulation of cdna. Cells were infected with 100 ng WT and IN mutants of R7/3 CMV EGFP VSV-G pseudotyped virus for 5 h and late reverse transcripts were assessed by qpcr at 5, 10 and 25 h after infection. possible that the mutants may have a dominant-negative effect on reverse transcription, which would result in less substrate for integration. Since our previous results evidenced an influence of the N-terminal residue of IN on the accumulation of RT product, we quantified the amount of viral cdna synthesized after infection with WT and D116A viruses complemented with either N-terminal Met IN or WT IN. Fig. 4B shows that levels of late RT product are comparable between viruses complemented either with WT IN or its N-terminal Met mutant (t-test p>0.05), and a 2- to 4-fold lower amount of late RT product in the complemented viruses compared to the non-complemented ones regardless of the identity of the N-terminal residue. These results indicate that an excess of IN has a detrimental effect on reverse transcription and that under these conditions the Met-IN does not add to the negative effect compared to WT IN likely because the amount of complementing WT IN is enough to overwhelm the system and accordingly overshadow any further effect due to IN stabilization. Taken together, these data indicate that substitution of the N-terminal residue of HIV-1 IN results in the inability of the mutants to efficiently fulfill the integration step. Discussion Alongside RT, IN is the enzyme that distinguishes retroviruses from other viruses. IN belongs to a family of structurally related DNA transferases that includes phage transposases and mammalian VDJ recombinases RAG1 and RAG2. Recombinant HIV-1 IN has been shown to mediate a concerted in vitro integration reaction without any additional protein (Sinha et al., 2002). Recently, a number of host factors that interact with IN Fig. 4. N-terminal mutant integrase only partially rescues integration-deficient HIV-1. (A) TZM cells were infected with plr2p-r-pc-in and IN mutants complemented R7/3 CMV EGFP D116AVSV-G pseudotyped viruses, split 1:10 and assessed by flow cytometry at 2, 6 and 10 days after infection. (B) TZM cells were infected with plr2p-r-pc-in and IN mutants complemented R7/3 CMV EGFP and R7/3 CMV EGFP D116A VSV-G pseudotyped viruses for 5 h and late reverse transcripts were assessed by qpcr at 10 h after infection.

5 A.G. Lloyd et al. / Virology 360 (2007) rule. We therefore set out to test the relevance of this residue in the context of the HIV-1 early life cycle. The results of our study indicate that the identity of IN N-terminal residue is of great importance as its substitution causes a near total inhibition of viral replication (Fig. 1A). This outcome is the result of multiple defects mainly residing in the early phases of infection (Fig. 1B) and involving both reverse transcription (Fig. 3) and integration (Fig. 4A). Evidences for a role of IN in reverse transcription have previously been described. Specifically, it has been demonstrated that IN and RT directly interact in vitro (Tasara et al., 2001; Wu et al., 1999) and that a number of mutations in conserved regions of IN induce severe defects in viral cdna synthesis (Ao et al., 2005; Lu et al., 2005a, 2005c; Wu et al., 1999). Our data imply that the identity of HIV-1 IN N-terminal residue influences reverse transcription and also suggest that because of the nature of the substitution analyzed such relevance might be related to the stability of integrase via the N-end rule proteasome pathway, as we reported earlier (Mulder and Muesing, 2000). Whether and how IN increased stability harms reverse transcription or the half-life of its product is currently under investigation. We speculate that higher concentrations of IN could directly inhibit RT as suggested by Tasara et al. (2001), this is supported by the results shown in Fig. 4B, where an excess of IN (from a complementation system in trans) decreased the amount of RT products. Alternatively, IN could be the target of host factors that can prevent it from efficiently carrying out its pro-reverse transcription activity. The mechanism of integration inhibition by Met-IN is still unknown. Given that concerted integration can be efficiently achieved in vitro by recombinant Met-IN (Sinha et al., 2002), we hypothesize that increased stability of integrase might be detrimental for the repair of the single-stranded gap left after the insertion of the retroviral genome into the chromosomal DNA. Indeed, the prompt degradation of the integration complex might be necessary to allow the access of host derived DNA repair factors devoted to the closing of the gap. In this regard, it has been demonstrated that an excess of retroviral IN inhibits the access of repair polymerases to DNA gap repair reactions in vitro (Yoder and Bushman, 2000). In conclusion, we describe here that substitutions of the first residue of HIV-1 IN originate viruses with a complex phenotype, that can be classified both as class I mutants (Engelman, 1999), because of their inability to fully restore integration of integration-inactive viruses, as well as class II mutants because of their defect in the reverse transcription step. It is therefore not surprising, given the pleiotropic defects of the N-terminal IN mutant viruses, that the identity of IN first residue is almost absolutely conserved in HIV-1, HIV-2 and SIV (source: Los Alamos National Laboratory HIV Database). Materials and methods Plasmids and virus production R7/3 YU2 EGFP (Wiskerchen and Muesing, 1995)(Fig. 2A, upper) was derived from the R7/3 HIV-1 clone (Feinberg et al., 1986) in which EGFP was cloned in the Nef position and the original envelope exchanged with an YU2 Env gene. R7/3 CMV EGFP (Fig. 2A middle) was constructed by cloning the CMV EGFP expression cassette into the ENV position of the R7/3 clone. Vesicular stomatitis virus glycoprotein (VSV-G) was expressed from plasmid phcmv G (Yee et al., 1994). IN complementation vector plr2p-r-pc-in (Fig. 2A lower) was described earlier (Fletcher et al., 1997). IN point mutations were made by overlap PCR and using standard molecular biology techniques. Viral stocks were made by transfecting HEK 293T with polyethylenimine (PEI) (Polysciences Inc.) (Durocher et al., 2002). Supernatants were harvested h later, 0.45 μm filtered, aliquoted and frozen at 70 C. HIV-1 was quantified by p24 ELISA performed using the HIV-1 p24 Antigen EIA kit (Beckman Coulter). Virus concentration was obtained by loading equal amounts of the different viruses on a 20% sucrose cushion and then centrifuging at 20,000 g for 3 h at 4 C for experiments of Fig. 1C or at 35,000 g for 1.5 h at 4 C for experiments of Figs. 2B and C. Infectivity analysis and western blot For spreading infections experiments, PHA stimulated PBMCs from two different donors were infected overnight with 50 ng p24/well of R7/3 YU2 EGFP and its IN mutants in a 24-well plate, washed three times with PBS and re-fed with complete RPMI-1640 medium plus 40 units IL-2/ml, supernatant's p24 values were assessed at day 4, 6, 11, 13, 18 and 21 days post-infection. TZM cells were obtained through the AIDS Research and Reference Program, Division of AIDS, NIAID, NIH, from Dr. J. Kappes. For single round infections, TZM cells were plated in 24 well plates at 40,000 cells/well and infected with serial dilutions of the WT as well as of the IN mutant viruses. Infections were carried out overnight in the presence of 8 μg/ml of polybrene. The second day after infection cells were trypsinized, fixed with PBS 3% formaldehyde (Tousimis) and fluorescence was analyzed by flow cytometry using FACScalibour (Becton Dickinson). 20,000 events were acquired per sample. Integration was assessed by using an integration-defective R7/3 CMV EGFP virus carrying an IN with a substitution at position D116 and complemented with the plr2p-r-pc-in vector or its N-terminal mutants. We infected TZM cells and split them 1:10 at day 2, 6 and 10 post-infection in order to dilute the unintegrated viral cdna. At the same time points, aliquots of the infected cells were analyzed by flow cytometry for EGFP expression. Western blots were carried out by separating equal amounts of concentrated virions, lysed in 4 loading buffer, on a 10% polyacrylamide gel (NuPAGE, Invitrogen). Proteins were then transferred to a PVDF membrane (Immobilon, Millipore) and probed either with anti-in monoclonal antibody 6G5 (Nilsen et al., 1996) or with an HIV-1 patient serum. Membranes were then incubated with horseradish peroxidase-conjugated secondary antibodies and developed with SuperSignal West Pico

6 134 A.G. Lloyd et al. / Virology 360 (2007) (Pierce) (anti-hiv-1) or SuperSignal West Femto (Pierce) (anti-in). Quantitative PCR TZM cells plated at a density of 40,000 cells/well were infected with 100 ng/well of VSV-G pseudotyped R7/3 CMV EGFP reporter virus and its IN mutants previously treated with 150 units/ml of DNase I (Roche) for 30 min at 37 C. Infections were carried out for 5 h in the presence of 8 μg/ml of polybrene. After rinsing with PBS, cells were fed with complete medium. Cells were harvested at time points 5, 10 and 25 h post-infection, pelleted and frozen at 70 C. Total genomic DNA was extracted using QIAamp DNA Blood kit (Qiagen). Two microliters of each sample was used for qpcr. Primers used for the detection of late reverse transcription products were the following: primer GAG-3 CAGCATTATCAGAAGGAGCCAC and GAG-4 ATGTCACTTCCCCTTGGTTCTCT. SYBR green (Molecular Probes) was used as reporter fluorophore and reactions and acquisitions were performed using 7500 Real Time PCR System (Applied Biosystems). Normalization was carried out by measuring the DNA concentration of each sample using PicoGreen dsdna Quantitation Reagent (Molecular Probes) following manufacturers instructions. Data are presented as number of late reverse transcription molecules per nanogram of total genomic DNA. Acknowledgments We thank Cecilia Cheng-Mayer, Paul Bieniasz, Ines Chen and David Ho for advice, support and critically reading the manuscript. We also like to thank Wendy Chen for her help with the figures. This work was supported by grants from the National Institutes of Health (NIH) number R21 AI to L.C.F.M. and R01 AI to V.S. References Ao, Z., Fowke, K.R., Cohen, E.A., Yao, X., Contribution of the C-terminal tri-lysine regions of human immunodeficiency virus type 1 integrase for efficient reverse transcription and viral DNA nuclear import. Retrovirology 2, 62. Bachmair, A., Finley, D., Varshavsky, A., In vivo half-life of a protein is a function of its amino-terminal residue. Science 234 (4773), Bartel, B., Wunning, I., Varshavsky, A., The recognition component of the N-end rule pathway. EMBO J. 9 (10), Busschots, K., Vercammen, J., Emiliani, S., Benarous, R., Engelborghs, Y., Christ, F., Debyser, Z., The interaction of LEDGF/p75 with integrase is lentiviral-specific and promotes DNA binding. J. Biol. Chem. 280 (18), Cherepanov, P., Maertens, G., Proost, P., Devreese, B., Van Beeumen, J., Engelborghs, Y., De Clercq, E., Debyser, Z., HIV-1 integrase forms stable tetramers and associates with LEDGF/p75 protein in human cells. J. Biol. Chem. 278 (1), Ciuffi, A., Llano, M., Poeschla, E., Hoffmann, C., Leipzig, J., Shinn, P., Ecker, J.R., Bushman, F., A role for LEDGF/p75 in targeting HIV DNA integration. Nat. Med. 11 (12), Dohmen, R.J., Madura, K., Bartel, B., Varshavsky, A., The N-end rule is mediated by the UBC2(RAD6) ubiquitin-conjugating enzyme. Proc. Natl. Acad Sci. U. S. A. 88 (16), Durocher, Y., Perret, S., Kamen, A., High-level and high-throughput recombinant protein production by transient transfection of suspensiongrowing human 293-EBNA1 cells. Nucleic Acids Res. 30 (2), E9. Engelman, A., In vivo analysis of retroviral integrase structure and function. Adv. Virus Res. 52, Engelman, A., Englund, G., Orenstein, J.M., Martin, M.A., Craigie, R., Multiple effects of mutations in human immunodeficiency virus type 1 integrase on viral replication. J. Virol. 69 (5), Feinberg, M.B., Jarrett, R.F., Aldovini, A., Gallo, R.C., Wong-Staal, F., HTLV-III expression and production involve complex regulation at the levels of splicing and translation of viral RNA. Cell 46 (6), Fletcher III, T.M., Soares, M.A., McPhearson, S., Hui, H., Wiskerchen, M., Muesing, M.A., Shaw, G.M., Leavitt, A.D., Boeke, J.D., Hahn, B.H., Complementation of integrase function in HIV-1 virions. EMBO J. 16 (16), Koken, M.H., Reynolds, P., Jaspers-Dekker, I., Prakash, L., Prakash, S., Bootsma, D., Hoeijmakers, J.H., Structural and functional conservation of two human homologs of the yeast DNA repair gene RAD6. Proc. Natl. Acad Sci. U. S. A. 88 (20), Llano, M., Vanegas, M., Fregoso, O., Saenz, D., Chung, S., Peretz, M., Poeschla, E.M., LEDGF/p75 determines cellular trafficking of diverse lentiviral but not murine oncoretroviral integrase proteins and is a component of functional lentiviral preintegration complexes. J. Virol. 78 (17), Lloyd, A.G., Tateishi, S., Bieniasz, P.D., Muesing, M.A., Yamaizumi, M., Mulder, L.C., Effect of DNA repair protein Rad18 on viral infection. PLoS Pathog 2 (5), e40. Lu, R., Limon, A., Ghory, H.Z., Engelman, A., 2005a. Genetic analyses of DNA-binding mutants in the catalytic core domain of human immunodeficiency virus type 1 integrase. J. Virol. 79 (4), Lu, R., Vandegraaff, N., Cherepanov, P., Engelman, A., 2005b. Lys-34, dispensable for integrase catalysis, is required for preintegration complex function and human immunodeficiency virus type 1 replication. J. Virol. 79 (19), Lu, R., Ghory, H.Z., Engelman, A., 2005c. Genetic analyses of conserved residues in the carboxyl-terminal domain of human immunodeficiency virus type 1 integrase. J. Virol. 79 (16), Madura, K., Dohmen, R.J., Varshavsky, A., N-recognin/Ubc2 interactions in the N-end rule pathway. J. Biol. Chem. 268 (16), Mulder, L.C., Muesing, M.A., Degradation of HIV-1 integrase by the N-end rule pathway. J. Biol. Chem. 275 (38), Mulder, L.C., Chakrabarti, L.A., Muesing, M.A., Interaction of HIV-1 integrase with DNA repair protein hrad18. J. Biol. Chem. 277 (30), Nilsen, B.M., Haugan, I.R., Berg, K., Olsen, L., Brown, P.O., Helland, D.E., Monoclonal antibodies against human immunodeficiency virus type 1 integrase: epitope mapping and differential effects on integrase activities in vitro. J. Virol. 70 (3), Sinha, S., Pursley, M.H., Grandgenett, D.P., Efficient Concerted Integration by Recombinant Human Immunodeficiency Virus Type 1 Integrase without Cellular or Viral Cofactors. J. Virol. 76 (7), Tasaki, T., Mulder, L.C., Iwamatsu, A., Lee, M.J., Davydov, I.V., Varshavsky, A., Muesing, M., Kwon, Y.T., A family of mammalian E3 ubiquitin ligases that contain the UBR box motif and recognize N-degrons. Mol. Cell. Biol. 25 (16), Tasara, T., Maga, G., Hottiger, M.O., Hubscher, U., HIV-1 reverse transcriptase and integrase enzymes physically interact and inhibit each other. FEBS Lett. 507 (1), Vandekerckhove, L., Christ, F., Van Maele, B., De Rijck, J., Gijsbers, R., Van den Haute, C., Witvrouw, M., Debyser, Z., Transient and stable knockdown of the integrase cofactor LEDGF/p75 reveals its role in the replication cycle of human immunodeficiency virus. J. Virol. 80 (4), Vanegas, M., Llano, M., Delgado, S., Thompson, D., Peretz, M., Poeschla, E., Identification of the LEDGF/p75 HIV-1 integrase-interaction domain and NLS reveals NLS-independent chromatin tethering. J. Cell Sci. 118 (Pt 8), Varshavsky, A., The ubiquitin system. Trends Biochem. Sci. 22 (10),

7 A.G. Lloyd et al. / Virology 360 (2007) Wiskerchen, M., Muesing, M.A., Human immunodeficiency virus type 1 integrase: effects of mutations on viral ability to integrate, direct viral gene expression from unintegrated viral DNA templates, and sustain viral propagation in primary cells. J. Virol. 69 (1), Wu, X., Liu, H., Xiao, H., Conway, J.A., Hehl, E., Kalpana, G.V., Prasad, V., Kappes, J.C., Human immunodeficiency virus type 1 integrase protein promotes reverse transcription through specific interactions with the nucleoprotein reverse transcription complex. J. Virol. 73 (3), Yee, J.K., Friedmann, T., Burns, J.C., Generation of high-titer pseudotyped retroviral vectors with very broad host range. Methods Cell Biol. 43 (Pt A), Yoder, K.E., Bushman, F.D., Repair of gaps in retroviral DNA integration intermediates. J. Virol. 74 (23),