Long-term exposure to Myozyme results in a decrease of anti-drug antibodies in lateonset Pompe disease patients

Supplementary Document

Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.

Cours Pasteur. Molecular Cancer Genetics. September 18-29, 2017

Cours Pasteur Molecular Cancer Genetics September 18-29, 2017 Directors François CLEMENT-BIDARD Co-director, Institut Curie Hospital Jean-Pierre VARTANIAN Co-director, Institut Pasteur PROGRAM 2017-2018

Supplementary Materials

Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

Opinion 9 January 2013

The legally binding text is the original French version TRANSPARENCY COMMITTEE Opinion 9 January 2013 The draft opinion adopted by the Transparency Committee on 7 November 2012 was the subject of a hearing

Accepted Manuscript. Letter to the Editor. Reply to: From the CUPIC study: Great times are not coming (?)

Accepted Manuscript Letter to the Editor Reply to: From the CUPIC study: Great times are not coming (?) Christophe Hezode, Helene Fontaine, Yoann Barthe, Fabrice Carrat, Jean-Pierre Bronowicki PII: S0-()00-

c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP

Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative

Supplementary Figure 1

Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated

Spontaneous Control of Viral Replication during Primary HIV Infection: When Is HIV Controller Status Established?

HIV/AIDS BRIEF REPORT Spontaneous Control of Viral Replication during Primary HIV Infection: When Is HIV Controller Status Established? Cécile Goujard, 1,2 Marie-Laure Chaix, 3 Olivier Lambotte, 1,2 Christiane

Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments

SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M

Supplementary Figure 1 a

Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans

Background 11/8/2011. Disclosure. Hereditary Periodic Fever Syndromes Mutations in Idiopathic Acute Recurrent Pericarditis.

Mutations in Idiopathic Acute Recurrent Pericarditis Disclosure I have no relevant financial relationships to disclose Guillaume Geri, Pierre Hausfater, Catherine Dodé, Zahir Amoura, Jean-Charles Piette,

BALANCE BETWEEN ESTROGENS AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION

BALANCE BETWEEN ESTROGE AND PROINFLAMMATORY CYTOKINES REGULATES CHEMOKINE PRODUCTION INVOLVED IN THYMIC GERMINAL CENTER FORMATION Nadine Dragin 1, 2, 3,, Patrice Nancy 4, José Villegas 2, 3, 5, Régine

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.

Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons

Supplementary Table 1. PIK3CA mutation in colorectal cancer

Liao X et al. PIK3CA Mutation in Colorectal Cancer. Page 1 Supplementary Table 1. PIK3CA mutation in colorectal cancer Exon Domain Nucleotide change* Amino acid change* cases 9 Helical c.1621t>a p.e541t

CHAPTER IV RESULTS Microcephaly General description

47 CHAPTER IV RESULTS 4.1. Microcephaly 4.1.1. General description This study found that from a previous study of 527 individuals with MR, 48 (23 female and 25 male) unrelated individuals were identified

Names for ABO (ISBT 001) Blood Group Alleles

Names for ABO (ISBT 001) blood group alleles v1.1 1102 Names for ABO (ISBT 001) Blood Group Alleles General description: The ABO system was discovered as in 1900 and is considered the first and clinically

McAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers.

Mclpine PERK-GSK3 regulates foam cell formation Supplemental Material Supplementary Table I. Sequences of real time PCR primers. Primer Name Primer Sequences (5-3 ) Product Size (bp) GRP78 (human) Fwd:

Names for H (ISBT 018) Blood Group Alleles

Names for H (ISBT 018) Blood Group Alleles General description: The H blood group system consists of one antigen, H, that is carried on glycolipids and glycoproteins on the RBC membrane, where it is synthesised

July 2015 Assay ID Assay Name Gene COSMIC ID Amino acid change Nucleotide change Wild type allele (VIC label) Mutant allele (FAM label)

July 2015 Assay ID Assay Name Gene COSMIC ID Amino acid change Nucleotide change Wild type allele (VIC label) Mutant allele (FAM label) p AHLJ090 AKT1_33765 AKT1 33765 p.e17k c.49g>a C T 2 AHBKFRM BRAF_473

SUPPLEMENTARY INFORMATION. Rare independent mutations in renal salt handling genes contribute to blood pressure variation

SUPPLEMENTARY INFORMATION Rare independent mutations in renal salt handling genes contribute to blood pressure variation Weizhen Ji, Jia Nee Foo, Brian J. O Roak, Hongyu Zhao, Martin G. Larson, David B.

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in

Immune system and diabetes. Chairmen: J. Belkhadir (Morocco) N.M. Lalic (Serbia)

Immune system and diabetes Chairmen: J. Belkhadir (Morocco) N.M. Lalic (Serbia) Autoimmunity and prevention of type 1 diabetes R. Mallone (France) Autoimmunity and Prevention of Type 1 Diabetes Roberto

Intron p Hybrid with p.leu245val p. Gly336Cys. p.leu62phe p. Ala137Val p. Asn152Thr hybrid with p.leu245val p.

RHD negative, i.e. null Phenotype Allele name Nucleotide change Exon Predicted amino acid change D RHD*01N.01 RHD deletion 1-10 p.0 Allele name detail Comments D RHD*08N.01 RHD*Pseudogene RHD* Ψ 37- bp

DEVELOPING A FOLLOW-UP FRAMEWORK FOR POMPE DISEASE

DEVELOPING A FOLLOW-UP FRAMEWORK FOR POMPE DISEASE Presenter: Sarah Bradley, MS, CGC Genetic Counselor, NYS Newborn Screening Program Authors: S. Bradley, D. Kronn, B. Vogel, M. Caggana, J. Orsini, K.

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53

1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,

Short communication Genetic barriers for integrase inhibitor drug resistance in HIV type-1 B and CRF02_AG subtypes

Antiviral Therapy 14:123 129 Short communication Genetic barriers for integrase inhibitor drug resistance in HIV type-1 B and CRF2_AG subtypes Almoustapha-Issiaka Maïga 1, Isabelle Malet 1 *, Cathia Soulie

Supplementary Table e1. Clinical and genetic data on the 37 participants from the WUSM

Supplementary Data Supplementary Table e1. Clinical and genetic data on the 37 participants from the WUSM cohort. Supplementary Table e2. Specificity, sensitivity and unadjusted ORs for glioma in participants

Supplemental Table 1. The list of variants with their respective scores for each variant classifier Gene DNA Protein Align-GVGD Polyphen-2 CADD MAPP

Supplemental Table 1. The list of variants with their respective scores for each variant classifier Gene DNA Protein Align-GVGD Polyphen-2 CADD MAPP Frequency Domain Mammals a 3 S/P b Mammals a 3 S/P b

Cours Pasteur. Molecular Cancer Genetics. September 24 October 5, Directors Jean-Pierre VARTANIAN Institut Pasteur. Sarah WATSON Institut Curie

Cours Pasteur Molecular Cancer Genetics September 24 October 5, 2018 Directors Jean-Pierre VARTANIAN Institut Pasteur Sarah WATSON Institut Curie PROGRAM 2018-2019 Molecular Cancer Genetics Room 4 & Laboratory

www.lessonplansinc.com Topic: Protein Synthesis - Sentence Activity Summary: Students will simulate transcription and translation by building a sentence/polypeptide from words/amino acids. Goals & Objectives:

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.

Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG

Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at

Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for

Nature Genetics: doi: /ng Supplementary Figure 1. TNFAIP3-associated haplotypes in family 1.

Supplementary Figure 1 TNFAIP3-associated haplotypes in family 1. The p.leu227* mutation (shown as a star) arose de novo in the first affected member of the family (P1). Red haplotypes carry the TNFAIP3

Mauhin et al. Orphanet Journal of Rare Diseases (2018) 13:127 (Continued on next page)

Mauhin et al. Orphanet Journal of Rare Diseases (2018) 13:127 https://doi.org/10.1186/s13023-018-0877-4 RESEARCH Open Access Deep characterization of the anti-drug antibodies developed in Fabry disease

Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac

ONLINE SUPPLEMENT TO Crosstalk between mineralocorticoid and angiotensin II signaling for cardiac remodeling An Di ZHANG,,3, Aurelie NGUYEN DINH CAT*,,3, Christelle SOUKASEUM *,,3, Brigitte ESCOUBET, 4,

Integration Solutions

Integration Solutions (1) a) With no active glycosyltransferase of either type, an ii individual would not be able to add any sugars to the O form of the lipopolysaccharide. Thus, the only lipopolysaccharide

Supplementary Figure 1

Supplementary Figure 1 A B HEC1A PTEN +/+ HEC1A PTEN -/- 16 HEC1A PTEN -/- 22 PTEN RAD51 % Cells with RAD51 foci 40 -IR +IR 30 20 10 * *! TUBULIN 0 HEC1A PTEN+/+ HEC1A PTEN-/- 16 HEC1A PTEN-/- 22 C D 1.0

Supplementary Appendix

Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate

Faiez Zannad, MD, PhD, Nancy

1 Biotargets, drug discovery and therapeutic innovation. How French clinical networks can accelerate the discovery of new treatments in the field of cardiovascular and metabolic diseases? Faiez Zannad,

SUPPLEMENTARY INFORMATION

doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α

Mapping by recurrence and modelling the mutation rate

Mapping by recurrence and modelling the mutation rate Shamil Sunyaev Broad Institute of M.I.T. and Harvard Current knowledge is from Comparative genomics Experimental systems: yeast reporter assays Potential

Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade

Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha

ECMO/ECCO 2 R in Acute Respiratory Failure

ECMO/ECCO 2 R in Acute Respiratory Failure Alain Combes, MD, PhD, Hôpital Pitié-Salpêtrière, AP-HP Inserm UMRS 1166, ican, Institute of Cardiometabolism and Nutrition Sorbonne Pierre et Marie Curie University,

TP53 mutational profile in CLL : A retrospective study of the FILO group.

TP53 mutational profile in CLL : A retrospective study of the FILO group. Fanny Baran-Marszak Hopital Avicenne Bobigny France 2nd ERIC workshop on TP53 analysis in CLL, Stresa 2017 TP53 abnormalities :

Use of panel tests in place of single gene tests in the cancer genetics clinic

Clin Genet 2015: 88: 278 282 Printed in Singapore. All rights reserved CLINICAL GENETICS doi: 10.1111/cge.12488 Short Report se of panel tests in place of single gene tests in the cancer genetics clinic

Characterizing intra-host influenza virus populations to predict emergence

Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems

Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast

Supplemental Figures, Tables and Results Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast Sami Hocine 1, Pascal Raymond 2, Daniel Zenklusen 2, Jeffrey A. Chao 1 &

Supplementary Information

Supplementary Information Structural aspects of messenger RNA maintenance by the ribosome Lasse B. Jenner 1,2, Natalia Demeshkina 1,3, Gulnara Yusupova 1,3* and Marat Yusupov 1,3*. 1 Institut de Génétique

Newborn Screening and Studies of Lysosomal Storage Diseases in CFOH

Newborn Screening and Studies of Lysosomal Storage Diseases in CFOH Chinese Foundation of Health National Yang-Ming University Director: Dr. Chuan-Chi Chiang Speaker: Hsuan-Chieh Liao (Joyce) 1 Newborn

What do you think of when you here the word genome?

What do you think of when you here the word genome? What do you think of when you here the word genome? Personal Genomics Outline Review of pre-lab work Genomics and Medicine Case Overview & Assignment

A positron emission tomography activation study

Brain synergistic effects: cochlear implant and contralateral hearing aid A positron emission tomography activation study Arnaud Coez 1,2, Evelyne Ferrary 3,4,5, Didier Bouccara 3,4,5, Isabelle Mosnier

Supplementary Figure 1

Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice

Supplementary Material

Supplementary Material accompanying the manuscript Interleukin 37 is a fundamental inhibitor of innate immunity Marcel F Nold, Claudia A Nold-Petry, Jarod A Zepp, Brent E Palmer, Philip Bufler & Charles

Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N

MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using

Whole Exome Sequenced Characteristics

Supplementary Tables Supplementary Table 1: Patient characteristics of 45 whole exome sequenced HNSCC tumors Whole Exome Sequenced Characteristics Tumors (n=45) Age, years Median (range) 61.0 (19-90) Sex,

Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12

1 Supplementary Data Figure legends Supplementary Figure 1. IL-12 serum levels and frequency of subsets in FL patients. (A) IL-12 serum levels measured by multiplex ELISA (Luminex) in FL patients before

Multi-template approaches for segmenting the hippocampus: the case of the SACHA software

Multi-template approaches for segmenting the hippocampus: the case of the SACHA software Ludovic Fillon, Olivier Colliot, Dominique Hasboun, Bruno Dubois, Didier Dormont, Louis Lemieux, Marie Chupin To

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control

modified dye uptake assay including formazan test EC 90 not tested plaque reduction assay

Sauerbrei A, Bohn-Wippert K, Kaspar M, Krumbholz A, Karrasch M, Zell R. 2015. Database on natural polymorphisms and resistance-related non-synonymous mutations in thymidine kinase and DNA polymerase genes

NC bp. b 1481 bp

Kcna3 NC 11 178 p 1481 p 346 p c *** *** d relative expression..4.3.2.1 CD4 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna Kcna6 Kcna7 Kcnn4 relative expression..4.3.2.1 CD8 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna

Beta Thalassemia Case Study Introduction to Bioinformatics

Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha

Genetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT

GBinsight Sample Name: GB4411 Race: Gender: Female Reason for Testing: Type 2 diabetes, early onset MRN: 0123456789 Specimen: Saliva Received: 07/26/2016 Test ID: 113-1487118782-4 Test: Type 2 Diabetes

SUPPLEMENTAL INFORMATION. Impaired TLR9 responses in B cells from patients with systemic lupus erythematosus

1 SUPPLEMENTAL INFORMATION 2 3 4 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 2 21 22 23 24 25 26 27 28 29 3 31 32 33 34 35 36 37 38 39 4 Impaired TLR9 responses in B cells from patients with systemic lupus

Hypoglycaemia revealing heterozygous insulin receptor mutations.

Hypoglycaemia revealing heterozygous insulin receptor mutations. Vanessa Preumont, Christine Feincoeur, Olivier Lascols, Carine Courtillot, Philippe Touraine, Dominique Maiter, Corinne Vigouroux To cite

BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL

1 2 3 4 Materials and Methods Cell culture BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) 5 supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 6 penicillin-streptomycin.

Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.

University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.

Mapping of the influenza A hemagglutinin serotypes evolution by the ISSCOR method

Regular paper Supplementary Materials pp 441 452 Vol. 61, 2014 on-line at: www.actabp.pl Mapping of the influenza A hemagglutinin serotypes evolution by the ISSCOR method Jan P. Radomski 1,4 *, Piotr P.

BIOLOGY 621 Identification of the Snorks

Name: Date: Block: BIOLOGY 621 Identification of the Snorks INTRODUCTION: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on

INNATE IMMUNITY and INFECTIOUS DISEASES

INNATE IMMUNITY and INFECTIOUS DISEASES April 10-25, 2017 PRELIMINARY INNATE IMMUNITY AND INFECTIOUS DISEASES COURSE (from April 10 to April 25, 2017) This two and half week long course offers lectures

SUPPLEMENTAL FIGURE 1

SUPPLEMENTL FIGURE 1 C Supplemental Figure 1. pproach for removal of snorns from Rpl13a gene. () Wild type Rpl13a exonintron structure is shown, with exo in black and intronic snorns in red rectangles.

Supplementary Table 2. Identified causative mutations and/or mutation candidates.

Supplementary Table 2. Identified causative mutations and/or mutation candidates. Nonsense mutations base change aa change Average depth Result of next generation in 432 patient Hereditary form of the

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.

Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA

Asier Sáez-Cirión, PhD Unité de Régulation des Infections Rétrovirales Institut Pasteur, Paris, France

Infection à VIH : une rémission possible Asier Sáez-Cirión, PhD Unité de Régulation des Infections Rétrovirales Institut Pasteur, Paris, France Viral reservoirs persist in HIV-infected individuals receiving

Genetic and biochemical characteristics of patients with hyperlipidemia who require LDL apheresis

Genetic and biochemical characteristics of patients with hyperlipidemia who require LDL apheresis Mato Nagel, Ioan Duma, Constantina Vlad, Mandy Benke, Sylvia Nagorka Zentrum für Nephrologie & Stoffwechsel,

Trial Objectives immunogenicity safety

Optimal priming of poxvirus vector (NYVAC)-based HIV vaccine regimens requires 3 DNA injections. Long term Results of the EV03/ANRS Vac20 Phase I/II Trial. Yves Levy, Kim Ellefsen, Wolfgang Stöehr, Pierre-Alexandre

Étude de la coopération entre les cellules dendritiques et les lymphocytes T dans les allergies aux produits chimiques FPH42

Étude de la coopération entre les cellules dendritiques et les lymphocytes T dans les allergies aux produits chimiques FPH42 Dr Diane Antonios-Gholam PharmD, PhD Laboratoire de Toxicologie Clinique et

A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly

Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging

Supplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota

Supplementary Information Bamboo shoot fiber prevents obesity in mice by modulating the gut microbiota Xiufen Li 1,2, Juan Guo 1, Kailong Ji 1,2, and Ping Zhang 1,* 1 Key Laboratory of Tropical Plant Resources

MUTATION TEST CE IVD. ctnras-braf FEATURES

ctnras-braf CE IVD TECHNICAL SHEET IDYLLA ctnras-braf MUTATION TEST The Idylla ctnras-braf Mutation Test, performed on the Biocartis Idylla System, is an in vitro diagnostic test for the qualitative detection

Table S1. Primers used to quantitatively amplify the human mirnas precursors and indicated genes

Table S1. Primers used to quantitatively amplify the human mirnas precursors and indicated genes Forward primer (5 3 ) Rervese primer (5 3 ) U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT 5S TACGGCCATACCACCCTGAA

CD80 and PD-L2 define functionally distinct memory B cell subsets that are. Griselda V Zuccarino-Catania, Saheli Sadanand, Florian J Weisel, Mary M

Supplementary Figures CD8 and PD-L define functionally distinct memory B cell subsets that are independent of antibody isotype Running title: Memory B Cell Subset Function Griselda V Zuccarino-Catania,

Factane : from product characteristics to clinical efficiency The experience in immune tolerance induction

Factane : from product characteristics to clinical efficiency The experience in immune tolerance induction Prof. Benoît POLACK, MD, PhD University Hospital - Grenoble, France CNRS UJF UMR 5525 Adana, May

Reply to The question of heterogeneity in Marfan syndrome

Reply to The question of heterogeneity in Marfan syndrome Catherine Boileau, Claudine Junien, Gwenaëlle Collod, Guillaume Jondeau, Olivier Dubourg, Jean-Pierre Bourdarias, Catherine Bonaïti-Pellié, Jean

C-reactive protein levels in relation to various features of non-alcoholic fatty liver

C-reactive protein levels in relation to various features of non-alcoholic fatty liver disease among obese patients Esther Zimmermann 1,2, Rodolphe Anty 3,4,5, Joan Tordjman 6,7,8, An Verrijken 9, Philippe

Shedding after in situ raav delivery

Shedding after in situ raav delivery Review of the literature a 8 years of experience in Nantes in large animal models Caroline LE GUINER, PhD INSERM U649 (Philippe MOULLIER) Gene Therapy Laboratory Nantes

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Parkinson disease 8, automsomal dominant OMIM number for disease 607060 Disease

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described

Durable and sustained immune tolerance to ERT in Pompe disease with entrenched immune responses

Durable and sustained immune tolerance to ERT in Pompe disease with entrenched immune responses Zoheb B. Kazi, 1 Sean N. Prater, 1 Joyce A. Kobori, 2 David Viskochil, 3 Carrie Bailey, 3 Renuka Gera, 4

Title: Usefulness of Kaposi sarcoma-associated herpesvirus (KSHV)-DNA viral. load in whole blood for the diagnosis and monitoring of KSHV-associated

JCM Accepted Manuscript Posted Online 11 April 2018 J. Clin. Microbiol. doi:10.1128/jcm.00569-18 Copyright 2018 American Society for Microbiology. All Rights Reserved. 1 2 3 Title: Usefulness of Kaposi

Treatment of Cardiac Disease in Propionic Acidemia

Treatment of Cardiac Disease in Propionic Acidemia Kathryn Chatfield, MD, PhD Instructor of Pediatrics, Division of Cardiology University of Colorado School of Medicine Children s Hospital Colorado How

Chorea as the presenting manifestation of primary Sjögren s syndrome in a child

Chorea as the presenting manifestation of primary Sjögren s syndrome in a child Cécile Delorme, Fleur Cohen, Cécile Hubsch, Emmanuel Roze To cite this version: Cécile Delorme, Fleur Cohen, Cécile Hubsch,

Beyond the next generation: data mining and T cells. Amanda Semper, Scientific Programmes Manager, PHE Rare and Imported Pathogens Laboratory

Beyond the next generation: data mining and T cells Amanda Semper, Scientific Programmes Manager, PHE Rare and Imported Pathogens Laboratory Overview Data mining Getting the most from diagnostic data The

Beta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015

Bioinformatics in Medical Product Development SMPD 287 Three Beta Thalassemia Sami Khuri Department of Computer Science San José State University Hemoglobin Outline Anatomy of a gene Hemoglobinopathies

Viral quantification and filogenetic analysis Chikungunya virus strains imported to Italy Antonino Di Caro

Viral quantification a filogenetic analysis Chikungunya virus strains imported to Italy Antonino Di Caro National Institute for Infectious Diseases L. Spallanzani, Rome BACKGROUND 1 Since 2005, more than

Supplementary Online Content

Supplementary Online Content Ku CA, Hull S, Arno G, et al. Detailed clinical phenotype and molecular genetic findings in CLN3-associated isolated retinal degeneration. JAMA Ophthalmol. Published online

Obesity, Inflammation and Liver Cancer

Obesity, Inflammation and Liver Cancer Richard Moreau, M.D., 1 INSERM U773, Centre de Recherche Biomédicale Bichat-Beaujon CRB3, 2 Université Denis Diderot Paris 7, 3 Service d Hépatologie, Hôpital Beaujon,

ESEMeD/MHEDEA The European Study of the Epidemiology of Mental Disorders/Mental Health Disability : a

ESEMeD/MHEDEA 2000 - The European Study of the Epidemiology of Mental Disorders/Mental Health Disability : a European Assessment in the year 2000 (ESEMeD/MHEDEA 2000) Head : Kovess-Masfety Viviane, INSERM

Treatment of postpartum haemorrhage: NATA consensus statement

Treatment of postpartum haemorrhage: NATA consensus statement Jakob Stensballe MD, PhD, Consultant Anaesthetist & Transfusion Specialist Chair of Scientific Committee, NATA Section for Transfusion Medicine,

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from