T(14;18) Translocation in Chronic Hepatitis C Virus Infection

Transcription

1 T(14;18) Translocation in Chronic Hepatitis C Virus Infection ANNA LINDA ZIGNEGO, 1 FRANCESCA GIANNELLI, 1 MARIA EUGENIA MARROCCHI, 1 ANTONIO MAZZOCCA, 1 CLODOVEO FERRI, 2 CARLO GIANNINI, 1 MONICA MONTI, 1 PATRIZIO CAINI, 1 GIORGIO LA VILLA, 1 GIACOMO LAFFI, 1 AND PAOLO GENTILINI 1 Pathogenic mechanisms of B-cell lymphoproliferative disorders in chronic hepatitis C virus (HCV) infection are unclear. We studied t(14;18) translocation by polymerase chain reaction in peripheral blood mononuclear cells from 50 patients with HCV-related liver disease (group A), 7 with mixed cryoglobulinemia syndrome (group B), 55 with HCV-negative liver disease (group C), and 30 with HCVnegative chronic rheumatic disorders or chronic infection by nonhepatotropic agents (group D). T(14;18) was significantly more frequent in group A (13/50 patients 26 %) and group B (5/7 71.4%) patients than in group C (1/55 3.6%) and group D (1/30 3.3%) ones. Immunoblot analysis showed bcl-2 over-expression in all t(14;18)- positive samples. In group A, 10/13 (77%) patients with t(14;18) and 13/37 (35%) without t(14;18) had serum cryoglobulins in the absence of mixed cryoglobulinemia symptoms (P F.05). These data indicate that t(14;18) and bcl-2 over-expression in lymphoid cells are frequent in chronic HCV infection and suggest that this event may contribute to the pathogenesis of HCV-related lymphoproliferative disorders. (HEPATOLOGY 2000;31: ) Hepatitis C virus (HCV) infection has been associated with a series of B-cell lymphoproliferative disorders (LPDs), including essential mixed cryoglobulinemia (MC), B-cell non-hodgkin s lymphoma (NHL), and monoclonal gammopathies. 1-4 The mechanisms involved in LPDs, either virusrelated or virus-independent, are complex and still poorly defined. MC, the LPD most strictly associated with HCV infection, is a borderline (benign/malignant) disorder in that it frequently coexists with bone-marrow aspects of NHL and evolves, in about 5% to 8% of cases, into a clinically frank B-cell malignancy. 5,6 In addition, clonal expansion of IgMproducing B cells has been detected in patients with HCVpositive MC (HCV/MC). 7 Recently, 1 patient with HCV/MC has been shown to develop a monoclonal multistep lymphoproliferative disorder associated with t(14;18) translocation in the benign phase of the disease and additional genetic alterations in the accelerated one. 8 Over-expression of bcl-2 oncoprotein has been shown by immunohistochemistry in liver lymphocyte aggregates not only in the majority of HCV-positive MC, but also in about 45% of patients with chronic HCV-related hepatitis without MC. 9 The recombination of anti-apoptotic bcl-2 proto-oncogene [t(14;18)] has been widely investigated in the field of lymphomagenetic studies. Following t(14;18), the bcl-2 locus, normally located in chromosome 18, is juxtaposed with the immunoglobulin heavy chain locus (IgH), leading to bcl-2 activation. This genetic aberration, which occurs during early B-cell development, appears to be 1 step toward the progression of a normal cell to a cancer cell 10 ; in particular, its importance in regards to cooperative activities with different oncogenes, such as c-myc, has been experimentally shown. T(14;18) characterizes most follicular B-cell lymphomas as well as some diffuse ones. Recent data show that, among idiopathic HCV-positive NHL, follicular center lymphoma represents the most common variety. 11,5 T(14;18) is interpreted as an error during the VDJ-gene rearrangement process in Ig genes and may take place following strong antigenic stimulation because it is also detectable in benign follicular hyperplasia. 12 In the current investigation, we studied the occurrence of bcl-2 recombination in peripheral blood mononuclear cells from patients with chronic HCV infection with or without MC in comparison with patients with HCVnegative chronic liver disease (CLD), chronic rheumatic disorders other than MC, and chronic infections by nonhepatotropic agents. Abbreviations: HCV, hepatitis C virus; LPD, lymphoproliferative disorder; MC, mixed cryoglobulinemia; NHL, non-hodgkin s lymphoma; IgH, immunoglobulin heavy chain; CLD, chronic liver disease; CH, chronic hepatitis; C, cirrhosis; HCC, hepatocellular carcinoma; CGs, cryoglobulins; PBMC, peripheral blood mononuclear cells; PCR, polymerase chain reaction; RT, reverse transcription; VDJ, variable, diversity, joining gene segments. From the 1 Department of Internal Medicine, University of Florence, School of Medicine, Florence, and the 2 Rheumatology Unit, Department of Internal Medicine, University of Pisa, School of Medicine, Pisa, Italy. Received April 9, 1999; accepted November 2, Supported by the Istituto Superiore di Sanità (ISS), Research Project on Viral Hepatitis: Etiopathogenesis and Diagnosis; the Associazione Italiana Ricerca sul Cancro (AIRC); the Italian Liver Foundation, MURST, and the Fondazione Istituto di Ricerca Virologica O.B. Corsi. Address reprint requests to: Anna Linda Zignego, M.D., Ph.D., Department of Internal Medicine, University of Florence, School of Medicine, Viale Morgagni, 85 I-50134, Florence, Italy. a.zignego@dfc.unifi.it; fax: Copyright 2000 by the American Association for the Study of Liver Diseases /00/ $3.00/0 474 MATERIALS AND METHODS Patients We studied 4 groups of patients consecutively referred to the out-patient clinic at the Department of Internal Medicine, University of Florence School of Medicine, between January 1998 and August Group A included 50 patients (31 males, mean age 50.9, range years) with HCV-related CLD (28 with chronic hepatitis [CH], 19 with cirrhosis [C], and 3 with C and superimposed hepatocellular carcinoma [HCC]) and the following characteristics: presence of circulating anti-hcv antibodies and HCV-RNA, absence of any previous anti-viral and/or immunosuppressive treatment, no evidence of alcohol abuse or other causes of liver disease, and no symptoms of MC syndrome. Group A patients were negative for HBsAg, HBV-DNA, anti-hbc (IgM), -delta, -EBV, -CMV, -HSV, and -HIV. Group B included 7 anti-hcv and serum HCV-RNA positive patients with type II (IgMK) MC (2 males, mean age 54.5, range years). Type II MC was diagnosed according to already

2 HEPATOLOGY Vol. 31, No. 2, 2000 ZIGNEGO ET AL. 475 described criteria. 1 In particular, all group-b patients had detectable serum cryoglobulins (CGs) for more than 6 months and at least 2 of the following criteria: palpable purpura, positive IgM-RF Latex test, and low C4 levels. All group-b patients had histologically proven CLD (Table 1). Group C included 55 patients (28 males, mean age 51.2, range years) with anti-hcv negative, HCV-RNA negative, histologically proven CLD (chronic hepatitis in 27, cirrhosis in 23, and cirrhosis with superimposed HCC in 5 patients) similar to those of group A with respect to age and sex. CLD was HBV related (HBsAg, IgM anti-hbc, and HBV-DNA positive) in 27 patients, HDV related (IgM anti-hdv positive) in 5, alcoholic in 17, and primary biliary cirrhosis in 6, respectively. Group D included 30 patients (14 males, mean age 54.2, range years) with chronic rheumatic disorders (10 patients with systemic lupus erythematosus [SLE], 4 with rheumatoid arthritis [RA], and 5 with systemic sclerosis [SSc]), or chronic infective diseases (7 with human immunodeficiency virus [HIV] infection, 2 with pulmonary tuberculosis, and 1 with syphilis]). All patients in this group were anti-hcv/hcv-rna negative and had no evidence of liver disease. All patients gave their written informed consent to participate in the study, which was performed in accordance to the Principles of the Declaration of Helsinki and approved by the local Ethics Committee. TABLE 1. Clinical Data and Frequency of t(14;18) Translocation in the 4 Groups of Patients Included in the Study Group Liver Histology N N (%) Patients With t(14; 18) Sex (M/F) Mean Age (Years) Serum Cryoglobulins [N (%)] A (26) 5/ (77) Chronic hepatitis (38.4) Cirrhosis 19 3 (17.6) Cirrhosis HCC 3 0 B 7 5 (71.4) 2/ (100) Chronic hepatitis 5 5 (100) Cirrhosis 2 0 Cirrhosis HCC 0 0 C 55 2 (3.6) 2/ (50) Chronic hepatitis 27 0 Cirrhosis 23 2 (9) Cirrhosis HCC 5 0 D 30 1 (3.3) 1/ not done NOTE. Group A HCV-related chronic liver disease, group B HCV-related chronic liver disease with type II mixed cryoglobulinemia, group C HCV-negative chronic liver disease, and group D chronic rheumatic disorders/chronic non-hepatotropic infections , P Fisher s exact test group A vs. group B: P.027, group A vs. group C: P.0015, group A vs. group D: P.013; group B vs. group C: P , group B vs. group D: P Analytical Determinations bcl-2/j H. Detection of bcl-2/j H fusion in peripheral blood mononuclear cells (PBMC) was achieved by a nested polymerase chain reaction (PCR) method (bcl-2/j H PCR) on total DNA, according to Gribben et al. 13 with minor modifications. In particular, the oligonucleotide 5 CAG CCT TGA AAC ATT GAT GG 3 for the major breakpoint region (mbr) consensus region was substituted with oligonucleotide 5 GCA ATT CCG CAT TTA ATT CAT GGT ATT CAG GAT 3 (nucleotide position: ). 10 This technique had a limit of sensitivity of approximately 1 rearranged cell in 10 6 normal cells (data not shown). Amplification products were analyzed by both ethidium-bromide staining (EB-analysis) (Fig. 1) and hybridization with a specific DIG-labeled probe (SB-analysis) (Fig. 2). Each sample was analyzed at least twice and all PCR-negative samples were analyzed on at least 4 occasions. All PCR-positive samples were confirmed in at least 2 different experiments. Mononuclear cells tested in each reaction were 2.5 to Both positive (PBMC from 2 patients with t(14;18)-positive NHL) and negative controls (the PCR buffer with heat inactivated proteinase K and HepG2 cell line) were included in each experiment. To avoid false PCR-positive results by PCR product carryover, further precautions were used 1 : nested PCR was performed with a one-tube method to avoid opening the tube between the first and second steps. In PCR reaction mixtures, dutp was incorporated instead of dttp to generate amplicons degradable by Uracil-N-Glycosilase (Perkin-Elmer Cetus, Norwalk, CT), which was added to both reaction mixtures before PCR amplification. To ensure that DNA could be amplified in all samples, PCR was performed on all negative samples using primers for human HLA gene (exon 2 of HLA-DRB gene) (HLA PCR). The sequence of the primers was as follows: primer sense 5 CCCCACAGCACGTTTCTTG3 ; primer antisense 5 CCGCTGCACTGTGAAGCTCT3. Finally, the reliability of the PCR method used in this study to detect t(14;18) was confirmed by performing DNA sequence analysis of the PCR products in 10 randomly selected positive samples (9 from group A and 1 from group B) using previously described methods (data not shown). 14 bcl-2 Oncoprotein. PBMC (about ) were lysed in 0.2 ml of 1% Triton X-100 lysis buffer (Triton X-100 1%, Tris ph mmol/l, NaCl 150 mmol/l, EGTA 1 mmol/l, aprotinin 10 µmol/l, leupeptin 10 µmol/l, pepstatin 10 µmol/l, trypsin inhibitor 10 µmol/l, sodium orthovanadate 1 mmol/l, PMSF 1 mmol/l). Cellular extracts were incubated on ice for 30 minutes and then centrifuged at 12,000g for 15 minutes. The supernatants were collected, and protein concentration was determined using a bicinchoninic acid (BCA) protein assay kit (Pierce, Rockford, IL). Equivalent amounts of total cellular protein extracts (100 µg/lane) were resuspended in Laemmli sample buffer containing 10% 2-mercaptoethanol, boiled for 5 minutes, and subjected to 12.5% sodium dodecyl sulfate polyacrylamide gel electrophoresis. bcl-2 protein was detected by immunoblotting with specific antibody as follows: proteins were transferred from gel to PVDF membrane (Immobilon-P Millipore, Bedford, MA) using a transblot apparatus (Bio-Rad, Hercules, CA). The membrane was blocked with PBS plus 0.5% bovine gelatin and incubated with 2 µg/ml of mouse monoclonal antibody to human bcl-2 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Following 3 washes in PBS plus 0.1% Triton X-100, the membrane was incubated for 1 hour with the second antibody (horseradish peroxidase conjugated goat anti-mouse IgG [Amersham Life Sciences, Little Chalfont, UK]) used at 1:5,000 dilution. The blots were again washed 3 times in PBS plus 0.1% Triton X-100 and then developed using an ECL Kit (Amersham Life Sciences, Little Chalfont, UK) according to the manufacturer s instructions, and exposed to X-Omat AR film (Eastman Kodak, Rochester, NY). A cell line constitutively expressing bcl-2 protein (HL60 [ATCC cell lines, Rockville, MD]) 15 was used as positive control. HCV-RNA. Viral RNA was extracted from 150 µl of serum and amplified by one-tube nested reverse transcriptase (RT)-PCR. 1 To avoid false-positive results by PCR product carryover we adopted precautions similar to those used for bcl-2/j H determination. HCV genotypes were identified in serum and PBMC by genotype-specific primer PCR, as previously described. 1 Genotype 2a/c was further characterized by direct sequencing using solid-phase techniques. 14 Mixed infections by 2 HCV genotypes were confirmed by RFLP analysis on type-specific amplicons with AccI and HaeII enzymes. 15 Serum Cryoglobulins. Serum CGs were detected according to Meltzer and Franklin 16 ; the cryocrit was expressed as a percentage after centrifugation. Cryoglobulinemia was diagnosed in patients who had a measurable cryocrit level ( 1%) for at least 6 months. 17 The monoclonal component in the cryoprecipitate was detected by immunofixation (Paragon, Beckman, Fullerton, CA) and classified according to Brouet et al. 18

3 476 ZIGNEGO ET AL. HEPATOLOGY February 2000 FIG. 1. Detection of t(14;18) by mbr bcl-2/j H PCR and exon 2 of HLA-DRB gene by HLA PCR in peripheral blood mononuclear cells from patients with HCV-positive chronic liver disease and mixed cryoglobulinemia (groups A and B). Lanes 1, 3, and 5: results of HLA PCR; lanes 2, 4, and 6: results of mbr bcl-2/j H PCR. Lanes 1-2 and 3-4: peripheral blood mononuclear cells from 2 group A patients; Lanes 5-6: peripheral blood mononuclear cells from a group B patient; lane C : positive control [t(14;18)-positive follicular non-hodgkin s lymphoma]; lane C : negative control (PCR buffer); lane M molecular weight marker (123 bp DNA Ladder). Statistical Analysis Statistical analysis was performed using the Wilcoxon test, 2 analysis, and Fisher s exact test. RESULTS The frequency of t(14;18) in the 4 groups of patients included in the study, together with the patients clinical data, is shown in Tables 1 and 2. T(14;18) was significantly more frequent in the 2 groups of patients with HCV-related infection, respectively, with and without type II MC (groups A and B), than in those with HCV-unrelated CLD (group C), or chronic rheumatic disorders-chronic infections by nonhepatotropic agents (group D). Indeed, t(14;18)-positive PBMC were observed in 18/57 HCV-positive and 3/85 HCV-negative patients ( , P.0001). Considering all patients with HCV-related CLD (groups A and B), t(14;18) was more frequent in those with type II MC than in those without this LPD. On the other hand, in the whole series of patients with CLD (groups A-C), no significant correlation was found between t(14;18) and the patients age or the severity of liver disease. The 2 patients from group C and the 1 from group D with t(14;18) had cirrhosis (HBV related in 1 and alcoholic in the other patient) and RA, respectively. In all patients with t(14;18), both EB- and SB-analysis showed specific bands of variable size, more frequently ranging from 140 to 300 bases (Figs. 1 and 2). In 1 patient from group A and 1 from group C, SB-, but not EB-analysis showed a thin band in only 1 out of 4 consecutive experiments, suggesting a very low percentage of translocationpositive B cells (about 1/ cells). Immunoblot analysis revealed higher levels of bcl-2 oncoprotein in HCV-positive patients with t(14;18) than in healthy subjects (negative controls) or HCV-positive patients without translocation (Fig. 3). In addition to the 7 patients with type II MC (group B), serum CGs were also observed in 29 out of the 105 patients from groups A and C (23 from group A and 6 from group C). CGs characterization showed that 9 group-a patients had type II MC with a monoclonal component (IgMk in 5 and IgM in 2 patients), and 14 group A and 6 group C patients had type III MC. Considering the whole series of patients with CLD (groups A-C), t(14;18) was significantly more frequent in those with cryoglobulinemia (16/36 44%) than in those without (3/76; P.0001). Unfortunately, accurate data regarding persistent cryoglobulinemia were not available in group D patients. T(14;18) was not associated with a specific HCV type (Table 3). However, type 2c was more frequent in patients with bcl-2 recombination than in those without (Table 3). DISCUSSION The established recognition of an association between chronic HCV infection and the development of B-cell LPDs and/or autoimmune phenomena strongly suggests that this TABLE 2. Clinical Data and Results of t(14;18) Determination in the 7 Patients With HCV Related Chronic Liver Disease and Type II (IgMk) Mixed Cryoglobulinemia Included in the Study Patient (Number) Sex (M/F) Age (Yrs) Duration of MC Cryocrit (%) CH50 C4 C3 Liver Histology t(14;18) ( / ) 1 F CAH 2 M 53 nk nk LC 3 M CAH 4 F CAH 5 M CAH 6 F LC 7 F nk CAH Abbreviations: MC, mixed cryoglobulinemia; CAH, chronic active hepatitis; LC, liver cirrhosis; nk, not known.

4 HEPATOLOGY Vol. 31, No. 2, 2000 ZIGNEGO ET AL. 477 A B FIG. 2. Detection of t(14;18) in peripheral blood mononuclear cells from patients with HCV-positive chronic liver disease (group A) by mbr bcl-2/j H PCR. (A) Ethidium bromide stained agarose gel electrophoresis of PCR-amplified DNA. (B) Hybridization with the genomic bcl-2 probe. Lanes 1-3: peripheral blood mononuclear cells from patients with (lanes 1 and 3) or without (lane 2) t(14;18); lane C PCR buffer (negative control); lane C t(14; 18)-positive follicular non-hodgkin s lymphoma (positive control); lane M molecular weight marker (123 bp DNA Ladder). infection may predispose to inhibition of B-cell apoptotic death, thus favoring an abnormal persistence of lymphatic clones. Anti-apoptotic mechanisms involved in B-cell clonal expansion, either virus-related or virus-independent, are varying and generally complex. In this study, we found a high frequency of t(14;18) in patients with chronic HCV infection, especially in those with MC. Although t(14;18) presence does not necessarily correspond to a malignancy, it represents an important substrate predisposing to lymphomagenesis, as suggested by the observation that mice transgenic for t(14; 18) develop lymphoid hyperplasia progressing to malignant lymphoma. 19 Interestingly, 1 patient with HCV/MC developed a monoclonal, multistep lymphoproliferative disorder that, in the initial phase of the disease, was associated with t(14;18). 8 In addition, a high frequency of t(14;18) has been observed in salivary gland lymphomas from patients with Sjögren s syndrome, 20 another disease recently associated with HCV infection. 21 Bcl-2 recombination is interpreted as an error during the VDJ-gene rearrangement process in Ig genes 22 and may take place as a consequence of particularly strong antigenic stimulation. The chronic stimulation of the B-cell compartment by HCV, amplified by high viral variability and possibly also by HCV infection of the lymphatic cells themselves, 23,24 may contribute to the higher frequency of this recombination in patients with HCV infection than in those with HCVunrelated diseases observed in this study. The hypothesis that MC, the most frequent HCV-related LPD, could be a consequence of a prolonged stimulation of monoclonal B-cells producing rheumatoid factor with the WA cross-idiotype by HCV-containing immune complexes is not in contrast with the present results, even if the correlation may only be indirect. 25,26 On the other hand, recent observations indicating that the CD81 protein could be the putative HCV E2 cell receptor 27 may greatly help understanding the current results. In fact, CD81 (TAPA-1) is a cell-surface protein that, on B FIG. 3. Detection of bcl-2 oncoprotein in peripheral blood mononuclear cells from patients with HCVpositive chronic liver disease (group A) by immunoblot analysis. Lanes 1, 2, and 4: patients with t(14;18); patients in lanes 1 and 2 correspond to those in lanes 1 and 3 of Fig. 2, respectively. Lane 3: HCV-positive patient without t(14;18). Lane HL60: positive control samples.

5 478 ZIGNEGO ET AL. HEPATOLOGY February 2000 TABLE 3. Distribution of HCV Genotypes in Patients With HCV-Related Chronic Liver Disease With and Without Type II Mixed Cryoglobulinemia (Groups A and B), According to the Presence or Absence of bcl-2 Recombination HCV Genotype No. T(14;18)- Positive N (%) T(14;18)- Negative N (%) P Value 1a* 3 1 (5.5) 2 (5) NS 1b 40 9 (50) 31 (79) a / 2c (55) 8 (20.5) a / *One patient with and one without bcl-2 recombination had 1a 2c mixed infection. One patient with and one without bcl-2 recombination had 1b 2c mixed infection. cells, is part of a complex with CD21, CD19, and Leu13. This complex reduces the threshold for B cell activation via the B cell receptor by bridging antigen-specific recognition and CD21-mediated complement recognition. This leads to increased mutation frequency of VDJ rearrangements in antigenreactive B cells. Further studies will be useful to better specify the possible role played by HCV interaction with B-cell receptor/s and/or B-cell active infection by HCV. The finding of bcl-2 overexpression in peripheral lymphoid cells from HCV-positive CLD patients with and without MC observed in this study is in agreement with previous data by Monteverde et al., 9 who found immunohistochemical evidence of bcl-2 overexpression in liver lymphocyte aggregates in 90% of HCV-infected patients with type III MC, 57% of patients with type II MC, and 45% of patients with chronic hepatitis without cryoglobulinemia. On the other hand, the very high prevalence of bcl-2 overexpression observed in that study raises the possibility that other mechanisms, in addition to t(14;18), may contribute to the exuberant expression of this oncoprotein. This point should be addressed in further investigations. In the current study, t(14;18) and the consequent bcl-2 overexpression were significantly more frequent in patients with cryoglobulinemia and occurred in the majority of patients with overt MC syndrome, suggesting that determination of t(14;18) and/or bcl-2 overexpression in PBMC could be used as a noninvasive marker of the predisposition to develop MC and/or other B-cell LPDs. Clearly, prospective studies performed in HCV-positive patients with this recombination are needed to clarify this point. T(14;18) was detected in both type II and type III MC and also in a cryoglobulinemic patient without HCV infection. This is in agreement with the hypothesis of a role played by HCV in an early stage of MC pathogenesis, 28 and suggests that an association could exists between t(14;18) translocation/ bcl-2 overexpression in lymphoid cells and CG production, independently of HCV status or the clinical picture. Further studies involving populations of patients affected by HCVnegative type II MC with HBV or other infections as well as idiopathic type II MC will be important to confirm and better characterize this association. In the current study, we observed a higher prevalence of genotype 2c in translocation-positive patients with HCVpositive CLD. The possible importance of viral types in favoring LPDs has been widely discussed and is currently a controversial issue, even if all authors agree with the fact that all known HCV types may be identified in LPD patients. Discordance among different studies may be influenced by geographical factors as well as by the different criteria used in population selection. 1,29 In some studies, a high frequency of type 2a/c was detected in HCV-related LPDs including type II MC, B-cell NHL, and monoclonal gammopathies. 1,4,30,31 In light of present and past observations, it is possible that different viral types exert a lesser or more important influence on favoring the appearance of LPDs. Concerning more specifically type 2a/c, a correlation with the above-reported observations may possibly be found in the fact that this viral variant has been associated with a more intense stimulation of the lymphatic system. In this respect, it may be interesting to note that sequence variations between genotype 1b and 2 in the 5 -untranslated region affecting the internal ribosomal entry site of the virus have been reported to provide genotype 2c with a translational advantage over genotype 1, 32 possibly leading to a more efficient synthesis of viral epitopes. However, because of the small number of observations included in the present study, an accurate analysis of wider patient populations is needed to confirm and possibly explain the suggested association. In conclusion, t(14;18) and bcl-2 overexpression in lymphoid cells is a frequent finding in HCV-related CLD, especially when it also has overt type II MC. These data are in agreement with the hypothesis that t(14;18) may be involved in the complex multistep mechanisms leading from chronic HCV infection to B-cell LPDs by favoring the switch from a polyclonal antigen-driven B cell expansion to monoclonality. Further investigations are needed to establish whether t(14; 18) and/or bcl-2 overexpression in PBMC could be used as a noninvasive marker of an increased risk to develop B-cell LPDs and autoimmune phenomena in patients with HCVrelated CLD. Acknowledgment: The authors gratefully acknowledge Giampiero Buzzelli, M.D., for statistical advice, Pierluigi Rossi-Ferrini, M.D., and Fabio Innocenti, M.D., for the generous gift of t(14;18)-positive control samples and Ms. Mary Diamond for kind help in the preparation of the manuscript. REFERENCES 1. Zignego AL, Ferri C, Giannini C, Monti M, Careccia G, Longombardo G, Lombardini F, et al. Hepatitis C virus genotype analysis in patients with type II mixed cryoglobulinemia. Ann Intern Med 1996;124: Ferri C, Caracciolo F, Zignego AL, La Civita L, Monti M, Longombardo G, Lombardini F, et al. Hepatitis C virus infection in patients with non-hodgkin s lymphoma. Brit J Haematol 1994;88: Zuckerman E, Zuckerman T, Levine AM, Douer D, Gutekunst K, Mizokami M, Qian DG, et al. Hepatitis C virus infection in patients with B-cell non-hodgkin lymphoma. Ann Intern Med 1997;127: Andreone P, Zignego AL, Cursaro C, Gramenzi A, Gherlinzoni F, Fiorino S, Giannini C, et al. Prevalence of monoclonal gammopathies in patients with hepatitis C virus infection. Ann Intern Med 1998;129: Ferri C, Pileri S, Zignego AL. Hepatitis C and lymphoma. In: Goedert JJ, ed. Viral, Bacterial and Parasitic Oncology. National Cancer Institute and National Institute of Health. Totowa, NJ: The Humana Press Inc., 2000 (in press). 6. Monteverde A, Sabattini E, Poggi S, Ballaré M, Bertoncelli MC, De Vivo A, Briskomatis A, et al. Bone marrow findings further support the hypothesis that essential mixed cryoglobulinemia type II is characterized by a monoclonal B-cell proliferation. Leuk Lymphoma 1995;20: Franzin F, Efremov DG, Pozzato G, Tulissi P, Batista F, Burrone OR. Clonal B-cell expansions in peripheral blood of HCV-infected patients. Br J Haematol 1995;90: Ellis M, Rathaus M, Amiel A, Manor Y, Klein A, Lishner M. Monoclonal

6 HEPATOLOGY Vol. 31, No. 2, 2000 ZIGNEGO ET AL. 479 lymphocyte proliferation and bcl-2 rearrangement in essential mixed cryoglobulinaemia. Eur J Clin Invest 1995;25: Monteverde A, Ballaré M, Pileri S. Hepatic lymphoid aggregates in chronic hepatitis C and mixed cryoglobulinemia. Springer Semin Immunopathol 1997;19: Kneba M, Eick S, Herbst H, Willigeroth S, Pott C, Bolz I, Bergholz M, et al. Frequency and structure of t(14;18) major breakpoint regions in non-hodgkin s lymphomas typed according to the Kiel classification: analysis by direct DNA sequencing. Cancer Res 1991;51: Luppi M, Longo G, Ferrari MG, Barozzi P, Marasca R, Morselli M, Valenti C, et al. Clinico-pathological characterization of hepatitis C virus-related B-cell non-hodgkin s lymphomas without symptomatic cryoglobulinemia. Ann Oncol 1998;9: Limpens J, De Jong DJH, van Krieken CG, Price BD, van Ommen Young GJ, Kluin PM. Bcl-2/JH rearrangements in benign lymphoid tissues with follicular hyperplasia. Oncogene 1991;6: Gribben JG, Freedman AS, Woo SD, Blake K, Shu RS, Freeman G, Longtine JA, et al. All advanced stage non-hodgkin s lymphomas with a polymerase chain reaction amplifiable breakpoint of bcl-2 have residual cells containing the bcl-2 rearrangement at evaluation and after treatment. Blood 1991;78: Giannini C, Giannelli F, Monti M, Careccia G, Marrocchi ME, Laffi G, Gentilini P, et al. Prevalence of mixed infection by different hepatitis C virus genotypes in patients with hepatitis C virus-related chronic liver disease. J Lab Clin Med 1999;134: Vanhaesebroeck B, Reed JC, De Valck D, Grooten J, Miyashita T, Tanaka S, Beyaert R, Van Roy F, Fiers W. Effect of bcl-2 proto-oncogene expression on cellular sensitivity to tumor necrosis factor-mediated cytotoxicity. Oncogene 1993;8: Meltzer M, Franklin EC. Cryoglobulinemia: a study of twenty-nine patients. I. IgG and IgM cryoglobulins and factors affecting cryoprecipitability. Am J Med 1966;40: Invernizzi F, Pietrogrande M, Sagramoso B. Classification of the cryoglobulinemic syndrome. Clin Exp Rheumatol 1995;13(Suppl 13):123S-128S. 18. Brouet JC, Clauvel JP, Danon F, Klein M, Seligmann M. Biologic and clinical significance of cryoglobulins. A report of 86 cases. Am J Med 1974;57: McDonnell TJ, Korsmeyer SJ. Progression from lymphoid hyperplasia to high-grade malignant lymphoma in mice transgenic for the t(14; 18). Nature 1991;349: Pisa EK, Pisa P, Kang HI, Fox RI. High frequency of t(14;18) translocation in salivary gland lymphomas from Sjogren s syndrome patients. J Exp Med 1991;174: De Vita S, Sacco C, Sansonno D, Gloghini A, Dammacco F, Crovatto M, Santini G, et al. Characterization of overt B-cell lymphomas in patients with hepatitis C virus infection. Blood 1997;90: Meijerink JP, Raemaekers JM, Mensink EJ. New type of t(14; 18) in a non-hodgkin s lymphoma provides insight in molecular events in early B-cell differentiation. Br J Haematol 1995;91: Zignego AL, Macchia D, Monti M, Thiers V, Mazzetti M, Foschi M, Maggi E, et al. Infection of peripheral mononuclear blood cells by hepatitis C virus. J Hepatol 1992;15: Morsica G, Tambussi G, Sitia G, Novati R, Lazzarin A. Replication of hepatitis C virus in B lymphocytes. Blood 1999;94: Agnello V, Zhang QX, Abel G, Knight GB. The association of hepatitis C virus infection with monoclonal rheumatoid factors bearing the WA cross-idiotype: implications for the etiopathogenesis and therapy of mixed cryoglobulinemia. Clin Exp Rheumatol 1995;13(Suppl 13):101A- 104S. 26. Agnello V. The etiology and pathophysiology of mixed cryoglobulinemia secondary to hepatitis C virus infection. Springer Semin Immunopathol 1997;19: Zignego AL, Brechot C. Extrahepatic manifestations of HCV infection: facts and controversies J Hepatol 1999;31: Pileri P, Uematsu Y, Campagnoli S, Galli G, Falugi F, Petracca R, Weiner AJ, et al. Binding of Hepatitis C Virus to CD81. Science 1998;282: Frangeul L, Musset L, Cresta P, Cacoub P, Huraux JM, Lunel F. Hepatitis C virus genotypes and subtypes in patients with hepatitis C with and without cryoglobulinemia. J Hepatol 1996;25: Silvestri F, Barillari G, Fanin R, Pipan C, Falasca E, Salmaso F, Zaja F, et al. The genotype of the hepatitis C virus in patients with HCV-related B cell non-hodgkin s lymphoma. Leukemia 1997;11(12): Zehender G, de Maddalena C, Monti G, Ballare M, Saccardo F, Piconi S, Invernizzi F, et al. HCV genotypes in bone marrow and peripheral blood mononuclear cells of patients with mixed cryoglobulinemia. Clin Exp Rheumatol 1995;13(Suppl 13):87S-90S. 32. Tsukiyama-Kohara K, Iizuka N, Kohara M, Nomoto A. Internal ribosome entry site within hepatitis C virus RNA. J Virol 1992;66: