membrane form secreted form 13 aa 26 aa K K V V K K 3aa
|
|
- Cora McDaniel
- 5 years ago
- Views:
Transcription
1 Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai secreted form membrane form 13 aa 26 aa K K V V K K 3aa
2 Hapten monosaccharide Polyvalent antigen polysaccharide antigen receptor NO SIGNAL SIGNAL TRANSDUCTION
3 Y Y Igβ Igα Src-family kinase Y Y ITAM
4 ITAM YxxL/IxxxxxxYxxL/I Immune-receptor Tyrosine based Activation Motif
5 Y Y Y Y Igβ Igα Activated Syk Y Y Y Y ITAM Inactive Syk
6 The T cell receptor α β γ ε ε δ ζζ ITAM
7 CO-RECEPTORS CELL SURFACE PROTEINS THAT BIND TO THE SAME ANTIGEN AS THE ANTIGEN RECEPTOR DISTINGUISHABLE FROM COSTIMULATORS
8 CD4 TCR α β γ ε ε δ ζζ Lck Fyn Zap-70
9 CO-RECEPTORS CD4 ON HELPER T CELLS CD8 ON CYTOTOXIC T CELLS CD21/CR2 ON B CELLS
10 CD21/CR2 is a co-receptor and a positive regulator of BCR signaling CR2/CD21 YYYY Immune complex BCR CD19 CD81 β α Lyn Fyn Syk Vav PI3K
11 Generation of Diversity 1. V(D)J Recombination Combinatorial Diversity Junctional Diversity N Regions P nucleotides 2. Somatic Mutation
12 V D J - C V D J DNA junctional diversity, bases added and removed mrna
13 Rearrangement is temporally ordered B LINEAGE T LINEAGE IgH D to J Then Vto DJ Then Ig Kappa V to J TCR D beta to J beta Then V beta to DJ Then TCR V alpha to J alpha
14 L VDJ µ Poly A sites Cµ1 Cµ2 Cµ3 Cµ4 µm1 µm2 AAAA Choice of first polyadenylation site AAAA Choice of second polyadenylation site AAAA µs mrna AAAA µm mrna
15 V(D)J Recombination Lymphoid specific Locus-specific, cell-type specific, stage specific Accessibility model
16 Heptamer 12-bp spacer 23-bp spacer Heptamer Coding segment Nonamer Nonamer Coding segment RAG-2 RAG-1 NICK PRECEDES CUT OH P CLEAVE AND MAKE HAIRPINS
17 SIGNAL JOINT TRIM ADD N REGIONS JOIN RAG-1/RAG-2 still required TdT DNA-PK/Ku70/Ku80 XRCC4/DNA ligase CODING JOINT + N-region
18 RAG time RAG-1 dimers associate with RAG-2 dimers RAG-1 dimers bind to nonamers, cleave DNA RAG-2 has a beta-propeller like structure - probably brings in other proteins such as accessibility factors Rag genes evolved from a transposable element?
19 coding segment RSS RSS coding segment Looping out and Deletion Inversion
20 The 12/23 Rule Heptamer 12 bp spacer 23 bp spacer Heptamer Coding segment Nonamer Nonamer Coding segment
21 Cleave at heptamer junction ATTCTTTGAGATAGCTCGA TAAGAAACTCTATCGAGCT heptamer ATTCTTTGAGATAGCTCGA TAAGAAACTCTATCGAGCT Open up hairpin ATTCTTTGAGATAGCTCGATCG TAAGAAACTCTATCGAGCTAGC Add P nucleotides
22 HAIRPINS Resolved by Artemis, an enzyme which works in conjunction with DNA-PKcs
23 Severe Combined Immunodeficiency Rag-1 and Rag-2 deficiencies: SCID No VDJ recombination Artemis deficiency: SCID Defective coding joints Many other causes of SCID
24 V(D)J recombination and human lymphomas Many human lymphomas involve chromosomal translocations In some lymphomas (e.g. follicular lymphomas, lymphomas associated with Ataxia Telangiectasia, etc) the machinery involved in V(D)J recombination drives the translocation process
25 Regulation of V(D)J recombination 1. Allelic exclusion - role of pre-antigen receptors 2. Receptor editing
26 pre-bcr MEDIATED POSITIVE SELECTION (defective in X-linked agammaglobulinemia) V H to DJ H rearrangement Ψ Large pre-b C' pre-bcr Ψ Large pre-b C' pre-bcr Early pro-b Intermediate pro-b Late pro-b Ψ Large pre-b pre-bcr Small pre-b Y Immature B YY A B C C' D E F IgM IgD Mature B D H to J H rearrangement BONE MARROW Ψ Large pre-b C' pre-bcr V L to J L rearrangement Ψ Large pre-b C' pre-bcr
27 Pre-B receptor µ vpreb λ5 Igβ Igα S y k ITAM Blk/Lyn/Fyn
28 Pre-TCR No known ligand β ptα γ ε ε δ ζζ ITAM
29 Pre-antigen receptors Select cells that have made in-frame rearrangements Signals for survival, proliferation and allelic exclusion (rearrangement at second allele is shut off)
30 Central lymphoid organs Periphery antigen receptor "The death/ editing window" Proliferation and activation Rearrangement of Ig heavy chain or TCR β chain genes Selection by pre-antigen receptor of cells with in- frame Ig heavy chain or TCR β chain rearrangements Elimination or editing of self reactive cells F i n a l repertoire in responders
31 For more information and examples, see Immunobiology, by Janeway,C., Travers, P., Walport, M. and Capra, J., Garland Publishing, 5th edition, 2001 & Cellular and Molecular Immunology by Abbas, A., Pober, J., and Lichtman, A., W B Saunders; 4th edition.
Stage I Stage II Stage III Stage IV
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Stage I Stage II Stage III Stage IV Receptor gene Rearrangement Elimination
More informationIntroduction. Introduction. Lymphocyte development (maturation)
Introduction Abbas Chapter 8: Lymphocyte Development and the Rearrangement and Expression of Antigen Receptor Genes Christina Ciaccio, MD Children s Mercy Hospital January 5, 2009 Lymphocyte development
More informationT cell Receptor. Chapter 9. Comparison of TCR αβ T cells
Chapter 9 The αβ TCR is similar in size and structure to an antibody Fab fragment T cell Receptor Kuby Figure 9-3 The αβ T cell receptor - Two chains - α and β - Two domains per chain - constant (C) domain
More informationDevelopment of B and T lymphocytes
Development of B and T lymphocytes What will we discuss today? B-cell development T-cell development B- cell development overview Stem cell In periphery Pro-B cell Pre-B cell Immature B cell Mature B cell
More informationB Lymphocyte Development and Activation
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai 09/26/05; 9 AM Shiv Pillai B Lymphocyte Development and Activation Recommended
More informationThe Development of Lymphocytes: B Cell Development in the Bone Marrow & Peripheral Lymphoid Tissue Deborah A. Lebman, Ph.D.
The Development of Lymphocytes: B Cell Development in the Bone Marrow & Peripheral Lymphoid Tissue Deborah A. Lebman, Ph.D. OBJECTIVES 1. To understand how ordered Ig gene rearrangements lead to the development
More informationChapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.
Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature
More informationAndrea s SI Session PCB Practice Test Test 3
Practice Test Test 3 READ BEFORE STARTING PRACTICE TEST: Remember to please use this practice test as a tool to measure your knowledge, and DO NOT use it as your only tool to study for the test, since
More informationChapter 11. B cell generation, Activation, and Differentiation. Pro-B cells. - B cells mature in the bone marrow.
Chapter B cell generation, Activation, and Differentiation - B cells mature in the bone marrow. - B cells proceed through a number of distinct maturational stages: ) Pro-B cell ) Pre-B cell ) Immature
More informationIg light chain rearrangement: Rescue pathway
B Cell Development Ig light chain rearrangement: Rescue pathway There is only a 1:3 chance of the join between the V and J region being in frame Vk Jk Ck Non-productive Rearrangement Light chain has a
More informationPATHOGEN INNOCUOUS ANTIGEN. No Danger- very low expression of costimulatory ligands Signal One Only
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv illai AICD Naive Activated Effector Memory Activated Effector Naive AICD Activated
More informationSPECIFIC IMMUNITY = ACQUIRED IMMUNITY = ADAPTIVE IMMUNITY SPECIFIC IMMUNITY - BASIC CHARACTERISTIC
SPECIFIC IMMUNITY - BASIC CHARACTERISTIC SPECIFIC IMMUNITY = ACQUIRED IMMUNITY = ADAPTIVE IMMUNITY BASIC TERMINOLOGY SPECIFIC IMMUNITY humoral mediated with antibodies cellular mediated with T lymphocytes
More informationB cell development in the bone marrow.
development in the bone. s develop from multipotent haematopoietic stem s in the bone that produce lymphoid progenitors which in turn generate s. s with a unique antibody specificity develop by initial
More informationAndrea s Final Exam Review PCB 3233 Spring Practice Final Exam
NOTE: Practice Final Exam Although I am posting the answer key for this practice exam, I want you to use this practice to gauge your knowledge, and try to figure out the right answer by yourself before
More informationAntibodies and T Cell Receptor Genetics Generation of Antigen Receptor Diversity
Antibodies and T Cell Receptor Genetics 2008 Peter Burrows 4-6529 peterb@uab.edu Generation of Antigen Receptor Diversity Survival requires B and T cell receptor diversity to respond to the diversity of
More informationFollicular Lymphoma. ced3 APOPTOSIS. *In the nematode Caenorhabditis elegans 131 of the organism's 1031 cells die during development.
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai Follicular Lymphoma 1. Characterized by t(14:18) translocation 2. Ig heavy
More informationMolecular Pathology of Lymphoma (Part 1) Rex K.H. Au-Yeung Department of Pathology, HKU
Molecular Pathology of Lymphoma (Part 1) Rex K.H. Au-Yeung Department of Pathology, HKU Lecture outline Time 10:00 11:00 11:15 12:10 12:20 13:15 Content Introduction to lymphoma Review of lymphocyte biology
More informationThe Adaptive Immune Response. B-cells
The Adaptive Immune Response B-cells The innate immune system provides immediate protection. The adaptive response takes time to develop and is antigen specific. Activation of B and T lymphocytes Naive
More informationChapter 19: IgE-Dependent Immune Responses and Allergic Disease
Allergy and Immunology Review Corner: Chapter 19 of Cellular and Molecular Immunology (Seventh Edition), by Abul K. Abbas, Andrew H. Lichtman and Shiv Pillai. Chapter 19: IgE-Dependent Immune Responses
More informationIntroduction. Abbas Chapter 10: B Cell Activation and Antibody Production. General Features. General Features. General Features
Introduction Abbas Chapter 10: B Cell Activation and Antibody Production January 25, 2010 Children s Mercy Hospitals and Clinics Humoral immunity is mediated by secreted antibodies (Ab) Ab function to
More informationDevelopment Team. Head, Department of Zoology, University of Delhi. Department of Zoology, University of Delhi
Paper No.: 10: Module : 03: cells, BCR, TCR, Co-receptors, properties of antigen recognized by Development Team Principal Investigator: Co-Principal Investigator: Paper Coordinator: Content Writer: Content
More informationremember that T-cell signal determine what antibody to be produce class switching somatical hypermutation all takes place after interaction with
بسم هللا الرحمن الرحيم The last lecture we discussed the antigen processing and presentation and antigen recognition then the activation by T lymphocyte and today we will continue with B cell recognition
More informationT cell development October 28, Dan Stetson
T cell development October 28, 2016 Dan Stetson stetson@uw.edu 441 Lecture #13 Slide 1 of 29 Three lectures on T cells (Chapters 8, 9) Part 1 (Today): T cell development in the thymus Chapter 8, pages
More informationTwo categories of immune response. immune response. infection. (adaptive) Later immune response. immune response
Ivana FELLNEROVÁ E-mail: fellneri@hotmail.com, mob. 732154801 Basic immunogenetic terminology innate and adaptive immunity specificity and polymorphism immunoglobuline gene superfamily immunogenetics MHC
More informationThe Adaptive Immune Response. T-cells
The Adaptive Immune Response T-cells T Lymphocytes T lymphocytes develop from precursors in the thymus. Mature T cells are found in the blood, where they constitute 60% to 70% of lymphocytes, and in T-cell
More informationall of the above the ability to impart long term memory adaptive immunity all of the above bone marrow none of the above
1. (3 points) Immediately after a pathogen enters the body, it faces the cells and soluble proteins of the innate immune system. Which of the following are characteristics of innate immunity? a. inflammation
More informationInnate immunity (rapid response) Dendritic cell. Macrophage. Natural killer cell. Complement protein. Neutrophil
1 The immune system The immune response The immune system comprises two arms functioning cooperatively to provide a comprehensive protective response: the innate and the adaptive immune system. The innate
More informationAntigen Presentation and T Lymphocyte Activation. Shiv Pillai MD, PhD Massachusetts General Hospital Harvard Medical School. FOCiS
1 Antigen Presentation and T Lymphocyte Activation Shiv Pillai MD, PhD Massachusetts General Hospital Harvard Medical School FOCiS 2 Lecture outline Overview of T cell activation and the rules of adaptive
More informationAdaptive Immunity: Humoral Immune Responses
MICR2209 Adaptive Immunity: Humoral Immune Responses Dr Allison Imrie 1 Synopsis: In this lecture we will review the different mechanisms which constitute the humoral immune response, and examine the antibody
More informationPre-B and pre-t-cell receptors: conservation of strategies in regulating early lymphocyte development
Stefan A. Muljo Mark S. Schlissel Pre-B and pre-t-cell receptors: conservation of strategies in regulating early lymphocyte development Authors addresses Stefan A. Muljo 1, Mark S. Schlissel 2, 1Graduate
More informationMicrobiology 204. Background Slides on T Cell Development For Preparation for Flipped Classroom setting. Art Weiss.
Microbiology 204 Background Slides on T Cell Development For Preparation for Flipped Classroom setting Art Weiss October 23, 2015 Thymic Lobule Structure From: Immunobiology, Janeway, et al., 5th edition
More informationPrinciples of Adaptive Immunity
Principles of Adaptive Immunity Chapter 3 Parham Hans de Haard 17 th of May 2010 Agenda Recognition molecules of adaptive immune system Features adaptive immune system Immunoglobulins and T-cell receptors
More informationPRECURSOR LYMHPOID NEOPLASMS. B lymphoblastic leukaemia/lymphoma T lymphoblastic leukaemia/lymphoma
PRECURSOR LYMHPOID NEOPLASMS B lymphoblastic leukaemia/lymphoma T lymphoblastic leukaemia/lymphoma B lymphoblastic leukaemia/lymphoma Definition: B lymphoblastic leukaemia/lymphoma is a neoplasm of precursor
More informationLectins: selected topics 3/2/17
Lectins: selected topics 3/2/17 Selected topics Regulation of T-cell receptor signaling Thymic selection of self vs. non-self T-cells Essentials of Glycobiology Second Edition Signaling pathways associated
More informationAntigen-Independent B-Cell Development Bone Marrow
Antigen-Independent B-Cell Development Bone Marrow 1. DNA rearrangements establish the primary repertoire, creating diversity 2. Allelic exclusion ensures that each clone expresses a single antibody on
More informationT Cell Receptor & T Cell Development
T Cell Receptor & T Cell Development Questions for the next 2 lectures: How do you generate a diverse T cell population with functional TCR rearrangements? How do you generate a T cell population that
More informationT cell and Cell-mediated immunity
T cell and Cell-mediated immunity Lu Linrong ( 鲁林荣 ) PhD Laboratory of Immune Regulation Institute of Immunology Zhejiang University, it School of Medicine i Medical Research Building B815-819 Email: Lu.Linrong@gmail.com
More informationκ λ Antigen-Independent B-Cell Development Bone Marrow Ordered Rearrangement of Ig Genes During B-Cell Development in the Bone Marrow
Antigen-Independent B-Cell Development Bone Marrow 1. DNA rearrangements establish the primary repertoire, creating diversity 2. Allelic exclusion ensures that each clone expresses a single antibody on
More informationRecommended reading: Abbas et al. 5th edition, chapters 7 and 10; Janeway and Travers, 5th edition, chapter 7.
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai 10/05/05; 11 AM Shiv Pillai T Lymphocyte Development Recommended reading:
More informationGeneration of antibody diversity October 18, Ram Savan
Generation of antibody diversity October 18, 2016 Ram Savan savanram@uw.edu 441 Lecture #10 Slide 1 of 30 Three lectures on antigen receptors Part 1 : Structural features of the BCR and TCR Janeway Chapter
More informationAdaptive Immune System
Short Course on Immunology Adaptive Immune System Bhargavi Duvvuri Ph.D IIIrd Year (Immunology) bhargavi@yorku.ca Supervisor Dr.Gillian E Wu Professor, School of Kinesiology and Health Sciences York University,
More informationHelminth worm, Schistosomiasis Trypanosomes, sleeping sickness Pneumocystis carinii. Ringworm fungus HIV Influenza
Helminth worm, Schistosomiasis Trypanosomes, sleeping sickness Pneumocystis carinii Ringworm fungus HIV Influenza Candida Staph aureus Mycobacterium tuberculosis Listeria Salmonella Streptococcus Levels
More informationSINGLE CHOICE. 5. The gamma invariant chain binds to this molecule during its intracytoplasmic transport. A TCR B BCR C MHC II D MHC I E FcγR
A Name: Group: SINGLE CHOICE 1. Which is the most important ligand of TLR5? A endospore B flagellin C polysaccharide capsule D DNA E pilus 2. The antibody-binding site is formed primarily by... A the constant
More informationB cell activation and antibody production. Abul K. Abbas UCSF
1 B cell activation and antibody production Abul K. Abbas UCSF 2 Lecture outline B cell activation; the role of helper T cells in antibody production Therapeutic targeting of B cells 3 Principles of humoral
More informationT Cell Activation. Patricia Fitzgerald-Bocarsly March 18, 2009
T Cell Activation Patricia Fitzgerald-Bocarsly March 18, 2009 Phases of Adaptive Immune Responses Phases of T cell responses IL-2 acts as an autocrine growth factor Fig. 11-11 Clonal Expansion of T cells
More informationT cell maturation. T-cell Maturation. What allows T cell maturation?
T-cell Maturation What allows T cell maturation? Direct contact with thymic epithelial cells Influence of thymic hormones Growth factors (cytokines, CSF) T cell maturation T cell progenitor DN DP SP 2ry
More informationT Cell Effector Mechanisms I: B cell Help & DTH
T Cell Effector Mechanisms I: B cell Help & DTH Ned Braunstein, MD The Major T Cell Subsets p56 lck + T cells γ δ ε ζ ζ p56 lck CD8+ T cells γ δ ε ζ ζ Cα Cβ Vα Vβ CD3 CD8 Cα Cβ Vα Vβ CD3 MHC II peptide
More informationImmunobiology 7. The Humoral Immune Response
Janeway Murphy Travers Walport Immunobiology 7 Chapter 9 The Humoral Immune Response Copyright Garland Science 2008 Tim Worbs Institute of Immunology Hannover Medical School 1 The course of a typical antibody
More informationDefensive mechanisms include :
Acquired Immunity Defensive mechanisms include : 1) Innate immunity (Natural or Non specific) 2) Acquired immunity (Adaptive or Specific) Cell-mediated immunity Humoral immunity Two mechanisms 1) Humoral
More informationMajor Histocompatibility Complex (MHC) and T Cell Receptors
Major Histocompatibility Complex (MHC) and T Cell Receptors Historical Background Genes in the MHC were first identified as being important genes in rejection of transplanted tissues Genes within the MHC
More informationImmunology Lesson plan for international medical students
Immunology Lesson plan for international medical students Kermanshah University of medical sciences (KUMS) international affairs School of medicine Department of Immunology Lecturers: Dr. Ali Gorgin Karaji
More informationImmunology - Lecture 2 Adaptive Immune System 1
Immunology - Lecture 2 Adaptive Immune System 1 Book chapters: Molecules of the Adaptive Immunity 6 Adaptive Cells and Organs 7 Generation of Immune Diversity Lymphocyte Antigen Receptors - 8 CD markers
More informationGeneration of The Immune Response
Generation of The Immune Response Introduction The adaptive immune system recognizes antigens using randomly generated T cell and B cell surface receptors Antigen-specific clonal expansion takes place
More informationTEMA 5. ANTICUERPOS Y SUS RECEPTORES
TEMA 5. ANTICUERPOS Y SUS RECEPTORES The B-cell antigen receptor (left) consists of two identical heavy (H) chains and two identical light (L) chains. In addition, secondary components (Ig-α and Ig-β)
More informationStructure and Function of Antigen Recognition Molecules
MICR2209 Structure and Function of Antigen Recognition Molecules Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will examine the major receptors used by cells of the innate and
More informationT cell and Cell-mediated immunity
T cell and Cell-mediated immunity ( 第十章 第十二章第十二章 ) Lu Linrong ( 鲁林荣 ) PhD Laboratory of Immune Regulation Institute of Immunology Zhejiang University, School of Medicine Medical Research Building B815-819
More informationIMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS
LECTURE: 07 Title: IMMUNE CELL SURFACE RECEPTORS AND THEIR FUNCTIONS LEARNING OBJECTIVES: The student should be able to: The chemical nature of the cellular surface receptors. Define the location of the
More informationA second type of TCR TCR: An αβ heterodimer
How s recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do By the early 1980s, much about function was known, but the receptor genes had not been identified Recall
More informationHow T cells recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do? Monoclonal antibody approach
How T cells recognize antigen: The T Cell Receptor (TCR) Identifying the TCR: Why was it so hard to do By the early 1980s, much about T cell function was known, but the receptor genes had not been identified
More information5/1/13. The proportion of thymus that produces T cells decreases with age. The cellular organization of the thymus
T cell precursors migrate from the bone marrow via the blood to the thymus to mature 1 2 The cellular organization of the thymus The proportion of thymus that produces T cells decreases with age 3 4 1
More informationThe development of T cells in the thymus
T cells rearrange their receptors in the thymus whereas B cells do so in the bone marrow. The development of T cells in the thymus The lobular/cellular organization of the thymus Immature cells are called
More informationThe development of clonality testing for lymphomas in the Bristol Genetics Laboratory. Dr Paula Waits Bristol Genetics Laboratory
The development of clonality testing for lymphomas in the Bristol Genetics Laboratory Dr Paula Waits Bristol Genetics Laboratory Introduction The majority of lymphoid malignancies belong to the B cell
More informationImmunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells
Immunology Basics Relevant to Cancer Immunotherapy: T Cell Activation, Costimulation, and Effector T Cells Andrew H. Lichtman, M.D. Ph.D. Department of Pathology Brigham and Women s Hospital and Harvard
More informationGENETIC MARKERS IN LYMPHOMA a practical overview. P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute
GENETIC MARKERS IN LYMPHOMA a practical overview P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute B and T cell monoclonalities Rearrangement of immunoglobin and TCR genes may help
More informationCOURSE: Medical Microbiology, MBIM 650/720 - Fall TOPIC: Antigen Processing, MHC Restriction, & Role of Thymus Lecture 12
COURSE: Medical Microbiology, MBIM 650/720 - Fall 2008 TOPIC: Antigen Processing, MHC Restriction, & Role of Thymus Lecture 12 FACULTY: Dr. Mayer Office: Bldg. #1, Rm B32 Phone: 733-3281 Email: MAYER@MED.SC.EDU
More informationAttribution: University of Michigan Medical School, Department of Microbiology and Immunology
Attribution: University of Michigan Medical School, Department of Microbiology and Immunology License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution
More informationHST 176 Problem Set. 1. This is a schematic view of a rearranged µ chain.
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai HST 176 Problem Set 1. This is a schematic view of a rearranged µ chain.??
More informationImmunology for the Rheumatologist
Immunology for the Rheumatologist Rheumatologists frequently deal with the immune system gone awry, rarely studying normal immunology. This program is an overview and discussion of the function of the
More informationGeneration of the Immune Response
Generation of the Immune Response Sheet 18 immunity I only added extra notes that were explained in the lecture, refer back to the slides. SLIDE 3: In the generation of Immune response whether by B or
More informationOverview of immunology
Introduction Overview of immunology Masayuki Miyasaka, MD, PhD Interdisciplinary Program for Biomedical Sciences WPI Immunology Frontier Research Center (IFReC) Osaka University Inside our body, we have
More informationSignaling Through Immune System Receptors (Ch. 7)
Signaling Through Immune System Receptors (Ch. 7) 1. General principles of signal transduction and propagation. 2. Antigen receptor signaling and lymphocyte activation. 3. Other receptors and signaling
More informationLecture 7: Signaling Through Lymphocyte Receptors
Lecture 7: Signaling Through Lymphocyte Receptors Questions to Consider After recognition of its cognate MHC:peptide, how does the T cell receptor activate immune response genes? What are the structural
More informationImmunodermatology. Danielle Tartar, MD, PhD Assistant Clinical Professor Co-Director of Inpatient Dermatology University of California - Davis
Immunodermatology Danielle Tartar, MD, PhD Assistant Clinical Professor Co-Director of Inpatient Dermatology University of California - Davis Outline Adaptive Immunity: T and B cell development, activation,
More informationThe T cell receptor for MHC-associated peptide antigens
1 The T cell receptor for MHC-associated peptide antigens T lymphocytes have a dual specificity: they recognize polymporphic residues of self MHC molecules, and they also recognize residues of peptide
More informationb. In which box will the first amino acid of the mature protein be located? Second box from the left (after cleavage of the signal peptide)
Harvard-MIT Division of Health Sciences and Technology HST.176: Cellular and Molecular Immunology Course Director: Dr. Shiv Pillai HST 176 Problem Set 1. This is a schematic view of a rearranged µ chain.??
More informationOverview B cell development T cell development
Topics Overview B cell development T cell development Lymphocyte development overview (Cont) Receptor diversity is produced by gene rearrangement and is random Includes specificities that will bind to
More informationImmune Regulation and Tolerance
Immune Regulation and Tolerance Immunoregulation: A balance between activation and suppression of effector cells to achieve an efficient immune response without damaging the host. Activation (immunity)
More informationCHAPTER 9 BIOLOGY OF THE T LYMPHOCYTE
CHAPTER 9 BIOLOGY OF THE T LYMPHOCYTE Coico, R., Sunshine, G., (2009) Immunology : a short course, 6 th Ed., Wiley-Blackwell 1 CHAPTER 9 : Biology of The T Lymphocytes 1. 2. 3. 4. 5. 6. 7. Introduction
More informationHOST DEFENSE SMALL GROUP PROBLEM SOLVING SESSION CLINICAL IMMUNOLOGIC ASSAYS-II
Host Defense 2011 Small Group Problem Solving Session Clinical Immunologic Assays II HOST DEFENSE SMALL GROUP PROBLEM SOLVING SESSION CLINICAL IMMUNOLOGIC ASSAYS-II Small Group Classrooms LEARNING GOAL
More informationCELL BIOLOGY - CLUTCH CH THE IMMUNE SYSTEM.
!! www.clutchprep.com CONCEPT: OVERVIEW OF HOST DEFENSES The human body contains three lines of against infectious agents (pathogens) 1. Mechanical and chemical boundaries (part of the innate immune system)
More informationRICONOSCIMENTO DELL Ag DA PARTE DELL IMMUNITA ADATTATIVA
RICONOSCIMENTO DELL Ag DA PARTE DELL IMMUNITA ADATTATIVA T B TCR BCR IMMUNOGLOBULINE QuickTime e un decompressore TIFF (Non compresso) sono necessari per visualizzare quest'immagine. Struttura delle Immunoglobuline
More informationChapter 5. Generation of lymphocyte antigen receptors
Chapter 5 Generation of lymphocyte antigen receptors Structural variation in Ig constant regions Isotype: different class of Ig Heavy-chain C regions are encoded in separate genes Initially, only two of
More informationChapter 10 (pages ): Differentiation and Functions of CD4+ Effector T Cells Prepared by Kristen Dazy, MD, Scripps Clinic Medical Group
FIT Board Review Corner September 2015 Welcome to the FIT Board Review Corner, prepared by Andrew Nickels, MD, and Sarah Spriet, DO, senior and junior representatives of ACAAI's Fellows-In-Training (FITs)
More informationImmunology. T-Lymphocytes. 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters,
Immunology T-Lymphocytes 16. Oktober 2014, Ruhr-Universität Bochum Karin Peters, karin.peters@rub.de The role of T-effector cells in the immune response against microbes cellular immunity humoral immunity
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10495 WWW.NATURE.COM/NATURE 1 2 WWW.NATURE.COM/NATURE WWW.NATURE.COM/NATURE 3 4 WWW.NATURE.COM/NATURE WWW.NATURE.COM/NATURE 5 6 WWW.NATURE.COM/NATURE WWW.NATURE.COM/NATURE 7 8 WWW.NATURE.COM/NATURE
More informationTHE EFFECTOR FUNCTIONS OF ANTIBODIES. Catherine Fridman BMC
THE EFFECTOR FUNCTIONS OF ANTIBODIES Catherine Fridman BMC423 2009 HUMORAL IMMUNITYAND CELLULAR IMMUNITY HUMORAL IMMUNITY (ANTIBODIES AND COMPLEMENT) IS USED TO FIGHT AGAINST EXTRACELLULAR BACTERIA CELLULAR
More informationGeneration of post-germinal centre myeloma plasma B cell.
Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused
More informationMolecular Diagnosis. Nucleic acid based testing in Oncology
Molecular Diagnosis Nucleic acid based testing in Oncology Objectives Describe uses of NAT in Oncology Diagnosis, Prediction, monitoring. Genetics Screening, presymptomatic testing, diagnostic testing,
More informationAdaptive Immunity. Jeffrey K. Actor, Ph.D. MSB 2.214,
Adaptive Immunity Jeffrey K. Actor, Ph.D. MSB 2.214, 500-5344 Lecture Objectives: Understand role of various molecules including cytokines, chemokines, costimulatory and adhesion molecules in the development
More informationIntroduction to Immunology Part 2 September 30, Dan Stetson
Introduction to Immunology Part 2 September 30, 2016 Dan Stetson stetson@uw.edu 441 Lecture #2 Slide 1 of 26 CLASS ANNOUNCEMENT PLEASE NO TREE NUTS IN CLASS!!! (Peanuts, walnuts, almonds, cashews, etc)
More informationNucleic Acid Testing - Oncology. Molecular Diagnosis. Gain/Loss of Nucleic Acid. Objectives. MYCN and Neuroblastoma. Molecular Diagnosis
Nucleic Acid Testing - Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Gross alterations in DNA content of tumors (ploidy) Gain/Loss of nucleic acids Markers of Clonality Oncogene/Tumor
More informationAdaptive Immunity: Specific Defenses of the Host
17 Adaptive Immunity: Specific Defenses of the Host SLOs Differentiate between innate and adaptive immunity, and humoral and cellular immunity. Define antigen, epitope, and hapten. Explain the function
More informationT-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
More informationT-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
More informationPrimer on Tumor Immunology. International Society for Biological Therapy of Cancer. C. H. June, M.D. November 10, 2005
Primer on Tumor Immunology International Society for Biological Therapy of Cancer C. H. June, M.D. November 10, 2005 Outline: Primer on Tumor Immunology T Cell Receptors T Cell Biology Tumor immunology
More informationPrepared by: Dr.Mansour Al-Yazji
C L L CLL Prepared by: Abd El-Hakeem Abd El-Rahman Abu Naser Ahmed Khamis Abu Warda Ahmed Mohammed Abu Ghaben Bassel Ziad Abu Warda Nedal Mostafa El-Nahhal Dr.Mansour Al-Yazji LEUKEMIA Leukemia is a form
More informationT Cell Differentiation
T Cell Differentiation Ned Braunstein, MD MHC control of Immune Responsiveness: Concept Whether or not an individual makes an immune response to a particular antigen depends on what MHC alleles an individual
More informationSummary for mid material immunology. THIS APPLIES FOR ALL SECTIONS Heyam Awad
Summary for mid material immunology THIS APPLIES FOR ALL SECTIONS Heyam Awad Innate immune system Innate immunity is composed of: 1. Epithelial barriers: skin, respiratory and gastrointestinal epithelium..
More informationIMMUNOBIOLOGY, BIOL 537 Exam # 2 Spring 1997
Name I. TRUE-FALSE (1 point each) IMMUNOBIOLOGY, BIOL 537 Exam # 2 Spring 1997 Which of the following is TRUE or FALSE relating to immunogenicity of an antigen and T and B cell responsiveness to antigen?
More informationB Cell Activation and the Humoral Immune Response. Micro 204. Molecular and Cellular Immunology 2013 Lecturer: Jason Cyster
B Cell Activation and the Humoral Immune Response Micro 204. Molecular and Cellular Immunology 2013 Lecturer: Jason Cyster Vaccine Quest Vaccines are needed that induce broadly neutralizing antibodies
More information