Human Genetics and Gene Mapping of Complex Traits

Size: px
Start display at page:

Download "Human Genetics and Gene Mapping of Complex Traits"

Transcription

1 Human Genetics and Gene Mapping of Comple Traits Advanced Genetics, Spring 205 Human Genetics Series Tuesday 4/07/5 Nancy L. Saccone,

2 What is different aout Human Genetics (recall from Cristina Strong's lectures) Can study comple ehaviors and cognition, neurgenetics Etensive sequence variation leads to common/comple disease. Common disease, common variant hypothesis 2. Large # of small-effect variants 3. Large # of large-effect rare variants 4. Como of genotypic, environmental, epigenetic interactions Imprinting uniquely mammalian Trinucleotide repeat diseases "anticipation Greg Gison, Nature Rev Genet 202 Clinical impact

3 Testing for interactions GG (epistasis), GE Question: Does the effect of st variale on the outcome differ for different values of the 2 nd variale?

4 GE interaction eample not in humans Cooper and Zuek, rat strains: "maze dull" and "maze right" - selectively red ased on maze performance. Then, two environments: - normal la rearing - "enriched" environment (e.g. playthings, open space)

5 Animal models Cooper and Zuek, 958: mean numer of learning errors normal maze dull maze right enriched as presented in Rowe, 2003

6 Other possile outcomes Another way to get a GE interaction: cross-over normal maze dull maze right enriched

7 Possile outcomes Here's what we might see if there were main effects only (no GE interaction) normal maze dull maze right enriched

8 Possile outcomes another possiility: if no GE interaction AND no main effect of environment normal maze dull maze right enriched

9 Testing for interactions Traditional approach is to use a product term in the regression model Eample (case-control logistic regression analysis) Let P = proaility of eing a case Let = SNP genotype (additive coding) 2 = se (0=male, =female) P ln - P = + 22 To test for interaction etween and 2, i.e. does the SNP effect differ in men vs women: ln P = ( ) - P 2 Is there significant evidence that 3 is different from 0?

10 Eample: = SNP genotype, 2 = se Full model with interaction: Odds Ratio for SNP when 2 = 0 (male) Odds Ratio for SNP when 2 = (female) ] [ e P P [...] 0 [...] 0 0, [...] 0, [...] 0 0 ) /( ) /( e e e e e P P P P OR male [...] [...] 0, [...], [...] 0 0 ) /( ) /( e e e e e P P P P OR female

11 Genomic Imprinting Occurs in mammals (insects, plants) Departure from classical Mendelian genetics: Maternally and paternally inherited alleles are distinguished Epression of allele depends on parent of origin Can e tissue specific Called maternally imprinted if maternal allele is inactive Paternally imprinted if paternal allele is inactive Eample of epigenetics (study of inherited factors that are independent of the DNA sequence itself)

12 Imprinting can generate non-mendelian patterns Trait manifests only when allele is inherited from the mother: Trait manifests only when allele is inherited from the father: Dots indicate non-epressing carriers From Weiss, Genetic variation and human disease, 993 / Hall, 990a, ASHG

13 Genomic Imprinting and Human Disease Prader-Willi Syndrome and Angelman Syndrome (see Joe Dougherty s lecture) Beckwith-Wiedemann Syndrome IGF2 gene normally is imprinted in humans, with the maternal allele silenced Improper activation of the maternal allele leads to BWS Symptoms: overgrowth, increased risk of cancer

14 From Hartl, Essential Genetics 6 th Ed. Genomic Imprinting and Human Disease Prader-Willi Syndrome and Angelman Syndrome

15 Moving from GWAS to post-gwas: Genetics, clinical impact and personalized medicine Priorities for Personalized Medicine Report of the President s Council of Advisors on Science and Technology Septemer 2008 Eecutive Summary Personalized medicine refers to the tailoring of medical treatment to the individual characteristics of each patient. It does not literally mean the creation of drugs or medical devices that are unique to a patient, ut rather the aility to classify individuals into supopulations that differ in their susceptiility to a particular disease or their response to a specific treatment. Preventive or therapeutic interventions can then e concentrated on those who will enefit, sparing epense and side effects for those who will not.

16 Moving from GWAS to post-gwas: Genetics, clinical impact and personalized medicine 20: Green and Guyer (NHGRI), Nature 20: Base pairs to edside not just ench to edside 205: President Oama announced $25 million Precision Medicine Initiative Ojectives: Cancer treatment Voluntary national research cohort (compare with UK research facilitated y nationalized healthcare) Privacy protection Modernizing regulatory landscape Pulic-private partnerships Fact sheet at

17 Improving the effectiveness of healthcare: e.g. genomics to guide personalized medicine E D. Green and M.S. Guyer Nature 20

18 Pharmacologic Treatment Costs/Challenges Side effects Adherence Use restrictions Cost Benefits Efficacy Genomics can guide personalized medicine

19 Smoking cessation pharmacotherapy as an eample But first, some history.

20 2003 The dramatic reduction in smoking [in the US] has een one of the most important recent pulic health successes. The potent effect of pervasive societal changes on [smoking] ehavior will far outweigh any possile enefits of identification of risk genes for individual smokers

21 2006 Genetics studies should e acknowledged as currently unlikely to lead to improved lung cancer prevention compared with the proven, non genetic-ased strategies for smoking cessation

22 Current smoking rates (CDC data) Year % of US adults who were current smokers % % % % % What we have is not enough: Increased social pressure Policy changes Heightened awareness of health consequences Availale pharmacotherapy (e.g. nicotine replacement, others)

23 CHRNA5 predicts cessation success and response to medication Pharmacogenetics and Genomics: Feruary Volume 23 - Issue 2 - p Nicotinic acetylcholine receptor variation and response to smoking cessation therapies Bergen, Andrew W. a ; Javitz, Harold S. a ; Krasnow, Ruth a ; Nishita, Denise a ; Michel, Martha a ; Conti, David V. ; Liu, Jinghua ; Lee, Won ; Edlund, Christopher K. ; Hall, Sharon c ; Kwok, Pui-Yan d ; Benowitz, Neal L. e ; Baker, Timothy B. f ; Tyndale, Rachel F. h ; Lerman, Caryn g ; Swan, Gary E. a

24 Study Design University of Wisconsin TTURC N=073, European Ancestry All sujects received intensive ehavioral counseling Pharmacotherapy arms (NRT, upropion, como) and placeo arm Cessation Astinence at 60 days Time to relapse over 60 days Chen, Baker et al, Am J Psychiatry 202 CHRNA5 haplotype rs Functional amino acid change in CHRNA5 rs CHRNA5 mrna levels in rain and lung Haplotype of 2 variants H (GC, 20.8%) (high risk for dependence) H2 (GT, 43.7%) H3 (AC, 35.5%), low risk for dependence

25 CHRNA5 Predicts Cessation & Response to Medication Astinence 00% Smokers with CHRNA5 low risk 90% Smokers with CHRNA5 high risk 80% 70% 60% 50% 40% 30% Placeo + Counseling Counseling alone Counseling Medication + Medication Counseling 20% 0% 0% Chen, Baker et al, Am J Psychiatry 202 H H2 H3 H: LOW RISK H2 H3: HIGH RISK

26 Numer Needed to Treat (NNT) Varies y Genetic Status Astinence 00% 90% NNT > 000 NNT = 4 NNT: Numer of patients to treat for to enefit 80% 70% 60% 50% 40% 30% Placeo + Counseling Counseling alone Counseling Medication + Medication Counseling 20% 0% 0% H H2 H3 H: LOW RISK H2 H3: HIGH RISK Chen, Baker et al, Am J Psychiatry 202

27 In smokers with high genetic risk, NNT for cessation medication compares very well to current evidence-ased clinical treatments Disorder Treatment Numer needed to treat (NNT) Duodenal Ulcer H Pylori Antiiotics 2 COPD Anticholinergic 6 Stroke Alteplase Hypercholesterolemia Statins Nicotine Dependence NRT 4 in CHRNA5 high risk gp 000 in CHRNA5 low risk gp UpToDate, 203

28 Summary Human gene mapping for comple diseases/traits: Linkage (e.g. Model-ased or model-free analyses in families) Association (e.g. allele/genotype frequency differences unrelated cases-controls; linear and logistic regression; effect size) Genome-wide association studies Linkage disequilirium (LD) Power when tested SNP is in LD with causal SNP Genetic imputation GG and GE interactions Visualizing interactions vs main effects Testing with a product term Imprinting Genomics and personalized medicine (e.g genotype-y treatment interactions)

Pharmacogenetics of Tobacco Smoking and Lung Cancer

Pharmacogenetics of Tobacco Smoking and Lung Cancer Pharmacogenetics of Tobacco Smoking and Lung Cancer Christopher Amos, Ph.D. Laura Bierut, M.D. Caryn Lerman, Ph.D. Rachel Tyndale, Ph.D. Center for Genomic Medicine Geisel College of Medicine at Dartmouth

More information

Example HLA-B and abacavir. Roujeau 2014

Example HLA-B and abacavir. Roujeau 2014 Example HLA-B and abacavir Roujeau 2014 FDA requires testing for abacavir Treatment with abacavir is generally well tolerated, but 5% of the patients experience hypersensitivity reactions that can be life

More information

Imprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821

Imprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Imprinting Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Learning Objectives 1. To understand the basic concepts of genomic imprinting Genomic imprinting is an epigenetic phenomenon that causes

More information

An Introduction to Quantitative Genetics I. Heather A Lawson Advanced Genetics Spring2018

An Introduction to Quantitative Genetics I. Heather A Lawson Advanced Genetics Spring2018 An Introduction to Quantitative Genetics I Heather A Lawson Advanced Genetics Spring2018 Outline What is Quantitative Genetics? Genotypic Values and Genetic Effects Heritability Linkage Disequilibrium

More information

FACT SHEET 15. Epigenetics. What is imprinting of genes? Produced by the Centre for Genetics Education. Internet:

FACT SHEET 15. Epigenetics. What is imprinting of genes? Produced by the Centre for Genetics Education. Internet: Important points It is increasingly clear that translation of the genetic code into proteins is not the only way that our genes influence our growth, development and health and that changes in the genetic

More information

BST227 Introduction to Statistical Genetics. Lecture 4: Introduction to linkage and association analysis

BST227 Introduction to Statistical Genetics. Lecture 4: Introduction to linkage and association analysis BST227 Introduction to Statistical Genetics Lecture 4: Introduction to linkage and association analysis 1 Housekeeping Homework #1 due today Homework #2 posted (due Monday) Lab at 5:30PM today (FXB G13)

More information

Genetics Review. Alleles. The Punnett Square. Genotype and Phenotype. Codominance. Incomplete Dominance

Genetics Review. Alleles. The Punnett Square. Genotype and Phenotype. Codominance. Incomplete Dominance Genetics Review Alleles These two different versions of gene A create a condition known as heterozygous. Only the dominant allele (A) will be expressed. When both chromosomes have identical copies of the

More information

Chromosomes, Mapping, and the Meiosis-Inheritance Connection. Chapter 13

Chromosomes, Mapping, and the Meiosis-Inheritance Connection. Chapter 13 Chromosomes, Mapping, and the Meiosis-Inheritance Connection Chapter 13 Chromosome Theory Chromosomal theory of inheritance - developed in 1902 by Walter Sutton - proposed that genes are present on chromosomes

More information

CS2220 Introduction to Computational Biology

CS2220 Introduction to Computational Biology CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS

More information

Large-scale identity-by-descent mapping discovers rare haplotypes of large effect. Suyash Shringarpure 23andMe, Inc. ASHG 2017

Large-scale identity-by-descent mapping discovers rare haplotypes of large effect. Suyash Shringarpure 23andMe, Inc. ASHG 2017 Large-scale identity-by-descent mapping discovers rare haplotypes of large effect Suyash Shringarpure 23andMe, Inc. ASHG 2017 1 Why care about rare variants of large effect? Months from randomization 2

More information

BST227: Introduction to Statistical Genetics

BST227: Introduction to Statistical Genetics BST227: Introduction to Statistical Genetics Lecture 11: Heritability from summary statistics & epigenetic enrichments Guest Lecturer: Caleb Lareau Success of GWAS EBI Human GWAS Catalog As of this morning

More information

Association of a nicotine receptor polymorphism with reduced ability to quit smoking in pregnancy

Association of a nicotine receptor polymorphism with reduced ability to quit smoking in pregnancy Research Symposium, MRC CAiTE & Department of Social Medicine, University of Bristol, 3 rd March 2009. Association of a nicotine receptor polymorphism with reduced ability to quit smoking in pregnancy

More information

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG

More information

Nicotine dependence treatment: A translational research approach

Nicotine dependence treatment: A translational research approach Washington University School of Medicine Digital Commons@Becker Presentations 2009: Translating Basic Science Findings to Guide Prevention Efforts 2009 Nicotine dependence treatment: A translational research

More information

I. Multiple Alleles. Chapter 5. Summary points. What pattern of inheritance is demonstrated in the following cross?

I. Multiple Alleles. Chapter 5. Summary points. What pattern of inheritance is demonstrated in the following cross? Chapter 5 Extensions and Modifications of Basic Principles I. Multiple Alleles The ABO blood group has multiple alleles codominance and complete dominance. In codominance, both alleles are expressed simultaneously.

More information

Learning Outcomes: The following list provides the learning objectives that will be covered in the lectures, and tutorials of each week:

Learning Outcomes: The following list provides the learning objectives that will be covered in the lectures, and tutorials of each week: Course Code Course Title ECTS Credits MED-306 Medical Genetics 6 School Semester Prerequisites Medical School Spring (Semester 6) MED-103 Biology I MED-109 Biology II MED-204 Biochemistry I MED-209 Biochemistry

More information

Human Genetics 542 Winter 2018 Syllabus

Human Genetics 542 Winter 2018 Syllabus Human Genetics 542 Winter 2018 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Jan 3 rd Wed Mapping disease genes I: inheritance patterns and linkage analysis

More information

GENDER James Bier

GENDER James Bier GENDER 2005-2008 James Bier Objectives 1. State the method of determining gender in several genetic systems. 2. List the three regions of the Y chromosome. 3. Describe the events that promote sexual development

More information

Welcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm

Welcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease

More information

Association mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative

Association mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47

More information

Human Genetics 542 Winter 2017 Syllabus

Human Genetics 542 Winter 2017 Syllabus Human Genetics 542 Winter 2017 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Module I: Mapping and characterizing simple genetic diseases Jan 4 th Wed Mapping

More information

Non-Mendelian inheritance

Non-Mendelian inheritance Non-Mendelian inheritance Focus on Human Disorders Peter K. Rogan, Ph.D. Laboratory of Human Molecular Genetics Children s Mercy Hospital Schools of Medicine & Computer Science and Engineering University

More information

Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.

Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22. Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;

More information

Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur

Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur Human Molecular Genetics Prof. S. Ganesh Department of Biological Sciences and Bioengineering Indian Institute of Technology, Kanpur Module - 02 Lecture - 06 Let us test your understanding of Pedigree

More information

Dependence Treatment: From Mouse to Man to Medicine. Caryn Lerman, Ph.D. Transdisciplinary Tobacco Use Research Center

Dependence Treatment: From Mouse to Man to Medicine. Caryn Lerman, Ph.D. Transdisciplinary Tobacco Use Research Center Nicotine Dependence Treatment: From Mouse to Man to Medicine Caryn Lerman, Ph.D. Transdisciplinary Tobacco Use Research Center UPENN About this presentation Dr. Lerman presented this on December 1, 2009,

More information

2007: Alcohol Use Across the Lifespan

2007: Alcohol Use Across the Lifespan Washington University School of Medicine Digital Commons@Becker Posters 2007: Alcohol Use Across the Lifespan 2007 DSM-IV nicotine withdrawal and alcohol dependence: Association findings with the Nicotinic

More information

Today. Genomic Imprinting & X-Inactivation

Today. Genomic Imprinting & X-Inactivation Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic

More information

Lecture 20. Disease Genetics

Lecture 20. Disease Genetics Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying

More information

The Foundations of Personalized Medicine

The Foundations of Personalized Medicine The Foundations of Personalized Medicine Jeremy M. Berg Pittsburgh Foundation Professor and Director, Institute for Personalized Medicine University of Pittsburgh Personalized Medicine Physicians have

More information

Lecture 7. Chapter 5: Extensions and Modifications of Basic Principles, Part 2. Complementation Test. white squash x white squash WwYy x WwYy

Lecture 7. Chapter 5: Extensions and Modifications of Basic Principles, Part 2. Complementation Test. white squash x white squash WwYy x WwYy Lecture 7 white squash x white squash WwYy x WwYy Chapter 5: Extensions and Modifications of Basic Principles, Part 2 Problem Set 1B due on Monday Genotype W_Y_ 9/16 W_yy 3/16 wwy_ 3/16 wwyy 1/16 Phenotype

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

GENOME-WIDE ASSOCIATION STUDIES

GENOME-WIDE ASSOCIATION STUDIES GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE

More information

Genetics of Nicotine Dependence & Impact of Smoking on Bladder Cancer Risk and Prognosis

Genetics of Nicotine Dependence & Impact of Smoking on Bladder Cancer Risk and Prognosis Genetics of Nicotine Dependence & Impact of Smoking on Bladder Cancer Risk and Prognosis BCAN August 2014 Helena Furberg Barnes Assistant Attending Epidemiologist www.mskcc.org Current smoking in the US

More information

Genetics and Genomics in Medicine Chapter 6 Questions

Genetics and Genomics in Medicine Chapter 6 Questions Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions

More information

Lab Activity 36. Principles of Heredity. Portland Community College BI 233

Lab Activity 36. Principles of Heredity. Portland Community College BI 233 Lab Activity 36 Principles of Heredity Portland Community College BI 233 Terminology of Chromosomes Homologous chromosomes: A pair, of which you get one from mom, and one from dad. Example: the pair of

More information

What#are#the#different#types#of#mutations#&#phenotypic#effects?#Give#an#example#of#a#disease#for#each.#

What#are#the#different#types#of#mutations#&#phenotypic#effects?#Give#an#example#of#a#disease#for#each.# Mutation#Classifications:# a. Location# #understand#the#differences#and#consequences.# # o Germinal* *gametes,*inherited* o Somatic* *other*cells,*not*generally*inherited* o Autosomal* *within*genes*on*autosomes*

More information

Ch 8 Practice Questions

Ch 8 Practice Questions Ch 8 Practice Questions Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What fraction of offspring of the cross Aa Aa is homozygous for the dominant allele?

More information

New Enhancements: GWAS Workflows with SVS

New Enhancements: GWAS Workflows with SVS New Enhancements: GWAS Workflows with SVS August 9 th, 2017 Gabe Rudy VP Product & Engineering 20 most promising Biotech Technology Providers Top 10 Analytics Solution Providers Hype Cycle for Life sciences

More information

Compound heterozygosity Yurii S. Aulchenko yurii [dot] aulchenko [at] gmail [dot] com. Thursday, April 11, 13

Compound heterozygosity Yurii S. Aulchenko yurii [dot] aulchenko [at] gmail [dot] com. Thursday, April 11, 13 Compound heterozygosity Yurii S. Aulchenko yurii [dot] aulchenko [at] gmail [dot] com 1 Outline Recessive model Examples of Compound Heterozygosity Compound Double Heterozygosity (CDH) test 2 Recessive

More information

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1 Supplementary Figure 1 Illustrative example of ptdt using height The expected value of a child s polygenic risk score (PRS) for a trait is the average of maternal and paternal PRS values. For example,

More information

The Chromosomal Basis Of Inheritance

The Chromosomal Basis Of Inheritance The Chromosomal Basis Of Inheritance Chapter 15 Objectives Explain the chromosomal theory of inheritance and its discovery. Explain why sex-linked diseases are more common in human males than females.

More information

5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?

5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits? corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or

More information

Basic Definitions. Dr. Mohammed Hussein Assi MBChB MSc DCH (UK) MRCPCH

Basic Definitions. Dr. Mohammed Hussein Assi MBChB MSc DCH (UK) MRCPCH Basic Definitions Chromosomes There are two types of chromosomes: autosomes (1-22) and sex chromosomes (X & Y). Humans are composed of two groups of cells: Gametes. Ova and sperm cells, which are haploid,

More information

Epigenetics: Basic Principals and role in health and disease

Epigenetics: Basic Principals and role in health and disease Epigenetics: Basic Principals and role in health and disease Cambridge Masterclass Workshop on Epigenetics in GI Health and Disease 3 rd September 2013 Matt Zilbauer Overview Basic principals of Epigenetics

More information

ADVANCED PGT SERVICES

ADVANCED PGT SERVICES Genomic Prediction ADVANCED PGT SERVICES with PGT-A using SEQ is a cost-effective, rigorously validated, unambiguous, and streamlined test for aneuploidy in blastocyst biopsies, and uses state of the art

More information

Information leaflet for patients and families. Uniparental Disomy (UPD)

Information leaflet for patients and families. Uniparental Disomy (UPD) Information leaflet for patients and families Uniparental Disomy (UPD) What are genes and chromosomes? Our genes are the unique set of instructions inside every cell of our body which make each of us an

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance The Chromosomal Basis of Inheritance Factors and Genes Mendel s model of inheritance was based on the idea of factors that were independently assorted and segregated into gametes We now know that these

More information

MOLECULAR EPIDEMIOLOGY Afiono Agung Prasetyo Faculty of Medicine Sebelas Maret University Indonesia

MOLECULAR EPIDEMIOLOGY Afiono Agung Prasetyo Faculty of Medicine Sebelas Maret University Indonesia MOLECULAR EPIDEMIOLOGY GENERAL EPIDEMIOLOGY General epidemiology is the scientific basis of public health Descriptive epidemiology: distribution of disease in populations Incidence and prevalence rates

More information

Biology 2C03 Term Test #3

Biology 2C03 Term Test #3 Biology 2C03 Term Test #3 Instructors: Dr. Kimberley Dej, Ray Procwat Date: Monday March 22, 2010 Time: 10:30 am to 11:20 am Instructions: 1) This midterm test consists of 9 pages. Please ensure that all

More information

American Psychiatric Nurses Association

American Psychiatric Nurses Association Francis J. McMahon International Society of Psychiatric Genetics Johns Hopkins University School of Medicine Dept. of Psychiatry Human Genetics Branch, National Institute of Mental Health* * views expressed

More information

THE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15

THE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15 What you must know: Inheritance in sex-linked genes. Inheritance of linked genes and chromosomal mapping. How alteration of chromosome number or structurally

More information

AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG

AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG AN INTRODUCTION TO EPIGENETICS DR CHLOE WONG MRC SGDP CENTRE, INSTITUTE OF PSYCHIATRY KING S COLLEGE LONDON Oct 2015 Lecture Overview WHY WHAT EPIGENETICS IN PSYCHIARTY Technology-driven genomics research

More information

The Risk of Anti-selection in Protection Business from Advances in Statistical Genetics

The Risk of Anti-selection in Protection Business from Advances in Statistical Genetics The Risk of Anti-selection in Protection Business from Advances in Statistical Genetics Richard Russell, PhD Lead Health Data Scientist Stephen Courquin Head of UK Actuarial Research Peter Banthorpe SVP,

More information

Genetics of COPD Prof. Ian P Hall

Genetics of COPD Prof. Ian P Hall Genetics of COPD 1 Prof. Ian P. Hall Dean, Faculty of Medicine and Health Sciences The University of Nottingham Medical School Ian.Hall@nottingham.ac.uk Chronic obstructive pulmonary disease (COPD) 900,000

More information

High resolution melting for methylation analysis

High resolution melting for methylation analysis High resolution melting for methylation analysis Helen White, PhD Senior Scientist National Genetics Reference Lab (Wessex) Why analyse methylation? Genomic imprinting In diploid organisms somatic cells

More information

MRC Integrative Epidemiology Unit (IEU) at the University of Bristol. George Davey Smith

MRC Integrative Epidemiology Unit (IEU) at the University of Bristol. George Davey Smith MRC Integrative Epidemiology Unit (IEU) at the University of Bristol George Davey Smith The making of a University Unit MRC Centre for Causal Analyses in Translational Epidemiology 2007 to 2013 Interdisciplinary

More information

Human Genetics (Learning Objectives)

Human Genetics (Learning Objectives) Human Genetics (Learning Objectives) Recognize Mendel s contribution to the field of genetics. Review what you know about a karyotype: autosomes and sex chromosomes. Understand and define the terms: characteristic,

More information

A loss-of-function variant in CETP and risk of CVD in Chinese adults

A loss-of-function variant in CETP and risk of CVD in Chinese adults A loss-of-function variant in CETP and risk of CVD in Chinese adults Professor Zhengming CHEN Nuffield Dept. of Population Health University of Oxford, UK On behalf of the CKB collaborative group (www.ckbiobank.org)

More information

Developing Genetic Education for Smoking Cessation. Julia F. Houfek, PhD, APRN-CNS, BC Associate Professor UNMC College of Nursing

Developing Genetic Education for Smoking Cessation. Julia F. Houfek, PhD, APRN-CNS, BC Associate Professor UNMC College of Nursing Developing Genetic Education for Smoking Cessation Julia F. Houfek, PhD, APRN-CNS, BC Associate Professor UNMC College of Nursing Research Team Members Lynne Buchanan, PhD, APRN-NP Pamela Jones, PhD, RN,

More information

115 remained abstinent. 140 remained abstinent. Relapsed Remained abstinent Total

115 remained abstinent. 140 remained abstinent. Relapsed Remained abstinent Total Chapter 10 Exercises 1. Intent-to-treat analysis: Example 1 In a randomized controlled trial to determine whether the nicotine patch reduces the risk of relapse among smokers who have committed to quit,

More information

Genome-wide Association Analysis Applied to Asthma-Susceptibility Gene. McCaw, Z., Wu, W., Hsiao, S., McKhann, A., Tracy, S.

Genome-wide Association Analysis Applied to Asthma-Susceptibility Gene. McCaw, Z., Wu, W., Hsiao, S., McKhann, A., Tracy, S. Genome-wide Association Analysis Applied to Asthma-Susceptibility Gene McCaw, Z., Wu, W., Hsiao, S., McKhann, A., Tracy, S. December 17, 2014 1 Introduction Asthma is a chronic respiratory disease affecting

More information

Genetics and Pharmacogenetics in Human Complex Disorders (Example of Bipolar Disorder)

Genetics and Pharmacogenetics in Human Complex Disorders (Example of Bipolar Disorder) Genetics and Pharmacogenetics in Human Complex Disorders (Example of Bipolar Disorder) September 14, 2012 Chun Xu M.D, M.Sc, Ph.D. Assistant professor Texas Tech University Health Sciences Center Paul

More information

Chapter 15 Chromosomes, Mapping, and the Meiosis - Inheritance Connection

Chapter 15 Chromosomes, Mapping, and the Meiosis - Inheritance Connection hapter 15 hromosomes, Mapping, and the Meiosis - Inheritance onnection 1 XTNSIONS (not really XPTIONS) Sex Linkage rosophila melanogaster fruit fly species eats fungi on fruit generation time 2 weeks ruit

More information

Chapter 15 Notes 15.1: Mendelian inheritance chromosome theory of inheritance wild type 15.2: Sex-linked genes

Chapter 15 Notes 15.1: Mendelian inheritance chromosome theory of inheritance wild type 15.2: Sex-linked genes Chapter 15 Notes The Chromosomal Basis of Inheritance Mendel s hereditary factors were genes, though this wasn t known at the time Now we know that genes are located on The location of a particular gene

More information

3) It is not clear to me why the authors exclude blond hair from the red hair GWAS, and blond and red hair from the brown hair GWAS.

3) It is not clear to me why the authors exclude blond hair from the red hair GWAS, and blond and red hair from the brown hair GWAS. Reviewer #1 (Remarks to the Author): The manuscript from Morgan et al. presents a fascinating in-depth look at the genetics of hair color in the UK Biobank collection. The authors examine nearly 350,000

More information

Mendelian Genetics. Activity. Part I: Introduction. Instructions

Mendelian Genetics. Activity. Part I: Introduction. Instructions Activity Part I: Introduction Some of your traits are inherited and cannot be changed, while others can be influenced by the environment around you. There has been ongoing research in the causes of cancer.

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Baker TB, Piper ME, Stein JH, et al. Effects of nicotine patch vs varenicline vs combination nicotine replacement therapy on smoking cessation at 26 weeks: a randomized clinical

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance Chapter 15 The Chromosomal Basis of Inheritance PowerPoint Lectures for Biology, Seventh Edition Neil Campbell and Jane Reece Lectures by Chris Romero Overview: Locating Genes on Chromosomes A century

More information

The genetics of complex traits Amazing progress (much by ppl in this room)

The genetics of complex traits Amazing progress (much by ppl in this room) The genetics of complex traits Amazing progress (much by ppl in this room) Nick Martin Queensland Institute of Medical Research Brisbane Boulder workshop March 11, 2016 Genetic Epidemiology: Stages of

More information

BIOLOGY - CLUTCH CH.15 - CHROMOSOMAL THEORY OF INHERITANCE

BIOLOGY - CLUTCH CH.15 - CHROMOSOMAL THEORY OF INHERITANCE !! www.clutchprep.com Chromosomal theory of inheritance: chromosomes are the carriers of genetic material. Independent Assortment alleles for different characters sort independently of each other during

More information

The Statistics of Inheritance

The Statistics of Inheritance Why? The Statistics of Inheritance How can statistics help predict the traits of offspring? The randomization of alleles from the parents genetic material is essential to the survival and evolution of

More information

Investigating causality in the association between 25(OH)D and schizophrenia

Investigating causality in the association between 25(OH)D and schizophrenia Investigating causality in the association between 25(OH)D and schizophrenia Amy E. Taylor PhD 1,2,3, Stephen Burgess PhD 1,4, Jennifer J. Ware PhD 1,2,5, Suzanne H. Gage PhD 1,2,3, SUNLIGHT consortium,

More information

Copyright Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.

Copyright Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited. 94 Original article Nicotinic acetylcholine receptor variation and response to smoking cessation therapies Andrew W. Bergen a, Harold S. Javitz a, Ruth Krasnow a, Denise Nishita a, Martha Michel a, David

More information

What is the relationship between genes and chromosomes? Is twinning genetic or can a person choose to have twins?

What is the relationship between genes and chromosomes? Is twinning genetic or can a person choose to have twins? WHAT WILL YOU KNOW? What is the relationship between genes and chromosomes? Is twinning genetic or can a person choose to have twins? How could a person have the gene for something that is never apparent?

More information

Name Date Class. Main Idea. Human traits are controlled by single genes with two alleles, single genes with... a. b. c.

Name Date Class. Main Idea. Human traits are controlled by single genes with two alleles, single genes with... a. b. c. Modern Genetics Name Date Class Modern Genetics Guided Reading and Study Human Inheritance This section explains some patterns of inheritance in humans. It also describes the functions of the sex chromosomes

More information

Genetic Assessment and Counseling

Genetic Assessment and Counseling Genetic Assessment and Counseling Genetic counseling is the communication of information and advice about inherited conditions and a person seeking such advice is called a consultand. This process includes

More information

Does prenatal alcohol exposure affect neurodevelopment? Attempts to give causal answers

Does prenatal alcohol exposure affect neurodevelopment? Attempts to give causal answers Does prenatal alcohol exposure affect neurodevelopment? Attempts to give causal answers Luisa Zuccolo l.zuccolo@bristol.ac.uk MRC IEU, School of Social and Community Medicine Background Prenatal alcohol

More information

Chapter 15: The Chromosomal Basis of Inheritance

Chapter 15: The Chromosomal Basis of Inheritance Name Chapter 15: The Chromosomal Basis of Inheritance 15.1 Mendelian inheritance has its physical basis in the behavior of chromosomes 1. What is the chromosome theory of inheritance? 2. Explain the law

More information

CONTENT SUPPLEMENTARY FIGURE E. INSTRUMENTAL VARIABLE ANALYSIS USING DESEASONALISED PLASMA 25-HYDROXYVITAMIN D. 7

CONTENT SUPPLEMENTARY FIGURE E. INSTRUMENTAL VARIABLE ANALYSIS USING DESEASONALISED PLASMA 25-HYDROXYVITAMIN D. 7 CONTENT FIGURES 3 SUPPLEMENTARY FIGURE A. NUMBER OF PARTICIPANTS AND EVENTS IN THE OBSERVATIONAL AND GENETIC ANALYSES. 3 SUPPLEMENTARY FIGURE B. FLOWCHART SHOWING THE SELECTION PROCESS FOR DETERMINING

More information

E). Children regress; become vegetative, and 5). Autosomal dominant; shows anticipation.

E). Children regress; become vegetative, and 5). Autosomal dominant; shows anticipation. published BIO212 MIDTERM #2, SECTION.11/1/04. ALL ANSWERS MUST GO ON THE ANSWER SHEET; YOU ARE LIMITED TO THE SPACE PROVIDED FOR EACH ANSWER. YOU MAY USE THE BACKS OF THE PAGES FOR SCRAP/CALCULATIONS.

More information

Genetic association analysis incorporating intermediate phenotypes information for complex diseases

Genetic association analysis incorporating intermediate phenotypes information for complex diseases University of Iowa Iowa Research Online Theses and Dissertations Fall 2011 Genetic association analysis incorporating intermediate phenotypes information for complex diseases Yafang Li University of Iowa

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance Chapter 15 The Chromosomal Basis of Inheritance PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

Introduction to linkage and family based designs to study the genetic epidemiology of complex traits. Harold Snieder

Introduction to linkage and family based designs to study the genetic epidemiology of complex traits. Harold Snieder Introduction to linkage and family based designs to study the genetic epidemiology of complex traits Harold Snieder Overview of presentation Designs: population vs. family based Mendelian vs. complex diseases/traits

More information

Smoking in offspring of alcoholic twins

Smoking in offspring of alcoholic twins Washington University School of Medicine Digital Commons@Becker Posters 2006: Alcohol and Tobacco Dependence: from Bench to Bedside 2006 Smoking in offspring of alcoholic twins Jeffrey F. Scherrer Washington

More information

Key Questions. Vocabulary probability homozygous heterozygous phenotype. independent assortment

Key Questions. Vocabulary probability homozygous heterozygous phenotype. independent assortment Proaility and Punnett Squares Applying Mendel s Principles THINK AOUT IT Nothing in life is certain. There s a great deal of wisdom in that old saying, and genetics is a fine example. If a parent carries

More information

The Chromosomal Basis of Inheritance

The Chromosomal Basis of Inheritance Chapter 15 The Chromosomal Basis of Inheritance PowerPoint Lecture Presentations for Biology Eighth Edition Neil Campbell and Jane Reece Lectures by Chris Romero, updated by Erin Barley with contributions

More information

10/19/2017. How Nutritional Genomics Affects You in Nutrition Research and Practice Joyanna Hansen, PhD, RD & Kristin Guertin, PhD, MPH

10/19/2017. How Nutritional Genomics Affects You in Nutrition Research and Practice Joyanna Hansen, PhD, RD & Kristin Guertin, PhD, MPH Disclosures Joyanna Hansen How Affects You in Nutrition Research and Practice Joyanna Hansen, PhD, RD & Kristin Guertin, PhD, MPH Consultant Nutricia North America Research Support Academy of Nutrition

More information

Introduction to the Genetics of Complex Disease

Introduction to the Genetics of Complex Disease Introduction to the Genetics of Complex Disease Jeremiah M. Scharf, MD, PhD Departments of Neurology, Psychiatry and Center for Human Genetic Research Massachusetts General Hospital Breakthroughs in Genome

More information

Heredity and Meiosis AP BIOLOGY. Heredity. Slide 1 / 142 Slide 2 / 142. Slide 4 / 142. Slide 3 / 142. Slide 6 / 142. Slide 5 / 142.

Heredity and Meiosis AP BIOLOGY. Heredity. Slide 1 / 142 Slide 2 / 142. Slide 4 / 142. Slide 3 / 142. Slide 6 / 142. Slide 5 / 142. Slide 1 / 142 Slide 2 / 142 AP BIOLOGY Heredity Slide 3 / 142 Slide 4 / 142 Heredity Unit Topics Click on the topic to go to that section Heredity & Meiosis Law of Independent Assortment What Mendel Didn't

More information

The CHRNA3 gene encoding the neuronal. CHRNA3 genotype, nicotine dependence, lung function and disease in the general population

The CHRNA3 gene encoding the neuronal. CHRNA3 genotype, nicotine dependence, lung function and disease in the general population Eur Respir J 2012; 40: 1538 1544 DOI: 10.1183/09031936.00176811 CopyrightßERS 2012 CHRNA3 genotype, nicotine dependence, lung function and disease in the general population Diljit Kaur-Knudsen, Børge G.

More information

Mendelian & Complex Traits. Quantitative Imaging Genomics. Genetics Terminology 2. Genetics Terminology 1. Human Genome. Genetics Terminology 3

Mendelian & Complex Traits. Quantitative Imaging Genomics. Genetics Terminology 2. Genetics Terminology 1. Human Genome. Genetics Terminology 3 Mendelian & Complex Traits Quantitative Imaging Genomics David C. Glahn, PhD Olin Neuropsychiatry Research Center & Department of Psychiatry, Yale University July, 010 Mendelian Trait A trait influenced

More information

OVERVIEW OF EPIGENETICS

OVERVIEW OF EPIGENETICS OVERVIEW OF EIENETICS Date: * Time: 9:00 am - 9:50 am * Room: Berryhill 103 Lecturer: Terry Magnuson 4312 MBRB trm4@med.unc.edu 843-6475 *lease consult the online schedule for this course for the definitive

More information

For more information about how to cite these materials visit

For more information about how to cite these materials visit Author(s): Kerby Shedden, Ph.D., 2010 License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution Share Alike 3.0 License: http://creativecommons.org/licenses/by-sa/3.0/

More information

European Educational Programme in Epidemiology

European Educational Programme in Epidemiology European Educational Programme in Epidemiology 32 nd RESIDENTIAL SUMMER COURSE FLORENCE, ITALY Specialized Courses 8 12 JULY 2019 1/15 European Educational Programme in Epidemiology Specialized Courses:

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Hartwig FP, Borges MC, Lessa Horta B, Bowden J, Davey Smith G. Inflammatory biomarkers and risk of schizophrenia: a 2-sample mendelian randomization study. JAMA Psychiatry.

More information

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1 Supplementary Figure 1 Replicability of blood eqtl effects in ileal biopsies from the RISK study. eqtls detected in the vicinity of SNPs associated with IBD tend to show concordant effect size and direction

More information

Codominance. P: H R H R (Red) x H W H W (White) H W H R H W H R H W. F1: All Roan (H R H W x H R H W ) Name: Date: Class:

Codominance. P: H R H R (Red) x H W H W (White) H W H R H W H R H W. F1: All Roan (H R H W x H R H W ) Name: Date: Class: Name: Date: Class: (Exceptions to Mendelian Genetics Continued) Codominance Firstly, it is important to understand that the meaning of the prefix "co is "together" (i.e. cooperate = work together, coexist

More information

Medical Genetics in Undergraduate Medicine

Medical Genetics in Undergraduate Medicine Medical Genetics in Undergraduate Medicine Sandra Marles Section Leader without Separate Clerkship Overall Goal of New Genetics Curriculum To integrate teaching of genetic principles, genetic diseases

More information

Index. Child Adolesc Psychiatric Clin N Am 16 (2007) Note: Page numbers of article titles are in boldface type.

Index. Child Adolesc Psychiatric Clin N Am 16 (2007) Note: Page numbers of article titles are in boldface type. Child Adolesc Psychiatric Clin N Am 16 (2007) 745 749 Index Note: Page numbers of article titles are in boldface type. A Adolescent(s), velocardiofacial syndrome in, psychiatric disorders associated with,

More information

Host Genomics of HIV-1

Host Genomics of HIV-1 4 th International Workshop on HIV & Aging Host Genomics of HIV-1 Paul McLaren École Polytechnique Fédérale de Lausanne - EPFL Lausanne, Switzerland paul.mclaren@epfl.ch Complex trait genetics Phenotypic

More information