Mechanisms underlying epigene2c effects of endocrine disrup2ve chemicals. Joëlle Rüegg
|
|
|
- Catherine Neal
- 5 years ago
- Views:
Transcription
1 Mechanisms underlying epigene2c effects of endocrine disrup2ve chemicals Joëlle Rüegg
2 2 EDCs and human health Bisphenol A Epigenetic mechanisms Behavioural and psychiatric disorders Phthalates DNA methylation Cancer Methoxychlor Histone code Impaired sexual development Decreased fertility Dioxins Obesity and diabetes II
3 3 Regulation of DNA methylation DNMTs 5mC TETs C DNMTs + BER 5caC TETs 5fC 5hmC TETs But how are these factors targeted? May 12, 2015 Reik and Walter, Nature Reviews, 2001
4 4 EDC targets bind to specific genomic loci Nucleus ER ER ERE Estrogen receptor alpha & beta Androgen receptor Glucocortiocoid receptor Thyroid hormone receptor Retinoic acid receptors Arylhydrocarbon receptor Can ERs (and other nuclear receptors) target DNA (de)methylation? Is this the mechanism underlying the epigenetic effects of EDCs?
5 5 ERb is involved in regulation of DNA methylation MEFs Adipocytes wt ERa knock out Sp1 Sp1 Sp1 LXR RXR LXRE Glut4 promoter Sp1 ERb knock out Sp1 Sp1 LXRE Rüegg et al., Mol. Endocrinology, 2012 Ø 2055 hypermethylated loci Ø 6016 hypomethylated loci
6 6 Hypomethylated Hypermethylated 100 wt berko berkoherb 100 % methyla2on CpG CpG rela2ve expression ERb seems to be important for the establishment 0 of the DNA pattern at specific genomic regions
7 7 Possible interaction partners DNMTs C 5mC TETs 5hmC + BER TETs 5caC 5fC 7
8 8 ERb interacts with Far western blot analysis -ChIP in MEFs + - relative enrichment wt berko berkoherb 0 HoxA10 Tnfaip2 Hypermethylated loci ERb interacts with and recruits it to regions that are hypermethylated in the absence of ERb Pitx1 Duong et al., submitted
9 9 Working model ESC Differentiation Neuron DNMT TET EDCs TETs DNMTs Neurodevelopment Mental and neurological health C 5mC 5hmC 5fC 5caC DNMTs TETs
10 10 Fkbp51 and the HPA-axis Fkbp5
11 11 BPA affects stress response and behaviour in rats In utero exposure to BPA BPA ng/ml Corticosterone levels control male BPA male control female BPA female basal 60 min post stress Does BPA affect Fkbp5? Panagiotidou et al. J Endocrinol 2014;220:
12 12 BPA affects Fkbp5 methylation and expression in rats Hippocampal Fkbp51 expression DNA methylation at Fkbp5 intron 5 male Fkbp51/GAPDH ratio * * * * * male control male BPA female control female BPA % methylation * ** * * ** control BPA 0.0 basal post stress 0 CpG1 CpG2 CpG3 CpG4 CpG5 CpG6 CpG7 Kitraki et al., in revision
13 HT22 cells: an in vitro model for neuronal differentiation Fig. 1. Expression of essential cholinergic markers in differentiated HT22 cells. Expression of essential cholinergic markers in differentiated HT22 cells. Panel A, RT-PCR analysis of the expression of mrnas encoding M1, M2, M4 machr subtypes, ChAT, VAChT and GAPDH in brain from C57BL/6J mice (positive control) and in differentiated HT22 cells. NC, PCR negative controls in the absence of template DNA. Panels B and C, representative ICC staining of ChAT (green) in differentiated HT22 cells in the presence and absence of the primary antibody, respectively. Panels D, E and F, representative ICC staining of HACT, M2 and M4 in differentiated HT22 cells. Positive staining was shown in red. For all ICC, nuclei were revealed by DAPI in blue. Scale bar, 30 μm. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.) undifferentiated differentiated Liu et al., Life Sciences, 2009 Fig. 2. Comparisons between undifferentiated and differentiated HT22 cells for their morphology and expression of cholinergic markers. Panels A and B, representative phase contrast images of undifferentiated (A) and differentiated (B) HT22 cells. Scale bar, 30 μm. Panel C, Western blots for expression of ChAT, HACT, M1, M2, and M4 machr subtypes in undifferentiated and differentiated HT22 cells. Actin was used as an internal control. Change to medium w/o BPA 2 days Differentiation +/- BPA Fig. 2. Comparisons between undifferentiated and differentiated HT22 cells for their morphology and expression of cholinergic markers. Panels A and B, representative phase contrast images of undifferentiated (A) and differentiated (B) HT22 cells. Scale bar, 30 μm. Panel C, Western blots for expression of ChAT, HACT, M1, M2, and M4 machr subtypes in undifferentiated and differentiated HT22 cells. Actin was used as an internal control. Harvest 3 days
14 14 BPA affects Fkbp5 methylation and expression in vitro B relative expression expression after BPA treatment rel. to untreated control 1 nm BPA shcontrol Fkbp5 expression *** 10 nm BPA *** 100 nm BPA *** 1 um BPA Fkbp5 expression * sherbeta *** 10 um BPA % methylation % methylation DNA methylation at Fkbp5 intron 5 CpG 5 control * * Is the effect of BPA ERbeta dependent? Fkbp5 methylation 1 um BPA CpG 6 * 14 no BPA 10 nm BPA 1 um BPA shcontrol sherb Kitraki et al., in revision
15 15 Summary and plans ESC Differentiation Neuron DNMT TET EDCs TETs DNMTs Neurodevelopment Mental and neurological health C 5mC 5hmC 5fC 5caC DNMTs TETs Investigating the effect of EDCs on NR-regulator interaction EDCs? FCS FRET Monitoring gene activation/silencing by DNA methylation undifferentiated EDCs? differentiation differentiated
16 16 The epigenome is sensitive to environmental factors.. But it is reversible! 16
17 Thanks to 17 Group Ekström Group Schär Nancy Bretschneider Martin Seifert National and Kapodistrian University of Athens: Efthymia Kitraki All my colleagues at Fonds zur Förderung des akademischen Nachwuchses you for your attention!
18 18 18
19 19 DNMTs Summary II HYPERMETHYLATION, MEF TET wt berko HYPOMETHYLATION, wt ESC Loss of pluripotency MEF EDCs DNMT TET TETs DNMTs TET berko DNMT C 5mC 5hmC 5fC 5caC
20 20 Integrating my research Relevance+for+humans+ Correla0on'with'methyla0on' pa2erns'in'epidemiological'and' clinical'samples' Biomarkers+for+exposure+and+health+ outcomes+ Physiological+outcomes+ Effects'of'EDCs'on'neurogenesis'in#vitro#and#behaviour' in#vivo# Relevance+of+in#vitro#findings+for+the+intact+organism+ Molecular+mechanisms+ Effects'of'EDCs'on'epigene0c'pa2erning'and'interac0on'between' NRs'and'regulators'of'DNA'methyla0on' Novel+insights+into+modes+of+ac8on+ Screening+systems+for+epigene8c+changes+
Estrogen receptor beta regulates locus-specific DNA methylation a possible mechanism for epigenetic effects of endocrine disrupters
Estrogen receptor beta regulates locus-specific DNA methylation a possible mechanism for epigenetic effects of endocrine disrupters Joëlle Rüegg Swedish Toxicology Science Research Center, Swetox Karolinska
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
Figure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
Endocrine Disrupters as Obesogens
Endocrine Disrupters as Obesogens Is the environment making us fat? Bruce Blumberg, Ph.D. Department of Developmental and Cell Biology Department of Pharmaceutical Sciences Developmental Biology Center
Plasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for
RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD
RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD Aurora Healthcare, Milwaukee, WI INTRODUCTION v Epigenetic aberration and genetic alteration
Epigenetic Pathways Linking Parental Effects to Offspring Development. Dr. Frances A. Champagne Department of Psychology, Columbia University
Epigenetic Pathways Linking Parental Effects to Offspring Development Dr. Frances A. Champagne Department of Psychology, Columbia University Prenatal & Postnatal Experiences Individual differences in brain
SOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
Dominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer
Dominic J Smiraglia, PhD Department of Cancer Genetics DNA methylation in prostate cancer Overarching theme Epigenetic regulation allows the genome to be responsive to the environment Sets the tone for
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
DOHaD: Role of environmental chemical exposures
DOHaD: Role of environmental chemical exposures Linda S. Birnbaum, Ph.D., D.A.B.T., A.T.S. Director, National Institute of Environmental Health Sciences and National Toxicology Program PPTox-IV Boston,
Supplementary Figure 1
Supplementary Figure 1 14 12 SEM4C PLXN2 8 SEM4C C 3 Cancer Cell Non Cancer Cell Expression 1 8 6 6 4 log2 ratio Expression 2 1 4 2 2 p value.1 D Supplementary Figure 1. Expression of Sema4C and Plexin2
Dioxin induces Ahr-dependent robust DNA demethylation of the Cyp1a1 promoter via Tdg in the mouse liver
Dioxin induces Ahr-dependent robust DNA demethylation of the Cypa promoter via Tdg in the mouse liver Hesbon Z. Amenya, Chiharu Tohyama, Seiichiroh Ohsako Laboratory of Environmental Health Sciences, Center
Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
Supplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2607 Figure S1 Elf5 loss promotes EMT in mammary epithelium while Elf5 overexpression inhibits TGFβ induced EMT. (a, c) Different confocal slices through the Z stack image. (b, d) 3D rendering
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb2566 Figure S1 CDKL5 protein expression pattern and localization in mouse brain. (a) Multiple-tissue western blot from a postnatal day (P) 21 mouse probed with an antibody against CDKL5.
2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a
Supplementary figure legends Supplementary Figure 1. Expression of Shh signaling components in a panel of gastric cancer. (A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and
SUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1. Hippocampal sections from new-born Pten+/+ and PtenFV/FV pups were stained with haematoxylin and eosin (H&E) and were imaged at (a) low and (b) high
SUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
The Big Picture of Trace chemicals
Impacts of Trace Chemicals on the Environment David O. Norris Integrative Physiology University of Colorado at Boulder david.norris@colorado.edu The Big Picture of Trace chemicals And how we all fit into
Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
Chapter 4. Estrogen receptor expression in human macrophages
Chapter 4 Estrogen receptor expression in human macrophages 4.1. Introduction Macrophages respond to estrogen present in their microenvironment and hence should express functional estrogen receptors unless
Rishabh Kala 1, Harsh N. Shah 1, Samantha L. Martin 1 and Trygve O. Tollefsbol 1,2,3,4,5*
Kala et al. BMC Cancer (2015) 15:672 DOI 10.1186/s12885-015-1693-z RESEARCH ARTICLE Open Access Epigenetic-based combinatorial resveratrol and pterostilbene alters DNA damage response by affecting SIRT1
Control. csarnt -/- Cre, f/f
ody weight (g) A re,f/f re x f/f f/+ re, f/+ re,f/+ f/f x f/f f/+ cs -/- re, f/f re f/f re, f/f Normal chow Tamoxifen Tamoxifen Tamoxifen W 4W re f/f re, re/ff f/f re f/f re, re/ff f/f Normal chow Tamoxifen
Supplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
Mohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi
Role of Vitamin D receptor (VDR) in HIV induced tubular injury Mohammad Husain Department of Biotechnology, Jamia Millia Islamia New Delhi 07/10/2015 INTRODUCTION Vitamin D is technically not a Vitamin;
marker. DAPI labels nuclei. Flies were 20 days old. Scale bar is 5 µm. Ctrl is
Supplementary Figure 1. (a) Nos is detected in glial cells in both control and GFAP R79H transgenic flies (arrows), but not in deletion mutant Nos Δ15 animals. Repo is a glial cell marker. DAPI labels
Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen
Xenoestrogen-induced Regulation of EZH2 and Histone Methylation via Non-Genomic Estrogen Receptor Signaling to PI3K/AKT Tiffany G. Bredfeldt, Kristen L. Greathouse, Stephen H. Safe, Mien-Chie Hung, Mark
Endocrine Disrupter Chemicals: Universal Access to Healthcare
Endocrine Disrupter Chemicals: the right to know Riana Bornman, School of Health Systems and Public Health, University of Pretoria SAMA Conference 2016 Universal Access to Healthcare Concern started SOS-EDCs
Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of
Supplemental Figure Legends Supplemental Figure 1. Western blot analysis indicated that was detected in the fractions of plasma membrane and cytosol but not in nuclear fraction isolated from Pkd1 null
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence
Supplemental Table 1. Primers used for RT-PCR analysis of inflammatory cytokines Gene Primer Sequence IL-1α Forward primer 5 -CAAGATGGCCAAAGTTCGTGAC-3' Reverse primer 5 -GTCTCATGAAGTGAGCCATAGC-3 IL-1β
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts
Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts (TIG-3 cells) were rendered senescent by either serial passage
SHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
SUPPLEMENTARY INFORMATION
Supplementary Figure 1. Behavioural effects of ketamine in non-stressed and stressed mice. Naive C57BL/6 adult male mice (n=10/group) were given a single dose of saline vehicle or ketamine (3.0 mg/kg,
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
Prenatal alcohol exposure and metabolic disease in adulthood
8 th International Research Conference on Adolescents and Adults with FASD Prenatal alcohol exposure and metabolic disease in adulthood Prof Karen Moritz Director Child Health Research Centre University
Social deficits in Shank3-deficient mouse models of autism are rescued by histone deacetylase (HDAC) inhibition
SUPPLEMENTARY INFORMATION Articles https://doi.org/10.1038/s41593-018-0110-8 In the format provided by the authors and unedited. Social deficits in Shank3-deficient mouse models of autism are rescued by
Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.
Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets
Bisphenol A (BPA) and Cardiovascular diseases in Lebanon
Bisphenol A (BPA) and Cardiovascular diseases in Lebanon Mona Nasrallah M.D Internal Medicine, Endocrinology Second Annual VMP Research Retreat American University of Beirut August 24, 2013 Assessment
Supplementary Table S1. Tumor samples used for analysis Tumor size (cm) BNG (grade) ERα PR. pn-
Supplementary Table S1. Tumor samples used for analysis Sample# Age Tumor size (cm) pn- Stage Stage BNG (grade) ERα PR HER2 (FISH) Triple negative T1 46 3 N1a III 2 Pos Neg N T2 58 1 N(i-) I 3 Pos Neg
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Díaz et al., http://www.jcb.org/cgi/content/full/jcb.201209151/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Hypoxia induces invadopodia formation in different epithelial
Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.
Supplementary Figure 1 Production of cytokines and chemokines after vaginal HSV-2 infection. C57BL/6 mice were (a) treated intravaginally with 20 µl of PBS or infected with 6.7x10 4 pfu of HSV-2 in the
Exposures and Heritable Health Effects
Exposures and Heritable Health Effects Thaddeus T. Schug Population Health Branch National Institute of Environmental Health Sciences November 30, 2017 Outline Developmental exposures and health effects
Supplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
Genes, Aging and Skin. Helen Knaggs Vice President, Nu Skin Global R&D
Genes, Aging and Skin Helen Knaggs Vice President, Nu Skin Global R&D Presentation Overview Skin aging Genes and genomics How do genes influence skin appearance? Can the use of Genomic Technology enable
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/7/310/ra11/dc1 Supplementary Materials for STAT3 Induction of mir-146b Forms a Feedback Loop to Inhibit the NF-κB to IL-6 Signaling Axis and STAT3-Driven Cancer
Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
Stem Cell Epigenetics
Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )
Supplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse
Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse Martha Susiarjo 1,2, Isaac Sasson 3, Clementina Mesaros 4, Marisa S. Bartolomei 1,2 * 1 Department of Cell and Developmental Biology, University
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
Supplemental Figure S1. RANK expression on human lung cancer cells.
Supplemental Figure S1. RANK expression on human lung cancer cells. (A) Incidence and H-Scores of RANK expression determined from IHC in the indicated primary lung cancer subgroups. The overall expression
EPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin
Supplementary Figure 1. Baf60c and baf180 are induced during cardiac regeneration in zebrafish. RNA in situ hybridization was performed on paraffin sections from sham-operated adult hearts (a and i) and
Supplementary Figure 1
Combination index (CI) Supplementary Figure 1 2. 1.5 1. Ishikawa AN3CA Nou-1 Hec-18.5...2.4.6.8 1. Fraction affected (Fa) Supplementary Figure 1. The synergistic effect of PARP inhibitor and PI3K inhibitor
Morphogens: What are they and why should we care?
Morphogens: What are they and why should we care? Historic, Theoretical Mechanism of Action Nucleoprotein: the specific trophic cellular material extracted from the cell nucleus. DNA and RNA which regulates
Epigenetics: A historical overview Dr. Robin Holliday
Epigenetics 1 Rival hypotheses Epigenisis - The embryo is initially undifferentiated. As development proceeds, increasing levels of complexity emerge giving rise to the larval stage or to the adult organism.
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
Bisphenol A (BPA) Affects Reproductive Formation across Generations in Mice
NOTE Anatomy Bisphenol A (BPA) Affects Reproductive Formation across Generations in Mice Masato HIYAMA 1), Ehn-Kyong CHOI 2), Shoichi WAKITANI 1), Toru TACHIBANA 1), Hamayun KHAN 1), Ken Takeshi KUSAKABE
Supplementary Materials for
www.sciencesignaling.org/cgi/content/full/9/439/ra78/dc1 Supplementary Materials for Small heterodimer partner mediates liver X receptor (LXR) dependent suppression of inflammatory signaling by promoting
Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease
1 Supplemental Materials 2 3 Title: Epigenetic mechanisms underlying maternal diabetes-associated risk of congenital heart disease 4 5 6 Authors: Madhumita Basu, 1 Jun-Yi Zhu, 2 Stephanie LaHaye 1,3, Uddalak
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was
Supplementary Figure 1 IMQ-Induced Mouse Model of Psoriasis. IMQ cream was painted on the shaved back skin of CBL/J and BALB/c mice for consecutive days. (a, b) Phenotypic presentation of mouse back skin
Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region
Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region methylation in relation to PSS and fetal coupling. A, PSS values for participants whose placentas showed low,
SUPPLEMENTARY FIGURE LEGENDS. atypical adenomatous hyperplasias (AAH); Grade II: adenomas; Grade III: adenocarcinomas;
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure S1: Tumor grades in Ras G12D ; p53 / lung tumors. Representative histology (H&E) of K-Ras G12D ; p53 / lung tumors 13 weeks after tumor initiation. Grade
Effects of TBCO on the Reproductive Capacity of 2 Generations of Japanese Medaka (Oryzias latipes)
Effects of on the Reproductive Capacity of 2 Generations of Japanese Medaka (Oryzias latipes) Br Br Br Br Steve Wiseman University of Saskatchewan Multigenerational Effects Pesticides Vinclozolin (anti-androgen)
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
Effective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG
Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG
SUPPLEMENTARY FIGURES: Supplementary Figure 1
SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic
Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering
nature methods Organelle-specific, rapid induction of molecular activities and membrane tethering Toru Komatsu, Igor Kukelyansky, J Michael McCaffery, Tasuku Ueno, Lidenys C Varela & Takanari Inoue Supplementary
Supplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
The role of DNMT3A and HOXA9 hypomethylation in acute myeloid leukemia (AML)
Campbell Drohan BIOL 463 December 2016 The role of DNMT3A and HOXA9 hypomethylation in acute myeloid leukemia (AML) Introduction Epigenetic modifications of DNA and histones are key to gene regulation
Supplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
Gene Expression DNA RNA. Protein. Metabolites, stress, environment
Gene Expression DNA RNA Protein Metabolites, stress, environment 1 EPIGENETICS The study of alterations in gene function that cannot be explained by changes in DNA sequence. Epigenetic gene regulatory
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
s u p p l e m e n ta ry i n f o r m at i o n
Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)
(A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC,
Supplemental Figure Legends Figure S1. Cell line characterization (A) Cells grown in monolayer were fixed and stained for surfactant protein-c (SPC, green) and co-stained with DAPI to visualize the nuclei.
Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections
Supplementary Figure 1. Expression of phospho-sik3 in normal and osteoarthritic articular cartilage in the knee. (a) Semiserial histological sections of normal cartilage were stained with safranin O-fast
SUPPLEMENTAL FILE. mir-22 and mir-29a are members of the androgen receptor cistrome modulating. LAMC1 and Mcl-1 in prostate cancer
1 SUPPLEMENTAL FILE 2 3 mir-22 and mir-29a are members of the androgen receptor cistrome modulating LAMC1 and Mcl-1 in prostate cancer 4 5 6 Lorenza Pasqualini 1, Huajie Bu 1,2, Martin Puhr 1, Narisu Narisu
Alpha thalassemia mental retardation X-linked. Acquired alpha-thalassemia myelodysplastic syndrome
Alpha thalassemia mental retardation X-linked Acquired alpha-thalassemia myelodysplastic syndrome (Alpha thalassemia mental retardation X-linked) Acquired alpha-thalassemia myelodysplastic syndrome Schematic