Analysis of loss of chromosome 10q, DMBT1 homozygous deletions, and PTEN mutations in oligodendrogliomas

Transcription

1 J Neurosurg 97: , 2002 Analysis of loss of chromosome 10q, DMBT1 homozygous deletions, and PTEN mutations in oligodendrogliomas MARC SANSON, M.D., PH.D., PASCAL LEURAUD, M.SC., LUCINDA AGUIRRE-CRUZ, M.D., JIÉ HE, M.D., YANNICK MARIE, M.SC., STÉPHANIE CARTALAT-CAREL, M.D., KARIMA MOKHTARI, M.D., HUGUES DUFFAU, M.D., JEAN-YVES DELATTRE, M.D., AND KHÊ HOANG-XUAN, M.D. INSERM U495, Laboratoire de Biologie des Interactions Neurones-Glie; Fédération de Neurologie Mazarin; Laboratoire de Neuropathologie R Escourolle; and Service de Neurochirurgie; Groupe Hospitalier Pitié-Salpêtrière and Université Pierre et Marie Curie, Paris, France D Object. Chromosomal deletions of 10q and candidate genes such as PTEN and DMBT1 have been thoroughly investigated in glioblastomas but few data specifically address oligodendrogliomas. Methods. In this study, 39 pure oligodendrogliomas were investigated for loss of heterozygosity (LOH) on 10q, PTEN mutations, and DMBT1 homozygous deletions. The LOH on 10q was found in 19 (48%) of 39 oligodendrogliomas and was closely related to anaplasia (p = 0.02), shorter time to progression (p = ), and poorer survival (p = 0.035). The DMBT1 homozygous deletions were found in 10 (26%) of 39 oligodendrogliomas but only one PTEN mutation was detected. The LOH on 10q is a strong predictor of survival and could be a valuable prognostic marker in oligodendrogliomas. Conclusions. Frequent inactivation of DMBT1 contrasting with rare mutations of PTEN may indicate that DMBT1 is preferentially involved in oligodendrogliomas. Nevertheless, the absence of a correlation with survival makes the role of DMBT1 in tumorigenesis still questionable and warrants further investigation. KEY WORDS oligodendroglioma chromosome 10 tumor suppressor gene loss of heterozygosity prognostic marker EPENDING on their morphological features and their presumed origin, gliomas are divided into astrocytomas, oligodendrogliomas, and mixed gliomas or oligoastrocytomas. Oligodendrogliomas, divided into WHO Grades II and III, represent up to 25 to 33% of gliomas. 4,5 They are of major interest because their prognosis is better and their chemosensitivity is higher than in astrocytomas. 2 Studies of the molecular alterations involved in oligodendroglioma have often focused on particular alterations, mainly loss of chromosomes 1p/19q, 1,11,20,22 and other genetic changes, such as loss of chromosome 10q or inactivation of the tumor suppressor genes PTEN/MMAC (10q23) and DMBT1 (10q25-26), which are common in malignant astrocytomas and could play a role in their tumorigenesis, have not been analyzed. 7,8,12,18,19,25,26 A few recent publications 6,9,14,21 in which it has been suggested that these genetic changes could also occur in oligodendrogliomas prompted us to undertake a systematic analysis of chromosome 10 and of the PTEN/MMAC and DMBT1 genes in a series of oligodendrogliomas. Materials and Methods Histological Classification A set of 39 oligodendrogliomas (eight WHO Grade II and 31 Abbreviations used in this paper: GBM = glioblastoma multiforme; LOH = loss of heterozygosity; PCR = polymerase chain reaction; WHO = World Health Organization. WHO Grade III) that were resected at the Pitié-Salpêtrière Hospital in Paris were selected based on the availability of paired blood and frozen tissue for molecular analysis. These tumors were reviewed, classified morphologically, and scored according to the WHO guidelines (K.M.). 10 Microsatellite Analysis for LOH on Chromosome 10q Blood and tumor DNA, which were isolated according to standard procedures, were screened for LOH on chromosome 10q by using the following polymorphic markers: D10S537, D10S219, D10- S1744 (near PTEN), D10S541, D10S579, D10S1755, D10S1671, D10S597, D10S1693, D10S209, D10S587 (near DMBT1), D10- S1723, D10S212, D10S537, D10S541, D10S597, D10S1693, and D10S212 spanning the region located between 10q21.22 and 10qter. One of the primers was labeled with the Hex, Fam, or Ned fluorochromes (Perkin-Elmer, Norwalk, CT). The samples were run on an automatic sequencer and analyzed with the Gene Scan program (Abi-prism, Perkin-Elmer). Screening of the PTEN/MMAC1 Gene Mutations The PTEN/MMAC1 mutations were screened using the denaturing gradient gel electrophoresis method in the entire coding sequence of the nine exons and their corresponding splice junctions with previously described primers. 26 The DNA showing altered denaturing gradient gel electrophoresis profiles was sequenced bidirectionally by using the Perkin-Elmer kit and sequencer. When a DNA variant was found, the corresponding blood DNA was sequenced to differentiate somatic events from constitutional variants (polymorphism or germline mutation). Search for Homozygous Deletion of the DMBT1 Locus Tumor DNA was screened for DMBT1 homozygous deletions by using a competitive multiplex PCR procedure modified from Mol- 1397

2 M. Sanson, et al. FIG. 1. Diagrams showing deletion mapping of LOH on 10q in 39 oligodendrogliomas: eight WHO Grade II (OII) and 31 WHO Grade III (OIII). A white square indicates retention of heterozygosity; a black square indicates the LOH. Uninformative or untested cases are indicated by a vertical line. Partial deletions were found in one Grade II and nine Grade III oligodendrogliomas, as shown by this figure. lenhauer, et al. 18 Briefly, three different fragments (g14, 241 bp; 74k, 293 bp; 60k, 257 bp) located on intron 16, exon 1, and exon 31 of the DMBT1 locus, respectively, were coamplified with a c12 (190-bp) fragment located on 8q11. The primers were: 5 GGTTGACAC- AAAACCAACCC and 3 GGTGTGAGTGCTTGATTGCA for the g14 fragment; 5 AGATGCTTTCCCCCTTGG and 3 CTTTTG- CTAACAGTCGATGGC for the 74k fragment; 5 TAATGCCTG- GTCATCTGGTG and 3 GAAATTCCTATTGCCCCTCC for the 60k fragment; and 5 AGTTGGGGCCATGTGACTAG and 3 TTC- CCAGCTGAGCAACAAC for the c12 fragment. The conditions for the coamplification were: 94 C (3 minutes), followed by 34 cycles at 94 C (30 seconds), 60 C (30 seconds), 72 C (1 minute), and one step at 72 C for 10 minutes, for the g14 and 60k fragments; 74k amplification differed by the temperature used for annealing (58 C instead of 60 C). The PCR ethidium bromide fluorescence signal response was quantified by scanning. We considered that the DMBT1 locus was deleted when all three PCR fragments showed homozygous deletions. Statistical Analysis The prognostic value of the variables was classified according to progression-free survival and overall survival, which were calculated from surgery until relapse or death. Survival curves were derived from Kaplan Meier estimates. Two variables, LOH on chromosome 10 and DMBT1 homozygous deletions, were investigated. Two-sided probability values less than 0.05 were considered significant. Results The LOH data are reported in Fig. 1; LOH on 10q (for at least one marker) was found in 18 (58%) of 31 WHO Grade III oligodendrogliomas and in one (12%) of eight WHO Grade II tumors (p = 0.02 according to the chi-square test). As shown by the deletion mapping, chromosome 10q was completely lost in nine cases and partially lost in 10 cases, involving the candidate PTEN/MMAC and DMBT1 loci in most of the cases. Screening of the PTEN/MMAC with denaturing gradient gel electrophoresis resulted in two abnormal profiles. The first one, found in intron 5 (IVS5 40insT), was also present in the corresponding blood DNA and was therefore considered to be a polymorphism. The second (c.384g T) corresponded to a missense mutation (Lys128Asn) on exon 5. As shown in Fig. 2, DMBT1 homozygous deletions were found in 10 (26%) of 39 oligodendrogliomas (three of eight WHO Grade II, seven of 31 WHO Grade III). Clinical follow up was available for 38 of 39 patients. The median age at surgery was 42 years (range years), 39 years for the subgroup with no LOH on 10q, and 49 years for the subgroup with LOH on 10q; the median Karnofsky Performance Scale score was 90 (range ) for the whole group, and for both the subgroup without LOH on 10q and the one with LOH on 10q. Five patients with Grade II tumors were treated with surgery alone. In addition to surgery, seven patients (three with Grade II and four with Grade III lesions) were treated with radiation therapy, two patients with Grade III tumors received chemotherapy, and 24 patients with Grade III lesions were treated with radiation therapy and chemotherapy. The LOH on 10q was significantly associated with reduced progression-free intervals (p = ; log rank test) and with reduced overall survival (p = 0.035; Fig. 3). If only the WHO Grade III group was considered, LOH on 10q was still associated with a shorter progression-free survival 1398

3 Loss of chromosome 10q in oligodendrogliomas FIG. 2. Gene map in which the exon intron structure of the DMBT1 gene and the location of 74k, g14, and 60k are indicated. Homozygous deletion ( ) of DMBT1 is detected by multiplex PCR with c12. Absence of amplification of one of the DMBT1 fragments is indicated by a minus sign, whereas a plus sign indicates that the DMBT1 fragment is normally amplified by PCR. time (p 0.05; Fig. 4), but the relationship of tumor grade to overall survival did not reach a significant level (p = 0.17). In contrast, DMBT1 homozygous deletion was related neither to progression-free survival nor to overall survival. Discussion In this study we show that chromosome 10q deletions are common in anaplastic oligodendrogliomas (or WHO Grade III) and indicate a poor outcome. In addition, DMBT1 could represent a target gene in oligodendrogliomas, whereas the role of the PTEN/MMAC gene appears to be marginal. The fact that LOH on 10q was present in 58% of WHO Grade III oligodendrogliomas, a higher rate than previously reported, 13,21 and in only 12% of WHO Grade II oligodendrogliomas indicates that this alteration is related to anaplasia. This finding is consistent with the astrocytoma model in which LOH on 10q is closely related to the acquisition of a highly malignant phenotype, particularly the GBM subtype. For instance, in our series of GBMs, 25 (83%) of 30 tumors exhibited LOH on chromosome 10q (unpublished data). In this setting, it is not surprising that LOH on 10q was significantly associated with reduced progression-free and overall survival in the entire group of oligodendrogliomas (composed of WHO Grades II and III), as previously stated. 21 More important is the observation that, within the single histological subgroup of WHO Grade III oligodendrogliomas, LOH on chromosome 10q also indicated a shorter progression-free survival. Thus, if our data are confirmed, detection of LOH on chromosome 10q by genotyping could become a useful prognostic marker for oligodendrogliomas (especially Grade III lesions), indicating an unfavorable course and justifying a more vigorous initial therapeutic approach. This information could complete the search for 1p/ 19q deletions that are, in contrast, favorable predictors of survival. 3,22 Although the deleted regions encompassed the candidate PTEN/MMAC locus on 10q23 in 16 (84%) of 19 of our tumors with LOH on 10q, only one mutation of PTEN/ MMAC (6%) was detected. This result agrees with previous reports in which PTEN/MMAC mutations were detected in FIG. 3. Upper: Graph showing survival time in pure oligodendroglioma (WHO Grades II and III) according to the presence or absence of LOH on 10q (p 0.05). Lower: Graph showing time to disease progression in pure oligodendroglioma (Grades II and III) according to the presence or absence of LOH on 10q (p 0.001). 1399

4 M. Sanson, et al. Conclusions The results of this study indicate that the search for LOH on 10q could yield a valuable prognostic marker in anaplastic oligodendrogliomas, usefully completing 1p and 19q genotyping. Our data also indicate that DMBT1 is frequently inactivated in oligodendrogliomas, whereas PTEN mutation is rare. Nevertheless, the absence of a correlation with survival makes the role of DMBT1 in tumorigenesis still questionable. Taken together, our data indicate the involvement of at least one additional tumor suppressor gene on 10q and need further investigation. Acknowledgments We are indebted to the patients who agreed to participate in this study, and to Drs. X. P. Zhou and J. P. Lagarde for technical advice. FIG. 4. Graph showing time to disease progression in anaplastic oligodendroglioma according to the presence or absence of LOH on 10q (p 0.05). 3 to 10% of oligodendrogliomas. 6,9,21 Alteration of this tumor suppressor gene is therefore an unusual event in oligodendrogliomas and is unlikely to play a substantial role in this tumor type. More probably, the chromosome 10q contains another tumor suppressor gene involved in the tumorigenesis of oligodendrogliomas. Previous LOH studies performed on low- and high-grade gliomas, including oligodendrogliomas, have pointed to another region located on 10q25-26, 13,15 which contains the candidate gene DMBT1. Homozygous deletions of DMBT1 have been reported in diverse malignant brain tumors (medulloblastomas and GBMs), 18,23 as well as in other cancers (gastrointestinal and lung). The DMBT1 locus contains multiple specific repeats that may be susceptible to genomic instability, a feature that could explain the frequency of homozygous deletions. 17 In a recent study a low 3% rate of DMBT1 homozygous deletions was found in oligodendrogliomas 21 but our data indicate a much higher figure of 26%. On the other hand, in our experience, homozygous deletion was found in only 7% of GBMs (two of 30, unpublished observations). Interestingly, deletion of DMBT1 was independent of tumor grade and clinical course, suggesting that this alteration is an early event in oligodendroglioma progression. This finding is consistent with the results of Maier, et al., 15 who found 36% of hemizygous deletions at 10q25-qtel, a region that includes the DMBT1 locus, in low-grade astrocytomas and oligodendrogliomas. Thus, DMBT1 could be preferentially involved in oligodendrogliomas. The tumor suppressor function of this gene remains unsettled, 24 however, even if it has been suggested recently that DMBT1 could be involved in an antitumor immune response by stimulating macrophages in the local environment. 16 An alternative explanation is therefore that it is not DMBT1 but a neighboring gene that is involved in tumorigenesis in oligodendrogliomas. References 1. Bello MJ, Leone PE, Vaquero J, et al: Allelic loss at 1p and 19q frequently occurs in association and may represent early oncogenic events in oligodendroglial tumors. Int J Cancer 64: , Cairncross G, Macdonald D, Ludwin S, et al: Chemotherapy for anaplastic oligodendroglioma. National Cancer Institute of Canada Clinical Trials Group. J Clin Oncol 12: , Cairncross JG, Ueki K, Zlatescu MC, et al: Specific genetic predictors of chemotherapeutic response and survival in patients with anaplastic oligodendrogliomas. J Natl Cancer Inst 90: , Coons SW, Johnson PC, Scheithauer BW, et al: Improving diagnostic accuracy and interobserver concordance in the classification and grading of primary gliomas. Cancer 79: , Daumas-Duport C, Varlet P, Tucker ML, et al: Oligodendrogliomas: Part 1: Patterns of growth, histological diagnosis, clinical and imaging correlations: a study of 153 cases. J Neurooncol 34: 37 59, Duerr EM, Rollbrocker B, Hayashi Y, et al: PTEN mutations in gliomas and glioneural tumors. Oncogene 16: , Fujimoto M, Fults DW, Thomas GA, et al: Loss of heterozygosity on chromosome 10 in human glioblastoma multiforme. Genomics 4: , Fujisawa H, Kurrer M, Reis RM, et al: Acquisition of the glioblastoma phenotype during astrocytoma progression is associated with loss of heterozygosity on 10q25-qter. Am J Pathol 155: , Jeuken JW, Nelen MR, Vermeer H, et al: PTEN mutation analysis in two genetic subtypes of high-grade oligodendroglial tumors. PTEN is only occasionally mutated in one of the two genetic subtypes. Cancer Genet Cytogenet 119:42 47, Kleihues P, Cavenee WK: Pathology and Genetics of Tumours of the Nervous System. Lyon: IARC Press, Kraus JA, Koopmann J, Kaskel P, et al: Shared allelic losses on chromosomes 1p and 19q suggest a common origin of oligodendroglioma and oligoastrocytoma. J Neuropathol Exp Neurol 54: 91 95, Li J, Yen C, Liaw D, et al: PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast and prostate cancer. Science 275: , Lin H, Bondy ML, Langford LA, et al: Allelic deletion analyses of MMAC/PTEN and DMBT1 loci in gliomas: relationship to prognostic significance. Clin Cancer Res 4: , Maier D, Comparone D, Taylor E, et al: New deletion in lowgrade oligodendroglioma at the glioblastoma suppressor locus on chromosome 10q Oncogene 15: , Maier D, Zhang Z, Taylor E, et al: Somatic deletion mapping on chromosome 10 and sequence analysis of PTEN/MMAC1 point to the 10q25 26 region as the primary target in low-grade and high-grade gliomas. Oncogene 16: ,

5 Loss of chromosome 10q in oligodendrogliomas 16. Mollenhauer J, Herbertz S, Holmskov U, et al: DMBT1 encodes a protein involved in the immune defense and in epithelial differentiation and is highly unstable in cancer. Cancer Res 60: , Mollenhauer J, Holmskov U, Wiemann S, et al: The genomic structure of the DMBT1 gene: evidence for a region with susceptibility to genomic instability. Oncogene 18: , Mollenhauer J, Wiemann S, Scheurlen W, et al: DMBT1, a new member of the SRCR superfamily, on chromosome 10q is deleted in malignant brain tumors. Nat Genet 17:32 39, Rasheed BK, Stenzel TT, McLendon RE, et al: PTEN gene mutations are seen in high-grade but not in low-grade gliomas. Cancer Res 57: , Reifenberger J, Reifenberger G, Liu L, et al: Molecular genetic analysis of oligodendroglial tumors shows preferential allelic deletions on 19q and 1p. Am J Pathol 145: , Sasaki H, Zlatescu MC, Betensky RA, et al: PTEN is a target of chromosome 10q loss in anaplastic oligodendrogliomas and PTEN alterations are associated with poor prognosis. Am J Pathol 159: , Smith JS, Alderete B, Minn Y, et al: Localization of common deletion regions on 1p and 19q in human gliomas and their association with histological subtype. Oncogene 18: , Somerville RP, Shoshan Y, Eng C, et al: Molecular analysis of two putative tumor suppressor genes, PTEN and DMBT, which have been implicated in glioblastoma multiforme disease progression. Oncogene 17: , Steck PA, Lin H, Langford LA, et al: Functional and molecular analyses of 10q deletions in human gliomas. Genes Chromosomes Cancer 24: , Steck PA, Pershouse MA, Jasser SA, et al: Identification of a candidate tumor suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet 15: , Zhou XP, Li YJ, Hoang-Xuan K, et al: Mutational analysis of the PTEN gene in gliomas: molecular and pathological correlations. Int J Cancer 84: , 1999 Manuscript received March 25, Accepted in final form August 7, This work was supported by the Association pour la Recherche contre le Cancer (ARC 5892), the Ligue Nationale contre le Cancer (75/01-RS/42), and the Délégation à la Recherche clinique (CRIC 99042). Pascal Leuraud and Jié He received research grants from the Association pour la Recherche contre le Cancer and the Association pour la Recherche sur les Tumeurs cérébrales, respectively. Address reprint requests to: Marc Sanson, M.D., Clinique Neurologique, Hôpital de la Salpêtrière, 47 Boulevard de l Hôpital, Paris, France. m.sanson@psl.ap-hop-paris.fr. 1401