ABS04. ~ Inaugural Applied Bayesian Statistics School EXPRESSION
|
|
|
- Horatio Jacobs
- 5 years ago
- Views:
Transcription
1 ABS Applied Bayesian Statistics School STATISTICS & GENE EXPRESSION GENOMICS: METHODS AND COMPUTATIONS Mike West Duke University Centro Congressi Panorama, Trento,, Italy 15th-19th 19th June 2004 CNR-IAMI/University of Pavia ~ Inaugural Applied Bayesian Statistics School
2 ABS04
3 Some Bio basics -The Genome - Joseph Nevins Holly Dressman Mike West Duke University
4 Human Genome 23 autosomal pairs, 2 sex chromosomes Eukaryotic organisms US D.O.E. Genome Program info site
5 Nucleotide Bases: Adenine Thymine Guanine Cytosine + Essential Structure of DNA
6 US D.O.E. Genome Program info site
7 Proteins - Building blocks and tools structure and function of organisms, cell signalling, cell growth factors, enzymes, triggers: transcription factors, DNA repair, US D.O.E. Genome Program info site
8 Transcription & Translation
9 but, what IS a gene?
10 Estrogen Receptor Gene (ESR1 or ERα) gaattccaaa attgtgatgt ttcttgtatt tttgatgaag gagaaatact gtaatgatca ctgtttacac tatgtacact ttaggccagc cctttgtagc gttatacaaa ctgaaagcac accggacccg caggctcccg gggcagggcc ggggccagag ctcgcgtgtc ggcgggacat gcgctgcgtc gcctctaacc tcgggctgtg ctctttttcc aggtggcccg ccggtttctg agccttctgc cctgcgggga cacggtctgc accctgcccg cggccacgga ccatgaccat gaccctccac accaaagcat ctgggatggc cctactgcat cagatccaag ggaacgagct ggagcccctg aaccgtccgc agctcaagat ccccctggag cggcccctgg gcgaggtgta cctggacagc agcaagcccg ccgtgtacaa ctaccccgag ggcgccgcct acgagttcaa cgccgcggcc gccgccaacg cgcaggtcta cggtcagacc ggcctcccct acggccccgg gtctgaggct gcggcgttcg gctccaacgg cctggggggt ttccccccac tcaacagcgt gtctccgagc ccgctgatgc tactgcaccc gccgccgcag ctgtcgcctt tcctgcagcc ccacggccag caggtgccct actacctgga gaacgagccc agcggctaca cggtgcgcga ggccggcccg ccggcattct acaggccaaa ttcagataat cgacgccagg gtggcagaga aagattggcc agtaccaatg acaagggaag tatggctatg gaatctgcca aggagactcg ctactgtgca gtgtgcaatg actatgcttc aggctaccat tatggagtct ggtcctgtga gggctgcaag gccttcttca agagaagtat tcaaggacat aacgactata tgtgtccagc caccaaccag tgcaccattg ataaaaacag gaggaagagc tgccaggcct gccggctccg caaatgctac gaagtgggaa tgatgaaagg tgggatacga aaagaccgaa gaggagggag aatgttgaaa cacaagcgcc agagagatga tggggagggc aggggtgaag tggggtctgc tggagacatg agagctgcca acctttggcc aagcccgctc atgatcaaac gctctaagaa gaacagcctg gccttgtccc tgacggccga ccagatggtc agtgccttgt tggatgctga gccccccata ctctattccg agtatgatcc taccagaccc ttcagtgaag cttcgatgat gggcttactg accaacctgg cagacaggga gctggttcac atgatcaact gggcgaagag ggtgccaggc tttgtggatt tgaccctcca tgatcaggtc caccttctag aatgtgcctg gctagagatc ctgatgattg gtctcgtctg gcgctccatg gagcacccag tgaagctact gtttgctcct aacttgctct tggacaggaa ccagggaaaa tgtgtagagg gcatggtgga gatcttcgac atgctgctgg ctacatcatc tcggttccgc atgatgaatc tgcagggaga ggagtttgtg tgcctcaaat ctattatttt gcttaattct ggagtgtaca catttctgtc cagcaccctg aagtctctgg aagagaagga ccatatccac cgagtcctgg acaagatcac agacactttg atccacctga tggccaaggc aggcctgacc ctgcagcagc agcaccagcg gctggcccag ctcctcctca tcctctccca catcaggcac atgagtaaca aaggcatgga gcatctgtac agcatgaagt gcaagaacgt ggtgcccctc tatgacctgc tgctggagat gctggacgcc caccgcctac atgcgcccac tagccgtgga ggggcatccg tggaggagac ggaccaaagc cacttggcca ctgcgggctc tacttcatcg cattccttgc aaaagtatta catcacgggg gaggcagagg gtttccctgc cacagtctga gagctccctg gc
11 Promotor sequence Start region for transcription to create RNA Coding sequence Codes for proteins
12 RNA Transcription
13 The message: mrna Splice exons coding only - Alternative splicing Variants of same gene and/or gene function -Protein Gene variants DNA SNPs, variants
14 A Gene, Protein and some of its Function in Cell Biology and Cancer
15 (O)Estrogen Receptor Estrogen hormone - blood-borne chemical messenger produced in ovaries Estrogen Receptor (ER) protein in cells - docking station for estrogen switch on growth signal to nucleus for cell growth, division proliferation, National Cancer Institute info site
16 Estrogen Receptor: A Transcription Factor ER triggers gene activation e.g., - Genes that influence cholesterol - Growth signals to nucleus: cell division (mitosis) and proliferation mammary milk gland cells - menstrual cycle: ER responsive cell growth, death endometrial cells in uterus National Cancer Institute info site
17 ER and Cancer Cancer: growth of cells with DNA mutations ER - normal cell growth regulator Over-expression of ER potential oncogenic Some cancers: Estrogen dependent breast cancer: 60%-75% Breast cancer neoadjuvant drugs: block ER receptor (Tamoxifen) inhibit estrogen production - aromatase inhibitors (Letrozol) National Cancer Institute info site
18 Transcription Networks & Expression ER regulates multiple genes and hence their mrna and protein products ER is regulated by, and co-regulated with, multiple genes mrna expression levels Abundance of gene Related across genes in transcriptional interaction
19 Transcription Networks & Expression ER regulates multiple genes and hence their mrna and protein products ER is regulated by, and co-regulated with, multiple genes mrna expression levels Abundance of gene Related across genes in transcriptional interaction
20 Data and Information Resources on Genes Gene Ontologies - web servers in US,EU (GenBank, Unigene, Ensembl, AmiGO, ) Key start point: LocusLink > Entrez Gene US NLM/NCBI Entrez Gene Web Site Our system: integrates genomics databases, information servers, statistical & graphical tools Duke Integrated Genomics (DIG)
21
22
23
24 Molecular Information Genome Technologies Human condition disease studies Analysis of tissue, blood, etc Gene expression (microarrays) DNA copy number (CGH) DNA methylation Protein expression Metabolic expression Analysis of the host Genotypes DNA sequence Serum protein expression Serum metabolic expression Serum gene expression?
25 Gene Expression DNA microarrays
26 High-throughput gene expression level snapshot Transcript mrna message Spots : probes - millions of copies of DNA for a gene - nucleotide sequence -oligonucleotides Custom spotted array Affymetrix GeneChip
27 Hybridization technology free RNA targets from biological sample hybridize to DNA probes on array Measuring Expression Target : fluorescent labels Scan fluorescent intensity image Access Excellence info site
28 Array Fabrication Affymetrix GeneChip arrays mrna target Custom spotted arrays cdna target - reverse transcription from RNA (U T) - relative expression ( Target vs Reference )
29 Sources of Variation & Noise Biology Species Strains Genotypes Animals - Individuals Tissues Tissue heterogeneity Time points Process Quality of experimental sample RNA quality RNA extraction, amplification Labelling effects Hybridization process Probe design Cross-hybridization Background effects Scanning, filtering
30 Next up: Biological Phenotypes
Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
Introduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
Aspects of Statistical Modelling & Data Analysis in Gene Expression Genomics. Mike West Duke University
Aspects of Statistical Modelling & Data Analysis in Gene Expression Genomics Mike West Duke University Papers, software, many links: www.isds.duke.edu/~mw ABS04 web site: Lecture slides, stats notes, papers,
Genes and Genetic Diseases. Gene: Is a fundamental unit of information storage.
GENETIC DISORDERS Genes and Genetic Diseases Gene: Is a fundamental unit of information storage. Genes determine the type of proteins and enzymes that are made by the cell. Genes control inheritance and
Cours Bioinformatique : TP2
Cours Bioinformatique 2008-2009: TP2 Researchers have identified a gene that is involved in breast cancer. Your task in this exercise is to use bioinformatics tools and databases to find useful information
Sections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Now that the DNA has been copied, it needs to send its genetic message to the ribosomes so proteins can be made Transcription: synthesis (making of) an RNA molecule from a DNA
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
Bio 111 Study Guide Chapter 17 From Gene to Protein
Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains
Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains INTRODUCTION To study the relationship between an animal's
Hands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
Breast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
The Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
Bayesian Prediction Tree Models
Bayesian Prediction Tree Models Statistical Prediction Tree Modelling for Clinico-Genomics Clinical gene expression data - expression signatures, profiling Tree models for predictive sub-typing Combining
Structural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
DNA, Genes, and Chromosomes. The instructions for life!!!
DNA, Genes, and Chromosomes The instructions for life!!! Gene Segment of DNA that has the information (the code) for a protein or RNA. A single molecule of DNA has thousands of genes on the molecule. Remember
General Biology 1004 Chapter 11 Lecture Handout, Summer 2005 Dr. Frisby
Slide 1 CHAPTER 11 Gene Regulation PowerPoint Lecture Slides for Essential Biology, Second Edition & Essential Biology with Physiology Presentation prepared by Chris C. Romero Neil Campbell, Jane Reece,
DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK
CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence
Hypertrophy of cardiac muscle in the left ventricular chamber.
The increase in the size of cells and consequently in the size of the affected organ. caused by specific hormone stimulation or by increased functional demand. ü ü Pregnancy: an adaptive response muscular
genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
Genetics. Instructor: Dr. Jihad Abdallah Transcription of DNA
Genetics Instructor: Dr. Jihad Abdallah Transcription of DNA 1 3.4 A 2 Expression of Genetic information DNA Double stranded In the nucleus Transcription mrna Single stranded Translation In the cytoplasm
Profiles of gene expression & diagnosis/prognosis of cancer. MCs in Advanced Genetics Ainoa Planas Riverola
Profiles of gene expression & diagnosis/prognosis of cancer MCs in Advanced Genetics Ainoa Planas Riverola Gene expression profiles Gene expression profiling Used in molecular biology, it measures the
Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
A REVIEW OF BIOINFORMATICS APPLICATION IN BREAST CANCER RESEARCH
Journal of Advanced Bioinformatics Applications and Research. Vol 1, Issue 1, June 2010, pp 59-68 A REVIEW OF BIOINFORMATICS APPLICATION IN BREAST CANCER RESEARCH Vidya Vaidya, Shriram Dawkhar Department
Studying Alternative Splicing
Studying Alternative Splicing Meelis Kull PhD student in the University of Tartu supervisor: Jaak Vilo CS Theory Days Rõuge 27 Overview Alternative splicing Its biological function Studying splicing Technology
UNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA
UNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA SITI SHUHADA MOKHTAR Thesis submitted in fulfillment of the requirements for the degree of Master of Science
PROTEIN SYNTHESIS. It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.
PROTEIN SYNTHESIS It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.» GENES = a sequence of nucleotides in DNA that performs
Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
Data analysis and binary regression for predictive discrimination. using DNA microarray data. (Breast cancer) discrimination. Expression array data
West Mike of Statistics & Decision Sciences Institute Duke University wwwstatdukeedu IPAM Functional Genomics Workshop November Two group problems: Binary outcomes ffl eg, ER+ versus ER ffl eg, lymph node
LESSON 3.2 WORKBOOK. How do normal cells become cancer cells? Workbook Lesson 3.2
For a complete list of defined terms, see the Glossary. Transformation the process by which a cell acquires characteristics of a tumor cell. LESSON 3.2 WORKBOOK How do normal cells become cancer cells?
Genes, Aging and Skin. Helen Knaggs Vice President, Nu Skin Global R&D
Genes, Aging and Skin Helen Knaggs Vice President, Nu Skin Global R&D Presentation Overview Skin aging Genes and genomics How do genes influence skin appearance? Can the use of Genomic Technology enable
Gene Regulation Part 2
Michael Cummings Chapter 9 Gene Regulation Part 2 David Reisman University of South Carolina Other topics in Chp 9 Part 2 Protein folding diseases Most diseases are caused by mutations in the DNA that
Association mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative
Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47
Outline. Fitting Nutrition into Your Genes. Martha A. Belury, Ph.D., R.D. Martha A. Belury Sept 2018
Fitting Nutrition into Your Genes, Ph.D., R.D. Human Nutrition The Ohio State University Outline I. History (abridged) of the Study of Genetics and Nutrition II. The Skinny on Fats & Genes III. How Dietary
Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
Genetics and Reproductive Options for SMA Families Annual SMA Conference Dallas, Texas Friday, June 15, 2017
Genetics and Reproductive Options for SMA Families 2018 Annual SMA Conference Dallas, Texas Friday, June 15, 2017 Part 1: SMA and Genetics Louise R Simard, PhD Part 2: SMA Carrier Screening Melissa Gibbons,
Breast Cancer and Biotechnology Jacquie Bay, Jo Perry, Michal Denny and Peter Lobie
LENScience Senior Biology Seminar Series Breast Cancer and Biotechnology Jacquie Bay, Jo Perry, Michal Denny and Peter Lobie Breast Cancer Each year in New Zealand, approximately 2,400 women and 20 men
Cancer. October is National Breast Cancer Awareness Month
Cancer October is National Breast Cancer Awareness Month Objectives 1: Gene regulation Explain how cells in all the different parts of your body develop such different characteristics and functions. Contrast
Chapter 11 How Genes Are Controlled
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Biology: Concepts & Connections, Sixth Edition Campbell, Reece, Taylor, Simon, and Dickey Copyright 2009 Pearson Education, Inc. Lecture by Mary
Human beings contain tens of thousands of genes, the basic material for cell
II. A Brief Overview of Genetics and Genetic Research Human beings contain tens of thousands of genes, the basic material for cell function including the transmission of hereditary characteristics. Genes
HEREDITY SAMPLE TOURNAMENT
HEREDITY SAMPLE TOURNAMENT PART 1 - BACKGROUND: 1. Heterozygous means. A. Information about heritable traits B. Unique/ different molecular forms of a gene that are possible at a given locus C. Having
MODULE 3: TRANSCRIPTION PART II
MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain
Chapter 1 Heredity. Prepared by: GOAD s Team
Chapter 1 Heredity Prepared by: GOAD s Team IMPORTANT VOCABULARY WORDS Traits Character Genes Allele Genotype homozygote heterozygote Dominant recessive phenotype WHAT IS HEREDITY? HEREDITY - is a passing
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression. Chromatin Array of nuc
Transcriptional control in Eukaryotes: (chapter 13 pp276) Chromatin structure affects gene expression Chromatin Array of nuc 1 Transcriptional control in Eukaryotes: Chromatin undergoes structural changes
RNA (Ribonucleic acid)
RNA (Ribonucleic acid) Structure: Similar to that of DNA except: 1- it is single stranded polunucleotide chain. 2- Sugar is ribose 3- Uracil is instead of thymine There are 3 types of RNA: 1- Ribosomal
Prokaryotes and eukaryotes alter gene expression in response to their changing environment
Chapter 18 Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development and is responsible for differences
Multimedia Appendix 6 Educational Materials Table of Contents. Intervention Educational Materials Audio Script (version 1)
Multimedia Appendix 6 Educational Materials Table of Contents Intervention Educational Materials... 1 Audio Script (version 1)... 1 Text (version 1)... 5 Slides (version 1)... 17 Audio Script (version
Course Title Form Hours subject
Course Title Form Hours subject Types, and structure of chromosomes L 1 Histology Karyotyping and staining of human chromosomes L 2 Histology Chromosomal anomalies L 2 Histology Sex chromosomes L 1 Histology
Chapter 11. How Genes Are Controlled. Lectures by Edward J. Zalisko
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Campbell Essential Biology, Fifth Edition, and Campbell Essential Biology with Physiology, Fourth Edition Eric J. Simon, Jean L. Dickey, and
Genomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
TRANSCRIPTION. DNA à mrna
TRANSCRIPTION DNA à mrna Central Dogma Animation DNA: The Secret of Life (from PBS) http://www.youtube.com/watch? v=41_ne5ms2ls&list=pl2b2bd56e908da696&index=3 Transcription http://highered.mcgraw-hill.com/sites/0072507470/student_view0/
Section Chapter 14. Go to Section:
Section 12-3 Chapter 14 Go to Section: Content Objectives Write these Down! I will be able to identify: The origin of genetic differences among organisms. The possible kinds of different mutations. The
Development and Application of an Enteric Pathogens Microarray
Development and Application of an Enteric Pathogens Microarray UC Berkeley School of Public Health Sona R. Saha, MPH Joseph Eisenberg, PhD Lee Riley, MD Alan Hubbard, PhD Jack Colford, MD PhD East Bay
Page 2. When sirna binds to mrna, name the complementary base pairs holding the sirna and mrna together. One of the bases is named for you. ...with...
Q1.Human immunodeficiency virus (HIV) particles have a specific protein on their surface.this protein binds to a receptor on the plasma membrane of a human cell and allows HIV to enter. This HIV protein
Ch. 18 Regulation of Gene Expression
Ch. 18 Regulation of Gene Expression 1 Human genome has around 23,688 genes (Scientific American 2/2006) Essential Questions: How is transcription regulated? How are genes expressed? 2 Bacteria regulate
Regulation of Gene Expression in Eukaryotes
Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression
Genetic Testing Methods
THE JACKSON LABORATORY Genetic Testing Methods CLINICAL AND CONTINUING EDUCATION About this resource THE GOAL The goal of this resource is to improve the primary care provider s knowledge about commonly
MODULE 4: SPLICING. Removal of introns from messenger RNA by splicing
Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by
Chapter 9. Cells Grow and Reproduce
Chapter 9 Cells Grow and Reproduce DNA Replication DNA polymerase Addition of a nucleotide to the 3 end of a growing strand Use dntps as substrate Release of pyrophosphate Initiation of Replication Replication
Eukaryotic Gene Regulation
Eukaryotic Gene Regulation Chapter 19: Control of Eukaryotic Genome The BIG Questions How are genes turned on & off in eukaryotes? How do cells with the same genes differentiate to perform completely different,
Section D: The Molecular Biology of Cancer
CHAPTER 19 THE ORGANIZATION AND CONTROL OF EUKARYOTIC GENOMES Section D: The Molecular Biology of Cancer 1. Cancer results from genetic changes that affect the cell cycle 2. Oncogene proteins and faulty
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
CHROMOSOMAL MICROARRAY (CGH+SNP)
Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due
Genomic tests to personalize therapy of metastatic breast cancers. Fabrice ANDRE Gustave Roussy Villejuif, France
Genomic tests to personalize therapy of metastatic breast cancers Fabrice ANDRE Gustave Roussy Villejuif, France Future application of genomics: Understand the biology at the individual scale Patients
Breast Cancer Statistics
1 in 8 Breast Cancer Statistics Incidence Mortality Prevalence 2 Breast Cancer Incidence Breast Cancer Mortality Breast Cancer Prevalence ~$100,000 Female Breast Anatomy Breasts consist mainly of fatty
Annotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009
Annotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009 1 Abstract A stretch of chimpanzee DNA was annotated using tools including BLAST, BLAT, and Genscan. Analysis of Genscan predicted genes revealed
SALSA MLPA KIT P060-B2 SMA
SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the
Gene expression in cancer diagnostics
Gene expression in cancer diagnostics Aron Eklund eklund@cbs.dtu.dk Cancer Systems Biology group Center for Biological Sequence Analysis Technical University of Denmark Introduction to Systems Biology
Genetic Counselling in relation to genetic testing
Genetic Counselling in relation to genetic testing Dr Julie Vogt Consultant Geneticist West Midlands Regional Genetics Service September 2016 Disclosures for Research Support/P.I. Employee Consultant Major
LESSON 4.4 WORKBOOK. How viruses make us sick: Viral Replication
DEFINITIONS OF TERMS Eukaryotic: Non-bacterial cell type (bacteria are prokaryotes).. LESSON 4.4 WORKBOOK How viruses make us sick: Viral Replication This lesson extends the principles we learned in Unit
SUPPLEMENTARY FIGURES: Supplementary Figure 1
SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic
Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
Genetics of Oncology. Ryan Allen Roy MD July 8, 2004 University of Tennessee
Genetics of Oncology Ryan Allen Roy MD July 8, 2004 University of Tennessee CREOG Objectives Describe the clinical relevance of viral oncogenes Describe the role of aneuploidy in the pathogenesis of neoplasia
Biology. Lectures winter term st year of Pharmacy study
Biology Lectures winter term 2008 1 st year of Pharmacy study 3 rd Lecture Chemical composition of living matter chemical basis of life. Atoms, molecules, organic compounds carbohydrates, lipids, proteins,
Integrated Analysis of Copy Number and Gene Expression
Integrated Analysis of Copy Number and Gene Expression Nexus Copy Number provides user-friendly interface and functionalities to integrate copy number analysis with gene expression results for the purpose
Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
Diploma in Equine Science
The process of meiosis is summarised in the diagram below, but it involves the reduction of the genetic material to half. A cell containing the full number of chromosomes (two pairs) is termed diploid,
Using Network Flow to Bridge the Gap between Genotype and Phenotype. Teresa Przytycka NIH / NLM / NCBI
Using Network Flow to Bridge the Gap between Genotype and Phenotype Teresa Przytycka NIH / NLM / NCBI Journal Wisla (1902) Picture from a local fare in Lublin, Poland Genotypes Phenotypes Journal Wisla
University of Pittsburgh Annual Progress Report: 2008 Formula Grant
University of Pittsburgh Annual Progress Report: 2008 Formula Grant Reporting Period July 1, 2011 June 30, 2012 Research Project 1: Project Title and Purpose Small Molecule Inhibitors of HIV Nef Signaling
2.1 The Importance of Cell Division
2.1 The Importance of Cell Division Functions of cell division Growth Repair Reproduction Growth All organisms begin as a single cell. Cell divisions will increase as an organism s size increases. There
Cytogenetics Technologies, Companies & Markets
Cytogenetics Technologies, Companies & Markets By Prof. K. K. Jain MD, FRACS, FFPM Jain PharmaBiotech Basel, Switzerland November 2018 A Jain PharmaBiotech Report A U T H O R ' S B I O G R A P H Y Professor
Global variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
Molecular understanding of tamoxifen resistance in breast cancer. Renée de Leeuw
Molecular understanding of tamoxifen resistance in breast cancer Renée de Leeuw Omslag ontworpen door: Theophile Suijkerbuijk (www.theophile.nl) Molecular understanding of tamoxifen resistance in breast
MRC-Holland MLPA. Description version 19;
SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL
Genetic Variation Junior Science
2018 Version Genetic Variation Junior Science http://img.publishthis.com/images/bookmarkimages/2015/05/d/5/c/d5cf017fb4f7e46e1c21b874472ea7d1_bookmarkimage_620x480_xlarge_original_1.jpg Sexual Reproduction
DNA codes for RNA, which guides protein synthesis.
Section 3: DNA codes for RNA, which guides protein synthesis. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review synthesis New RNA messenger RNA ribosomal RNA transfer RNA transcription
Clinical Oncology - Science in focus - Editorial. Understanding oestrogen receptor function in breast cancer, and its interaction with the
Clinical Oncology - Science in focus - Editorial TITLE: Understanding oestrogen receptor function in breast cancer, and its interaction with the progesterone receptor. New preclinical findings and their
Cancer and Gene Regulation
OpenStax-CNX module: m44548 1 Cancer and Gene Regulation OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
Introduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
Org Biochem Final Test Student Section Ch Samples Page 1 of 5
Ch 31-35 Samples Page 1 of 5 13. Which of the following is a purine? a) guanine b) cytosine c) thymine d) uracil 20. The three components of a nucleotide are a) glucose, a phosphate group, and choline.
Understanding DNA Copy Number Data
Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php
What s the Human Genome Project Got to Do with Developmental Disabilities?
What s the Human Genome Project Got to Do with Developmental Disabilities? Disclosures Neither speaker has anything to disclose. Phase Two: Interpretation Officially started in October 1990 Goals of the
Gene Expression. From a gene to a protein
Gene Expression From a gene to a protein Central Dogma (Crick 1958) Determines the genetic flow of information Central Dogma First step in decoding a genetic message from DNA is to copy (transcribe) it
RECENT ADVANCES IN THE MOLECULAR DIAGNOSIS OF BREAST CANCER
Technology Transfer in Diagnostic Pathology. 6th Central European Regional Meeting. Cytopathology. Balatonfüred, Hungary, April 7-9, 2011. RECENT ADVANCES IN THE MOLECULAR DIAGNOSIS OF BREAST CANCER Philippe
Gene Regulation - 4. One view of the Lactose Operon
Gene Regulation - 1 Regulating Genes We have been discussing the structure of DNA and that the information stored in DNA is used to direct protein synthesis. We've studied how RNA molecules are used to
You may use your notes to answer the following questions:
Build-A-Cell Name: Group members: Date: Instructions: Please use the the Lego blocks responsibly and not a device to pinch other students. Answer the pre-lab questions before you start, follow all directions,
MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
SALSA MLPA probemix P241-D2 MODY mix 1 Lot D As compared to version D1 (lot D1-0911), one reference probe has been replaced.
mix P241-D2 MODY mix 1 Lot D2-0413. As compared to version D1 (lot D1-0911), one reference has been replaced. Maturity-Onset Diabetes of the Young (MODY) is a distinct form of non insulin-dependent diabetes
Clonal evolution of human cancers
Clonal evolution of human cancers -Pathology-based microdissection and genetic analysis precisely demonstrates molecular evolution of neoplastic clones- Hiroaki Fujii, MD Ageo Medical Laboratories, Yashio