Association mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative
|
|
- Marybeth Sherman
- 5 years ago
- Views:
Transcription
1 Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s (usually) 1
2 (usually) Strong, easy to detect Extreme of linkage study is one large family; less likely that phenotype has multiple genetic causes (locus heterogeneity). but rare in population but rare in population (e.g. BRCA1) but rare in population; may not be reflective of common disease. but rare in population; may not be reflective of common disease. Also, hard to collect family data. 2
3 Common but weak effects but rare in population; may not be reflective of common disease. Also, hard to collect family data. Common but weak effects; need 1000 s of samples to detect but rare in population; may not be reflective of common disease. Also, hard to collect family data. Another key feature of association mapping: resolution Common but weak effects; need 1000 s of samples to detect. If no common cause, can fail. but rare in population; may not be reflective of common disease. Also, hard to collect family data. many recombinations have happened since common ancestor; shared region is small; no coinheritance distant markers many recombinations have happened since common ancestor; shared region is small; no coinheritance distant markers small number of generations; share big chunks of genome; can get coinheritance distant markers 3
4 small number of generations; share big chunks of genome; can get coinheritance distant markers many recombinations have happened since common ancestor; shared region is small; no coinheritance distant markers So you need very high density of markers to get signal in an association study, but you get very high spatial resolution. small number of generations; share big chunks of genome; can get coinheritance distant markers many recombinations have happened since common ancestor; shared region is small; no coinheritance distant markers In the old days of sparse markers, linkage analysis was the best strategy. -log(χ 2 p-value) Causative variant very close But there is a pitfall of association tests: population structure rs Diabetes in Native Americans Diabetes in Native Americans (1971) 4
5 Diabetes in Native Americans Association mapping causal loci Family studies indicate it is at least partly genetic, not environmental. Typed IgG heavy chains with protein assay. Phenotypes can serve as markers too (1971) Association mapping causal loci Association mapping causal loci Typed IgG heavy chains with protein assay. Phenotypes can serve as markers too (Multiple proteins from chr 14 region: haplotype) Association mapping causal loci Association mapping causal loci diabetes control diabetes control Gm no Gm Gm no Gm
6 Association mapping causal loci Association mapping causal loci Gm is protective against diabetes? Gm no Gm diabetes control Self-identified heritage Self-identified heritage Most full heritage members don t have the haplotype Self-identified heritage Most full heritage members don t have the haplotype Gm haplotype is very rare in self-identified 100% Pima members. The few without N.A. heritage are much more likely to have the haplotype 6
7 Gm haplotype is very rare in self-identified 100% Pima members. Gm is a marker for Caucasian ancestry. almost negligible huge Gm doesn t look like it has much additional protective effect if you stratify by familial origin first! these are all the Caucasians 7
8 Caucasian ancestry is associated with Gm haplotype. Caucasian ancestry is associated with Gm haplotype. Caucasian ancestry is associated with lower diabetes risk. Caucasian ancestry is associated with Gm haplotype. Caucasian ancestry is associated with lower diabetes risk. But Gm is not associated with lower diabetes risk! Cases Controls Controls are enriched for Caucasians Cases Controls = = Cases Controls = = N.A. and Caucasians are different at many loci At any one of these loci, Caucasian-like allele will be enriched in control samples. 8
9 Cases = Microarrays and genotyping Controls = Don t believe any one locus is causative! DNA microarrays DNA microarrays Post-genome era: the sequence and location of the oligos are known Fig Fig DNA microarrays Fig Fig
10 oligo (human genome fragment) index oligo (human genome fragment) index oligo (human genome fragment) index oligo (human genome fragment) index oligo (human genome fragment) index middle nucleotide on chip oligo 10
11 Sample DNA is labeled, allowed to hybridize middle nucleotide on chip oligo middle nucleotide on chip oligo readout of sample middle nucleotide on chip oligo Fabrication technology allows millions of oligos (each present in millions of copies) on a single slide readout of sample Genotyping by single-base extension Genotyping by single-base extension Fig
12 High density of markers necessary for association 12
5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?
corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or
More informationSupplementary note: Comparison of deletion variants identified in this study and four earlier studies
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationExample HLA-B and abacavir. Roujeau 2014
Example HLA-B and abacavir Roujeau 2014 FDA requires testing for abacavir Treatment with abacavir is generally well tolerated, but 5% of the patients experience hypersensitivity reactions that can be life
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationIntroduction to the Genetics of Complex Disease
Introduction to the Genetics of Complex Disease Jeremiah M. Scharf, MD, PhD Departments of Neurology, Psychiatry and Center for Human Genetic Research Massachusetts General Hospital Breakthroughs in Genome
More informationIntroduction to linkage and family based designs to study the genetic epidemiology of complex traits. Harold Snieder
Introduction to linkage and family based designs to study the genetic epidemiology of complex traits Harold Snieder Overview of presentation Designs: population vs. family based Mendelian vs. complex diseases/traits
More informationIntroduction to Genetics and Genomics
2016 Introduction to enetics and enomics 3. ssociation Studies ggibson.gt@gmail.com http://www.cig.gatech.edu Outline eneral overview of association studies Sample results hree steps to WS: primary scan,
More informationBST227 Introduction to Statistical Genetics. Lecture 4: Introduction to linkage and association analysis
BST227 Introduction to Statistical Genetics Lecture 4: Introduction to linkage and association analysis 1 Housekeeping Homework #1 due today Homework #2 posted (due Monday) Lab at 5:30PM today (FXB G13)
More informationUNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA
UNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA SITI SHUHADA MOKHTAR Thesis submitted in fulfillment of the requirements for the degree of Master of Science
More informationDan Koller, Ph.D. Medical and Molecular Genetics
Design of Genetic Studies Dan Koller, Ph.D. Research Assistant Professor Medical and Molecular Genetics Genetics and Medicine Over the past decade, advances from genetics have permeated medicine Identification
More informationGenetics and Genomics in Medicine Chapter 8 Questions
Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional
More informationCS2220 Introduction to Computational Biology
CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS
More informationFor more information about how to cite these materials visit
Author(s): Kerby Shedden, Ph.D., 2010 License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution Share Alike 3.0 License: http://creativecommons.org/licenses/by-sa/3.0/
More informationWhole-genome detection of disease-associated deletions or excess homozygosity in a case control study of rheumatoid arthritis
HMG Advance Access published December 21, 2012 Human Molecular Genetics, 2012 1 13 doi:10.1093/hmg/dds512 Whole-genome detection of disease-associated deletions or excess homozygosity in a case control
More informationLarge-scale identity-by-descent mapping discovers rare haplotypes of large effect. Suyash Shringarpure 23andMe, Inc. ASHG 2017
Large-scale identity-by-descent mapping discovers rare haplotypes of large effect Suyash Shringarpure 23andMe, Inc. ASHG 2017 1 Why care about rare variants of large effect? Months from randomization 2
More informationThe Foundations of Personalized Medicine
The Foundations of Personalized Medicine Jeremy M. Berg Pittsburgh Foundation Professor and Director, Institute for Personalized Medicine University of Pittsburgh Personalized Medicine Physicians have
More informationGenerating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
More informationGENOME-WIDE ASSOCIATION STUDIES
GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationMendel s Methods: Monohybrid Cross
Mendel s Methods: Monohybrid Cross Mendel investigated whether the white-flowered form disappeared entirely by breeding the F1 purple flowers with each other. Crossing two purple F1 monohybrid plants is
More informationAn Introduction to Quantitative Genetics I. Heather A Lawson Advanced Genetics Spring2018
An Introduction to Quantitative Genetics I Heather A Lawson Advanced Genetics Spring2018 Outline What is Quantitative Genetics? Genotypic Values and Genetic Effects Heritability Linkage Disequilibrium
More informationSupplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;
More informationChallenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
More informationBreast cancer. Risk factors you cannot change include: Treatment Plan Selection. Inferring Transcriptional Module from Breast Cancer Profile Data
Breast cancer Inferring Transcriptional Module from Breast Cancer Profile Data Breast Cancer and Targeted Therapy Microarray Profile Data Inferring Transcriptional Module Methods CSC 177 Data Warehousing
More informationImaging Genetics: Heritability, Linkage & Association
Imaging Genetics: Heritability, Linkage & Association David C. Glahn, PhD Olin Neuropsychiatry Research Center & Department of Psychiatry, Yale University July 17, 2011 Memory Activation & APOE ε4 Risk
More informationMendel Short IGES 2003 Data Preparation. Eric Sobel. Department of of Human Genetics UCLA School of of Medicine
Mendel Short Course @ IGES 2003 Data Preparation Eric Sobel Department of of Human Genetics UCLA School of of Medicine 02 November 2003 Mendel Short Course @ IGES Slide 1 Web Sites Mendel5: www.genetics.ucla.edu/software
More informationNonparametric Linkage Analysis. Nonparametric Linkage Analysis
Limitations of Parametric Linkage Analysis We previously discued parametric linkage analysis Genetic model for the disease must be specified: allele frequency parameters and penetrance parameters Lod scores
More informationWhen bad things happen to good genes: mutation vs. selection
When bad things happen to good genes: mutation vs. selection Selection tends to increase the frequencies of alleles with higher marginal fitnesses. Does this mean that genes are perfect? No, mutation can
More informationTalking Genomes with Your Patients. Meagan Cochran, MS, CGC Certified Genetic Counselor HudsonAlpha Institute for Biotechnology
Talking Genomes with Your Patients Meagan Cochran, MS, CGC Certified Genetic Counselor HudsonAlpha Institute for Biotechnology Objectives Review the importance of physician familiarity with genomic testing
More informationPractical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs
Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs Joris Vermeesch, Center for Human Genetics K.U.Leuven, Belgium ESHG June 11, 2010 When and
More informationindicated in shaded lowercase letters (hg19, Chr2: 217,955, ,957,266).
Legend for Supplementary Figures Figure S1: Sequence of 2q35 encnv. The DNA sequence of the 1,375bp 2q35 encnv is indicated in shaded lowercase letters (hg19, Chr2: 217,955,892-217,957,266). Figure S2:
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationDrug Metabolism Disposition
Drug Metabolism Disposition The CYP2C19 intron 2 branch point SNP is the ancestral polymorphism contributing to the poor metabolizer phenotype in livers with CYP2C19*35 and CYP2C19*2 alleles Amarjit S.
More informationA gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single
8.3 A gene is a sequence of DNA that resides at a particular site on a chromosome the locus (plural loci). Genetic linkage of genes on a single chromosome can alter their pattern of inheritance from those
More informationInteraction of Genes and the Environment
Some Traits Are Controlled by Two or More Genes! Phenotypes can be discontinuous or continuous Interaction of Genes and the Environment Chapter 5! Discontinuous variation Phenotypes that fall into two
More informationIntroduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015
Introduction to Cancer Bioinformatics and cancer biology Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Why cancer bioinformatics? Devastating disease, no cure on the horizon Major
More informationBIOLOGY - CLUTCH CH.15 - CHROMOSOMAL THEORY OF INHERITANCE
!! www.clutchprep.com Chromosomal theory of inheritance: chromosomes are the carriers of genetic material. Independent Assortment alleles for different characters sort independently of each other during
More informationHuman Genetics 542 Winter 2018 Syllabus
Human Genetics 542 Winter 2018 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Jan 3 rd Wed Mapping disease genes I: inheritance patterns and linkage analysis
More informationSupplementary Methods
Supplementary Methods Populations ascertainment and characterization Our genotyping strategy included 3 stages of SNP selection, with individuals from 3 populations (Europeans, Indian Asians and Mexicans).
More informationDNA Analysis Techniques for Molecular Genealogy. Luke Hutchison Project Supervisor: Scott R. Woodward
DNA Analysis Techniques for Molecular Genealogy Luke Hutchison (lukeh@email.byu.edu) Project Supervisor: Scott R. Woodward Mission: The BYU Center for Molecular Genealogy To establish the world s most
More informationLecture 20. Disease Genetics
Lecture 20. Disease Genetics Michael Schatz April 12 2018 JHU 600.749: Applied Comparative Genomics Part 1: Pre-genome Era Sickle Cell Anaemia Sickle-cell anaemia (SCA) is an abnormality in the oxygen-carrying
More informationHuman Genetics of Tuberculosis. Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980
Human Genetics of Tuberculosis Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980 Human genetics in tuberculosis? Concept Epidemiological/familial
More informationDuring the hyperinsulinemic-euglycemic clamp [1], a priming dose of human insulin (Novolin,
ESM Methods Hyperinsulinemic-euglycemic clamp procedure During the hyperinsulinemic-euglycemic clamp [1], a priming dose of human insulin (Novolin, Clayton, NC) was followed by a constant rate (60 mu m
More informationHuman Genetics 542 Winter 2017 Syllabus
Human Genetics 542 Winter 2017 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Module I: Mapping and characterizing simple genetic diseases Jan 4 th Wed Mapping
More informationDOES THE BRCAX GENE EXIST? FUTURE OUTLOOK
CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence
More informationIpek Ilgın Gönenç. December, Universitat Autònoma de Barcelona
Ipek Ilgın Gönenç December, 2016 Universitat Autònoma de Barcelona IntroducCon, some definicons GeneCc VariaCons, phenotypic and genotypic differences among individuals or in a populacon. Polymorphisms,
More informationUNIT 3 GENETICS LESSON #30: TRAITS, GENES, & ALLELES. Many things come in many forms. Give me an example of something that comes in many forms.
UNIT 3 GENETICS LESSON #30: TRAITS, GENES, & ALLELES Many things come in many forms. Give me an example of something that comes in many forms. Genes, too, come in many forms. Main Idea #1 The same gene
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationRoadmap. Inbreeding How inbred is a population? What are the consequences of inbreeding?
1 Roadmap Quantitative traits What kinds of variation can selection work on? How much will a population respond to selection? Heritability How can response be restored? Inbreeding How inbred is a population?
More informationRare Variant Burden Tests. Biostatistics 666
Rare Variant Burden Tests Biostatistics 666 Last Lecture Analysis of Short Read Sequence Data Low pass sequencing approaches Modeling haplotype sharing between individuals allows accurate variant calls
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationCHROMOSOMAL MICROARRAY (CGH+SNP)
Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due
More informationGenetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains
Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains INTRODUCTION To study the relationship between an animal's
More informationGenetics of COPD Prof. Ian P Hall
Genetics of COPD 1 Prof. Ian P. Hall Dean, Faculty of Medicine and Health Sciences The University of Nottingham Medical School Ian.Hall@nottingham.ac.uk Chronic obstructive pulmonary disease (COPD) 900,000
More informationA rare variant in MYH6 confers high risk of sick sinus syndrome. Hilma Hólm ESC Congress 2011 Paris, France
A rare variant in MYH6 confers high risk of sick sinus syndrome Hilma Hólm ESC Congress 2011 Paris, France Disclosures I am an employee of decode genetics, Reykjavik, Iceland. Sick sinus syndrome SSS is
More informationCURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi
2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000
More informationQuantitative genetics: traits controlled by alleles at many loci
Quantitative genetics: traits controlled by alleles at many loci Human phenotypic adaptations and diseases commonly involve the effects of many genes, each will small effect Quantitative genetics allows
More informationFor a long time, people have observed that offspring look like their parents.
Chapter 10 For a long time, people have observed that offspring look like their parents. Even before we knew about genes, people were breeding livestock to get certain traits in the offspring. They knew
More informationNational Disease Research Interchange Annual Progress Report: 2010 Formula Grant
National Disease Research Interchange Annual Progress Report: 2010 Formula Grant Reporting Period July 1, 2012 June 30, 2013 Formula Grant Overview The National Disease Research Interchange received $62,393
More informationIntroduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
More informationFONS Nové sekvenační technologie vklinickédiagnostice?
FONS 2010 Nové sekvenační technologie vklinickédiagnostice? Sekvenování amplikonů Sequence capture Celogenomové sekvenování FONS 2010 Sekvenování amplikonů Amplicon sequencing - amplicon sequencing enables
More informationSEX. Genetic Variation: The genetic substrate for natural selection. Sex: Sources of Genotypic Variation. Genetic Variation
Genetic Variation: The genetic substrate for natural selection Sex: Sources of Genotypic Variation Dr. Carol E. Lee, University of Wisconsin Genetic Variation If there is no genetic variation, neither
More informationNational Disease Research Interchange Annual Progress Report: 2010 Formula Grant
National Disease Research Interchange Annual Progress Report: 2010 Formula Grant Reporting Period July 1, 2011 June 30, 2012 Formula Grant Overview The National Disease Research Interchange received $62,393
More informationDeliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing
GA N 668353 H2020 Research and Innovation Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing WP N and Title: WP2 - Towards shared European Guidelines for PGx Lead beneficiary:
More informationOne slide on research question Literature review: structured; holes you will fill in Your research design
Topics Ahead Week 10-11: Experimental design; Running experiment Week 12: Survey Design; ANOVA Week 13: Correlation and Regression; Non Parametric Statistics Week 14: Computational Methods; Simulation;
More informationNature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.
Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype
More information# For the GWAS stage, B-cell NHL cases which small numbers (N<20) were excluded from analysis.
Supplementary Table 1a. Subtype Breakdown of all analyzed samples Stage GWAS Singapore Validation 1 Guangzhou Validation 2 Guangzhou Validation 3 Beijing Total No. of B-Cell Cases 253 # 168^ 294^ 713^
More informationTitle: Pinpointing resilience in Bipolar Disorder
Title: Pinpointing resilience in Bipolar Disorder 1. AIM OF THE RESEARCH AND BRIEF BACKGROUND Bipolar disorder (BD) is a mood disorder characterised by episodes of depression and mania. It ranks as one
More informationStatistical Tests for X Chromosome Association Study. with Simulations. Jian Wang July 10, 2012
Statistical Tests for X Chromosome Association Study with Simulations Jian Wang July 10, 2012 Statistical Tests Zheng G, et al. 2007. Testing association for markers on the X chromosome. Genetic Epidemiology
More informationRNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
More informationSAMPLE REPORT MENTAL HEALTH DNA INSIGHT
PERSONAL DETAILS DOB Jan 1, 19XX ETHNICITY Caucasian ORDERING HEALTHCARE PROFESSIONAL Glenn Braunstein.D. 6777 Nancy Ridge Drive San Diego, CA 92121 US LABORATORY INFO ACCESSION NUBER ACTIVATION CODE SPECIEN
More informationSupplementary Figure 1. Quantile-quantile (Q-Q) plot of the log 10 p-value association results from logistic regression models for prostate cancer
Supplementary Figure 1. Quantile-quantile (Q-Q) plot of the log 10 p-value association results from logistic regression models for prostate cancer risk in stage 1 (red) and after removing any SNPs within
More informationMULTIFACTORIAL DISEASES. MG L-10 July 7 th 2014
MULTIFACTORIAL DISEASES MG L-10 July 7 th 2014 Genetic Diseases Unifactorial Chromosomal Multifactorial AD Numerical AR Structural X-linked Microdeletions Mitochondrial Spectrum of Alterations in DNA Sequence
More informationAspects of Statistical Modelling & Data Analysis in Gene Expression Genomics. Mike West Duke University
Aspects of Statistical Modelling & Data Analysis in Gene Expression Genomics Mike West Duke University Papers, software, many links: www.isds.duke.edu/~mw ABS04 web site: Lecture slides, stats notes, papers,
More informationBST227: Introduction to Statistical Genetics
BST227: Introduction to Statistical Genetics Lecture 11: Heritability from summary statistics & epigenetic enrichments Guest Lecturer: Caleb Lareau Success of GWAS EBI Human GWAS Catalog As of this morning
More informationCompound heterozygosity Yurii S. Aulchenko yurii [dot] aulchenko [at] gmail [dot] com. Thursday, April 11, 13
Compound heterozygosity Yurii S. Aulchenko yurii [dot] aulchenko [at] gmail [dot] com 1 Outline Recessive model Examples of Compound Heterozygosity Compound Double Heterozygosity (CDH) test 2 Recessive
More informationGeorge R. Honig Junius G. Adams III. Human Hemoglobin. Genetics. Springer-Verlag Wien New York
George R. Honig Junius G. Adams III Human Hemoglobin Genetics Springer-Verlag Wien New York George R. Honig, M.D., Ph.D. Professor and Head Department of Pediatrics, College of Medicine University of Illinois
More informationHuman population sub-structure and genetic association studies
Human population sub-structure and genetic association studies Stephanie A. Santorico, Ph.D. Department of Mathematical & Statistical Sciences Stephanie.Santorico@ucdenver.edu Global Similarity Map from
More informationAdditional Disclosure
Additional Disclosure The Genetics of Prostate Cancer: Clinical Implications William J. Catalona, MD Collaborator with decode genetics, Inc. Non-paid consultant with no financial interest or support Northwestern
More informationGenetics & The Work of Mendel. AP Biology
Genetics & The Work of Mendel Gregor Mendel Modern genetics began in the mid-1800s in an abbey garden, where a monk named Gregor Mendel documented inheritance in peas u used experimental method u used
More informationHaplotype allelic classes in the lactase persistence locus
Haplotype allelic classes in the lactase persistence locus Robert Cedergren Colloquium november 3 rd 28 Julie Hussin 1,2, Philippe Nadeau 1,2, Jean-François Lefebvre 2 and Damian Labuda 1-3 1 Bioinformatics
More informationProblem 3: Simulated Rheumatoid Arthritis Data
Problem 3: Simulated Rheumatoid Arthritis Data Michael B Miller Michael Li Gregg Lind Soon-Young Jang The plan
More informationSupplementary Figures
Supplementary Figures Supplementary Fig 1. Comparison of sub-samples on the first two principal components of genetic variation. TheBritishsampleisplottedwithredpoints.The sub-samples of the diverse sample
More informationGenetics of extreme body size evolution in mice from Gough Island
Genetics of extreme body size evolution in mice from Gough Island Karl Broman Biostatistics & Medical Informatics, UW Madison kbroman.org github.com/kbroman @kwbroman bit.ly/apstats2017 This is a collaboration
More informationLack of Association between Endoplasmic Reticulum Stress Response Genes and Suicidal Victims
Kobe J. Med. Sci., Vol. 53, No. 4, pp. 151-155, 2007 Lack of Association between Endoplasmic Reticulum Stress Response Genes and Suicidal Victims KAORU SAKURAI 1, NAOKI NISHIGUCHI 2, OSAMU SHIRAKAWA 2,
More informationBy Mir Mohammed Abbas II PCMB 'A' CHAPTER CONCEPT NOTES
Chapter Notes- Genetics By Mir Mohammed Abbas II PCMB 'A' 1 CHAPTER CONCEPT NOTES Relationship between genes and chromosome of diploid organism and the terms used to describe them Know the terms Terms
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationCONTENT SUPPLEMENTARY FIGURE E. INSTRUMENTAL VARIABLE ANALYSIS USING DESEASONALISED PLASMA 25-HYDROXYVITAMIN D. 7
CONTENT FIGURES 3 SUPPLEMENTARY FIGURE A. NUMBER OF PARTICIPANTS AND EVENTS IN THE OBSERVATIONAL AND GENETIC ANALYSES. 3 SUPPLEMENTARY FIGURE B. FLOWCHART SHOWING THE SELECTION PROCESS FOR DETERMINING
More informationWhat#are#the#different#types#of#mutations#&#phenotypic#effects?#Give#an#example#of#a#disease#for#each.#
Mutation#Classifications:# a. Location# #understand#the#differences#and#consequences.# # o Germinal* *gametes,*inherited* o Somatic* *other*cells,*not*generally*inherited* o Autosomal* *within*genes*on*autosomes*
More informationComputational aspects of ChIP-seq. John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory
Computational aspects of ChIP-seq John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory ChIP-seq Using highthroughput sequencing to investigate DNA
More informationPopulation Genetics 4: Assortative mating
opulation Genetics 4: Assortative mating Mating system Random ositive assortment Negative assortment Inbreeding Mate choice is independent of both phenotype and genotype Mate choice is based on similarity
More informationNeoplasia 2018 lecture 11. Dr H Awad FRCPath
Neoplasia 2018 lecture 11 Dr H Awad FRCPath Clinical aspects of neoplasia Tumors affect patients by: 1. their location 2. hormonal secretions 3. paraneoplastic syndromes 4. cachexia Tumor location Even
More informationABS04. ~ Inaugural Applied Bayesian Statistics School EXPRESSION
ABS04-2004 Applied Bayesian Statistics School STATISTICS & GENE EXPRESSION GENOMICS: METHODS AND COMPUTATIONS Mike West Duke University Centro Congressi Panorama, Trento,, Italy 15th-19th 19th June 2004
More informationOverdiagnosis in Genetic Screening: Uncertainty
National Cancer Institute Overdiagnosis in Screening: Uncertainty Barbara Dunn, NCI/Division of Cancer Prevention Kathy Helzlsouer, NCI/Division of Cancer Control and Population Sciences U.S. DEPARTMENT
More informationMissing Heritablility How to Analyze Your Own Genome Fall 2013
Missing Heritablility 02-223 How to Analyze Your Own Genome Fall 2013 Heritability Heritability: the propor>on of observed varia>on in a par>cular trait (as height) that can be agributed to inherited gene>c
More informationSupplementary Online Content
Supplementary Online Content Hartwig FP, Borges MC, Lessa Horta B, Bowden J, Davey Smith G. Inflammatory biomarkers and risk of schizophrenia: a 2-sample mendelian randomization study. JAMA Psychiatry.
More informationGENETIC LINKAGE ANALYSIS
Atlas of Genetics and Cytogenetics in Oncology and Haematology GENETIC LINKAGE ANALYSIS * I- Recombination fraction II- Definition of the "lod score" of a family III- Test for linkage IV- Estimation of
More informationSummary. Introduction. Atypical and Duplicated Samples. Atypical Samples. Noah A. Rosenberg
doi: 10.1111/j.1469-1809.2006.00285.x Standardized Subsets of the HGDP-CEPH Human Genome Diversity Cell Line Panel, Accounting for Atypical and Duplicated Samples and Pairs of Close Relatives Noah A. Rosenberg
More information