Hallmarks of cancer. potential. Evasion of apoptosis

Transcription

1 Cancer Genetics: John A. Martignetti, M.D., Ph.D. Departments of Genetics & Genomic Sciences, Pediatrics, and Oncological l Sciences john.martignetti@mssm.edu

2 What is Cancer?

3 Hallmarks of cancer Limitless replicative potential Evasion of apoptosis

4 Cancer is a Genetic Disease From a genetic point of view, cancer can be divided into two broad categories. Monogenic diseases - germline mutation within a single gene results in a particular phenotype. Complex diseases - multiple genes and environmental factors interact to produce the disease phenotype. Cancer Sporadic Hereditary

5 10 x 10 9 > x >10 16 Cell division and replication: An opportunity for genetic disaster 100 x >10 25

6

7

8 The Molecular Pathogenesis of Prostate Cancer Development: Cancer is a progression of steps Normal prostate epithelium Germline mutations: RNASEL, ELAC2, MSR1 Normal prostate tissue Proliferative inflammatory atrophy Prostatic intraepithelial neoplasia Localized prostate t cancer Chromosome 8q gain / 8p loss TMPRSS2 Fusion Decrease in NKX3.1 Loss of sequences: 10q, 13q, 16q Decrease in PTEN PIN Metastatic prostate cancer Androgen-independent cancer Gain of sequences: 7p, 7q, Xq Androgen Receptor: Mutations / Amplifications Cancerous tissue

9

10

11 Physical Proof: Tumors arise from previously normal tissues

12 Removal of a Pedunculated Adenomatous Polyp 2007: 145,500 new cases of colorectal cancer and 55,000 deaths in the U.S. The adenoma carcinoma sequence the progression from normal colonic mucosa to small tubular adenomas to larger adenomas and those with more advanced histologic features (villous features, high-grade dysplasia, or both) to cancer is a central tenet of our understanding and management of colonic adenomas. Levine J and Ahnen D. N Engl J Med 2006;355:

13 Epidemiological Proof

14 TUMORS ARE MONOCLONAL GROWTHS Methylation G6PD alleles Ig chains (mm) Chromosomal abnormalities 1 cm

15 TUMORS ARISE FROM SPECIALIZED CELL TYPES: NOMENCLATURE EPITHELIA - CARCINOMA - SQUAMOUS CELL CARCINOMAS - ADENOCARCINOMAS MESENCHYME - SARCOMAS HEMATOPOIETIC - LEUKEMIAS, LYMPHOMAS NEUROECTODERM - GLIOBLASTOMA, NEUROBLASTOMA, RETINOBLASTOMA OUTLIERS - MELANOMAS, SMALL-CELL LUNG CA 80%

16 Human Cancers Some common carcinomas: Lung Breast (women) Leukemias: Bloodstream Lymphomas: Lymph nodes Colon Bladder Prostate (men) Some common sarcomas: Fat Bone Muscle

17 Cancer Nomenclature Cancer Prefixes Identify Origins Prefix Meaning adeno- chondro- gland cartilage erythro- red dblood cell hemangiohepatolipolympho- blood vessels liver fat lymphocyte melano- pigment cell myelo- myo- osteo- bone marrow muscle bone

18 Etiologic Factors In Cancer: Relative Contributions Genetic susceptibility ++++ Alcohol ++ Diet +++ Infection ++ Occupation ++ Environmental pollution + Medications + Additional factors + Tobacco ++++ Source: J. Fraumeni, M.D

19

20 METASTASIS

21

22 Each step is genetically controlled

23 Inheritance Environment Infection MUTATION DYSFUNCTION IN GROWTH REGULATING GENES OR PRODUCTS Mismatch Repair Genes Telomerase Activation GROWTH ADVANTAGE IMMORTALIZATION AUTOSTIMULATION INVASTION, METASTASIS, ANGIOGENESIS

24 Oncogenes Originally identified in RNA tumor viruses as genes that could transform cells into an altered state of control of cell proliferation, often resulting in a tumor. Highly evolutionarily conserved. Encode proteins that are important in cell cycle progression, cell division, i i and differentiation. myc abl sis ras myelocytomatosis virus Abelson murine leukemia virus simian sarcoma virus rat sarcoma virus

25 Rous Sarcoma Virus

26

27 Properties / Phenotype of Transformed Cells

28 Sporadic Cancer Sporadic tumors: mutations that initiate tumorigenesis occur in somatic cells.

29

30

31 Oncogenes : Functions 1. Signal transduction pathways/growth factors - tyrosine kinase receptors, e.g. c-kit, erb-b, RET, ras. Point mutations or deletions of ligand binding domain constitutively activate signal transduction and drive cells into the cell cycle. Cells can become autonomous of growth regulation by endogenous production of polypeptide growth factors which act on their own external receptors and stimulate their growth. 2. Cell cycle regulatory molecules - i.e. cyclin D1, overexpression expedites the G1 - S phase transition as does loss of inhibitory proteins, ultimately making cells resistant to differentiation factors. 3. Transcription factors - jun, fos, presumably activate a class of genes required for continued proliferation. 4. Regulators of programmed cell death - bcl-2, found at breakpoint of t(14;18) in follicular lymphoma. Overexpression of Bcl-2 protein, present in the inner mitochondrial membrane, results in prolonged cell survival - escape from apoptotic signals.

32 Mechanisms of Oncogene Activation Oncogene Point mutation colon cancer - ras Translocation Cell division Proliferation Normal Growth Typically, mutations in oncogenes occur somatically. At the cellular level they are dominant. At the genetic level sporadic. Amplification CML - BCR and abl Tumor Neuroblastoma - n-myc

33 Chronic Myelogenous Leukemia (CML):

34 Chronic Myelogenous Leukemia (CML): the first specific translocation t(9;22)(q34;q11). The Philadelphia chromosome translocation fuses the bcr and abl genes normal individual Leukemic patient bcr Bcr-abl Chr. 22 abl Chr. 9 9; 22 Translocation fuses Bcr and Abl

35 Functional Domains of p160bcr, p145abl, and p210bcr-abl Faderl S et al. N Engl J Med 1999;341:

36 Tyrosine Kinase Biochemistry 2 nd Ed; 1995:1185

37 Signaling Pathways of p210bcr-abl Faderl S et al. N Engl J Med 1999;341:

38 O CH 3 SO 3 H

39 Gleevec -Tyrosine Kinase Inhibitor: Likely Mode of Action of STI571 ATP in its specific binding site in the kinase domain of the protein is able to phosphorylate tyrosine residues (Y) on selected substrates. The phosphorylated p substrate then binds with other molecules and activates downstream pathways in leukaemogenesis. STI571 occupies the ATP pocket in the BCR-ABL kinase domain and substrates cannot be phosphorylated. Goldman J and Melo J. N Engl J Med 2001;344:

40

41

42

43 Contribution Of Hereditary Cancer Breast Cancer: 180,000 cases/yr 10% hereditary = 18,000 Colon Cancer: 130,000 cases/yr > 5% hereditary = >7,000 Prostate Cancer: 180,000 cases/yr 10% hereditary = 18,000 Variable Contribution To Other Cancers

44 Tumor Suppressor Genes Tumor suppressor genes are normal genes that slow down cell division, repair DNA mistakes, and tell cells when to die (apoptosis or programmed cell death). An important difference between oncogenes and tumor suppressor genes is that oncogenes result from the activation (turning on) of proto-oncogenes, but tumor suppressor genes cause cancer when they are inactivated (turned off). Another major difference is that while the overwhelming majority of oncogenes develop from mutations in normal genes (protooncogenes) during the life of the individual (acquired mutations), abnormalities of tumor suppressor genes can be inherited as well as acquired. Genes that control cell division: RB1 (retinoblastoma) Genes that repair DNA: HNPCC (hereditary nonpolyposis colon cancer). Cell "suicide" genes: p53 tumor suppressor gene (Li-Fraumeni syndrome (LFS). People with LFS have a higher risk for developing a number of cancers, including soft-tissue and bone sarcomas, brain tumors, breast cancer, adrenal gland cancer, and leukemia. -Many sporadic cancers including lung cancers, colon cancers, breast cancers as well as others often have mutated p53 genes within the tumor.

45 Hereditary Cancers: Recognition Early onset, wrong gender Multiple, bilateral, pleiotropic* (syndromic) Pedigree shows multiple affected members - Transmitted in an autosomal dominant pattern Hereditary cancers: a mutation is present in the germline. This mutation results in an increased predisposition toward developing a specific type(s) of cancer.

46 Hyperpigmented p e macules

47 Familial breast cancer All breast cancer

48 Highly penetrant mutations

49

50 Retinoblastoma: a Paradigm of Hereditary Cancers Most common intraocular malignancy in childhood: approximately 1:20,000 live births. Tumor of the retina - nervous tissue lining. Presenting signs include leukocoria and strabismus. Average age of diagnosis is months. Association with secondary site tumors: osteosarcoma, Ewing sarcoma, leukemia and lymphoma. Early diagnosis and treatment are critical: 90% cure rate by enucleation and radiation. First cancer to be directly associated with a genetic abnormality (interstitial deletion 13q14).

51 Retinoblastoma: a Paradigm of Hereditary Cancers Sporadic form: always unilateral; approximately 60% of cases. Familial form: transmitted in an autosomal dominant fashion; approximately 80% are bilateral; 15% are unilateral and 5% are asymptomatic (nonpenetrance) % due to parental transmission, remainder represent de novo mutations - paternal allele (10:1).

52 The Two - Hit Hypothesis Based on the epidemiology of retinoblastoma, Alfred Knudson developed the two-hit hypothesis. Knudson hypothesized that the responsible gene, RB, was a tumor suppressor gene, or a growth inhibitory gene. Wild type expression of Rb counteracts tumor formation. Because Rb is a growth-inhibitory gene, both copies of this gene need to be inactivated within a single cell to release that cell from its growth inhibitory effects. Considering that the rate at which somatic mutations occur in a mammalian cell is extremely rare (10-6 to 10-7 ), the occurrence of two independent somatic mutations at both alleles of the same gene is likely to represent a very rare event (10-12 to ). In a normal retinal cell, the first somatic mutation ( hit ) at the Rb tumor suppressor gene will not affect the cellular phenotype (because of the recessive nature of its growth inhibitory function) and only a second hit at the remaining wild type allele will trigger the tumorigenic process. Hence, the first mutation is recessive at the cellular level, although the clinical condition follows an autosomal dominant mode of inheritance. In familial retinoblastoma, the first Rb gene mutation is inherited through the germline, and is therefore present in every somatic cell. Only one additional mutation is required to trigger the tumorigenic process.

53 The Two - Hit Hypothesis Based on the epidemiology of retinoblastoma, Alfred Knudson developed the two-hit hypothesis. Knudson hypothesized that the responsible gene, RB, was a tumor suppressor gene, or a growth inhibitory gene. Wild type expression of Rb counteracts tumor formation. Because Rb is a grwoth-inhibitory gene, both copies of this gene need to be inactivated within a single cell to release that cell from its growth inhibitory effects. Considering that the rate at which somatic mutations occur in a mammalian cell is extremely rare (10-6 to 10-7 ), the occurrence of two independent somatic mutations at both alleles of the same gene is likely to represent a very rare event (10-12 to ). In a normal retinal cell, the first somatic mutation ( hit ) at the Rb tumor suppressor gene will not affect the cellular phenotype (because of the recessive nature of its growth inhibitory function) and only a second hit at the remaining Wild type allele will trigger the tumorigenic process. Hence, the first mutation is recessive at the cellular level, although the clinical condition follows an autosomal dominant mode of inheritance. In familial retinoblastoma, the first Rb gene mutation is inherited through the germline, and is therefore present in every somatic cell. Only one additional mutation is required to trigger the tumorigenic process.

54 The Two - Hit Hypothesis Based on the epidemiology of retinoblastoma, Alfred Knudson developed the two-hit hypothesis. Knudson hypothesized that the responsible gene, RB, was a tumor suppressor gene, or a growth inhibitory gene. Wild type expression of Rb counteracts tumor formation. Because Rb is a grwoth-inhibitory gene, both copies of this gene need to be inactivated within a single cell to release that cell from its growth inhibitory effects. Considering that the rate at which somatic mutations occur in a mammalian cell is extremely rare (10-6 to 10-7 ), the occurrence of two independent somatic mutations at both alleles of the same gene is likely to represent a very rare event (10-12 to ). In a normal retinal cell, the first somatic mutation ( hit ) at the Rb tumor suppressor gene will not affect the cellular phenotype (because of the recessive nature of its growth inhibitory function) and only a second hit at the remaining wild type allele will trigger the tumorigenic process. Hence, the first mutation is recessive at the cellular level, although the clinical condition follows an autosomal dominant mode of inheritance. In familial retinoblastoma, the first Rb gene mutation is inherited through the germline, and is therefore present in every somatic cell. Only one additional mutation is required to trigger the tumorigenic process.

55 The Two - Hit Hypothesis Based on the epidemiology of retinoblastoma, Alfred Knudson developed the two-hit hypothesis. Knudson hypothesized that the responsible gene, RB, was a tumor suppressor gene, or a growth inhibitory gene. Wild type expression of Rb counteracts tumor formation. Because Rb is a grwoth-inhibitory gene, both copies of this gene need to be inactivated within a single cell to release that cell from its growth inhibitory effects. Considering that the rate at which somatic mutations occur in a mammalian cell is extremely rare (10-6 to 10-7 ), the occurrence of two independent somatic mutations at both alleles of the same gene is likely to represent a very rare event (10-12 to ). In a normal retinal cell, the first somatic mutation ( hit ) at the Rb tumor suppressor gene will not affect the cellular phenotype (because of the recessive nature of its growth inhibitory function) and only a second hit at the remaining i wild type allele will trigger the tumorigenic process. Hence, the first mutation is recessive at the cellular level, although the clinical condition follows an autosomal dominant mode of inheritance. In familial retinoblastoma, the first Rb gene mutation is inherited through the germline, and is therefore present in every somatic cell. Only one additional mutation is required to trigger the tumorigenic process. What are some of the epidemiologic and clinical differences between sporadic and inherited retinoblastoma?

56

57 Familial Adenomatous Polyposis Familial Melanoma Retinoblastoma Neurofibromatosi s Herditary papillary renal cancer MEN1 Li Fraumeni Syndrome Peutz-Jeghers Cowdens Disease

58 Chromosomal Abnormalities: Cancer Risk Numerical abnormalities: Down syndrome - 20x increased risk for all pediatric leukemias; however, acute megakaryocytic leukemia risk is 400x greater. Sex chromosome abnormalities: Y chromosome - phenotypic females with Y chromosomal material have a greatly increased risk for gonadoblastoma (25% by age 30). Klinefelter syndrome - associated with mild increased risk of male breast cancer and leukemia. Structural abnormalities: WAGR - Wilms tumor, aniridia, genital abnormalities, mental retardation (11p15). Wilms and genital tumors. Genome instability syndromes: DNA repair genes. HNPCC - mut-l and mut-s genes Bloom syndrome - BLM (recq DNA helicase ). Multiple leukemias, GI cancers Werner syndrome - WRN. Multiple sarcomas.

59 Syndrome Genes Associated Predominant Cancer Risk Risk for Cancer, % (Age Period at Onset) Hereditary BRCA1, Breast, Ovarian, Prostate, Pancreatic for breast cancer (a) Breast/Ovarian Cancer BRCA2 cancers for ovarian cancer (a) Familial adenomatous polyposis APC Colon carcinoma, hepatoblastoma Gorlin syndrome PTCH Basal cell carcinoma, medulloblastoma Hereditary nonpolyposis colorectal cancer Li-Fraumeni syndrome MLH1, MSH2, MSH6, PMS2 TP53 Colon, endometrial, ovarian, renal pelvis, ureter, pancreatic, stomach, small bowel, hepatobilary cancers Soft tissue sarcomas, osteosarcomas, breast cancer, brain tumors, adrenocortical tumors, leukemia 1.6 for hepatoblastoma (c) 100 for colon cancer (t -early a) 90 for basal cell carcinoma (c-a) 5f for medulloblastoma (t- a) for colon cancer for endometrial cancer (teens-adulthood) (c-a) Multiple endocrine Medullary thyroid carcinoma, for medullary thyroid (c-early a) RET neoplasia type 2A pheochromocytoma 50 for pheochromocytoma Neurofibromatosis 1 NF1 Peripheral nerve sheath tumors, optic nerve gliomas, brain tumors, leukemia 10 for peripheral nerve sheath tumors (childhood-adulthood) Neurofibromatosis 2 NF2/merlin Vestibular schwannomas, menungiomas, spinal tumors, skin tumors 100 for vestibular schwannomas 100 (adolescence-a) Retinoblastoma RB1 Retinoblastoma, pinealoma, osteosarcoma, melanoma 90 for retinoblastoma (inf-c) 50 for osteosarcoma (adolescence-a) Tuberous sclerosis complex TSC1, TSC2 Renal cell carcinoma, ependymoma, subependylmal giant cell astrocytoma 5-14 for brain tumors (c-early a) <1 for malignant angiomyolipoma <3 for renal cell carcinoma (early a) Von Hippel-Lindau disease VHL Clear cell renal cancer, pheochromocytoma, pancreatic islet cell cancer 40 for renal cell carcinoma, for pheochromocytoma, Offit et al, for pancreatic islet cell (early a)

60 Robson M and Offit K. N Engl J Med 2007;357:

61 MONOGENIC TRAIT: HIGH PENETRANCE Modifier genes Environment Phenotype

62 DIAPHYSEAL MEDULLARY STENOSIS - OSTEOSARCOMA (DMS - OS): A BONE DYSPLASIA/CANCER SYNDROME Autosomal Dominant 35% Risk of OS Phenotype Bone Findings Cortical Growth Abnormalities Bone Infarctions Pathologic Fractures Pain Pre-Senile Cataracts Etiology Unknown

63

64

65

66 I I I New York Family T I II Australian Family C III C III C C C T I V IV C T V T V VI T I II III T Vermont Family IV C T T T C V T T C C C C 3 VI T VII

67 agcttgaa (GATC) n..aggccta agcttgaa (GATC)..aggccta agcttgaa (GATCGATC)..aggccta g gg STRs: Simple Tandem Repeats 1. Defined sequences; 2. Unique chromosomal positions; 3. Repeat lengths highly variable between individuals and easily measured; 4. Several hundred well-spaced markers can be used to examine the entire genome. agcttgaa (GATCGATCTGATCGATCGATC)..aggccta

68 D9S921 D9S925 D9S1749 D9S916 D9S790 D9SB3 D9S932M D9S171 D9S1121 D9S1118 D9S304 D9S301 D9S1124 D9S1122 D9S922 D9S303 D9S252 D9S906 D9S910 D9S2026 D9S930 D9S302 D9S907 D9S934 D9S918 D9S Position in Haldane FAMILY 2 FAMILY 3 FAMILY 4 FAMILY 5 VI-4 VI-5 IV-5 IV-6 IV-7 IV-4 V-1 V-2 V-5 III-3 IV-1 D9S925 AL624 AL882 D9S1749 D9S916 D9S976 D9SB3 D9S Chromosome 9 D9S1749 D9S916 D9S kb MTAP CDKN2A CDKN2B

69 Segregation of OS-1 Mutation with Disease Phenotype Family 5

70 COMPLEX TRAIT: LOW PENETRANCE Phenotype

71

72 Single nucleotide polymorphisms (SNPs) T / T T / G G / G

73

74 Nature Genetics May, August 2007

75

76 Through June 2009, there were 439 published GWA at p < 5 x 10-8

77

78 Next-Generation Sequencing Genome-wide analysis of sequence and structural variation and mutation Digital RNA profiling, including mrna quantitation, discovery of novel transcripts, splicing and allelic variation in expression Illumina Genome Analyzer ChIP Seq, small RNA analysis and other applications

79

80

81 Some Metrics Capillary (E.g. ABI 3730) Next-Gen Array Based (E.g. Illumina GAIIx, ABI SOLiD 3) Reads Per Run 96 >10 8 Read Length 500-1, Sequence Per Run ~ 100 kb ~ 20 Gb Run time Several hours 7 to 14 days Data type Analog Digital

82 A Reinvention of Transcriptomics Analysis Microarray Sequencing Novel transcripts No Yes Measure abundance < 3 logs > 4 logs Allelic variation Low Res Yes Splice variation Low Res Yes Structural variation Low Res Yes Data Type Analog hybridization Digital sequence Digital, single nucleotide resolution data permits more powerful analysis

83 Some Challenges Data analysis Today s computational tools are rudimentary relative to the data analysis needs Complementing sequence information In the near future, NGS sequencing studies will in general have small sample sizes and may be underpowered Therefore complementary computational and experimental strategies Therefore, complementary computational and experimental strategies are needed

84 Systems Biology Approach Make use of pathway, interaction & other associative information

85

86 Epigenetics Methylation Alternative Splicing MicroRNA

87 How is Breast Cancer Treated? Treatment depends on stage of cancer More than one treatment may be used Surgery Radiation therapy Chemotherapy Hormone therapy Targeted therapy

88 Factors Considered in Treatment Decisions The stage and grade of the tumor The tumor s hormone receptor status (estrogen receptor [ER], progesterone receptor [PR]) Factors that may signify an aggressive tumor, such as HER2/neu amplifications The presence of known mutations to breast cancer genes The woman s menopausal status The patient s age and general health

89 Of young women diagnosed with breast cancer but whose lymph nodes are unaffected, 80% will be free of disease for five years following surgery and radiotherapy alone. The remaining i 20% will develop metastases, and would benefit from receiving further (adjuvant) therapy. The problem is identifying the patients who fit into each group. b, c, Proportion of patients who, on two types of current predictive criteria (b, NIH Consensus, and c, St Gallen)3, 4, would be advised to receive further therapy. The red bars show the proportion of patients who would be cured by surgery and radiotherapy but would then receive unnecessary (and frequently toxic) adjuvant treatment. Nature 415,

90 Nature 415, : 2002

91 Of young women diagnosed with breast cancer but whose lymph nodes are unaffected, 80% will be free of disease for five years following surgery and radiotherapy alone. The remaining i 20% will develop metastases, and would benefit from receiving further (adjuvant) therapy. The problem is identifying the patients who fit into each group. b, c, Proportion of patients who, on two types of current predictive criteria (b, NIH Consensus, and c, St Gallen)3, 4, would be advised to receive further therapy. d, The situation if the molecular predictor described by Friend and colleagues were validated and used for the basis of advice. The red bars show the proportion of patients who would be cured by surgery and radiotherapy but would then receive unnecessary (and frequently toxic) adjuvant treatment.

92 What s Next?