Exosomes: composition,biogenesis and role as intercellular messengers in cancer
|
|
|
- Lizbeth Blair
- 5 years ago
- Views:
Transcription
1 Exosomes: composition,biogenesis and role as intercellular messengers in cancer Héctor Peinado Selgas, PhD. Head, Microenvironment and Metastasis Group Spanish National Cancer Research Centre (CNIO)
2 Tumor Progression Role of microenvironment
3 Extracellular vesicles = exosomes Oncosomes Cell Mol Life Sci Aug;68(16):
4 - Exosomes - Zoller, M. Nature Reviews Cancer (2009)
5 Exosomes in liquid biopsy = tumor exosomes Representation of tumor-derived cargo <10% Proteins (receptors, oncoproteins ) RNA (mrna, smallrna, rrna ) DNA (ssdna, dsdna, retrotransposons) Lipids (sphingomyelin, ceramides ) Sugars (glycosilation) Metabolites
6 Use of extracellular vesicles in liquid biopsy Tumor shed both cells and cellular components that could be used as surrogate markers of tumor burden, mutations, progression, outcome and response to therapy Liquid Biopsies CTCs Circulating Tumor Cells ctna Circulating Tumor Nucleid Acids Extracellular Vesicles Samples: Blood, plasma, serum, CSF, urine, saliva
7 Exosomes in liquid biopsy
8 Standarization is crucial Sample Isolation Methods Quantification Plasma (EDTA-Heparin) Serum Urine CSF Saliva Hour-Clinic Ice-RT Sucrose Size exclusion (Exo Spin) Immunoaffinity (CD9-CD63) Microfluidics Exoquick Ultracentrifugation Exosome Microvesicles Nanosight Izon Protein RNA DNA Fast, Simple, Reliable, Specific for tumors and Sensible Not quite there! We learn as we go
9 Molecular Cargo in Extracellular Vesicles dsdna Thakur et al 2014 Kahlert et al 2014 c-met MIF Integrins Peinado et al 2012 Costa da Silva et al 2015 Hoshino et al 2015.
10 Role of tumor-secreted exosomes during tumor progression Horizontal transfer Of molecules Influence in tumor microenvironment Proteins (receptors, oncoproteins ) RNA (mrna, smallrna, rrna ) DNA (ssdna, dsdna, retrotransposons) Lipids (sphingomyelin, ceramides ) Ions, ph, etc New circulating markers Vlassov et al. BBA, , 7: Pant et al. Biochem. Pharmacol , 11:
11 Tumor-derived exosomes as surrogate markers of cancer TUMOR
12 Circulating exosomes isolated from plasma of melanoma patients Circulating exosomes (100nm) Total number of exosomes in plasma Particles (x10 8 ) / ml of plasma Control I II III IV Stage Peinado et al. Nature Medicine. (18): (2012)
13 Protein content in circulating exosomes is increased in metastatic Stage IV melanoma patients Micrograms of protein / exosome Stage IV melanoma patients Peinado et al. Nature Medicine. (18): (2012)
14 Characterization of exosomes mass spectrometry B16-F10 Highly metastatic B16-F1 Low metastatic High Metastatic Melanoma exosome signature Symbol Entrez Gene Name ACTC1 actin, alpha, cardiac muscle 1 ALB albumin APOA1 apolipoprotein A-I APRT adenine phosphoribosyltransferase BSG basigin (Ok blood group) CD63 CD63 molecule CD151 CD151 molecule (Raph blood group) CD2AP CD2-associated protein ENG endoglin ENO3 enolase 3 (beta, muscle) HSPA1A/HSPA1B heat shock 70kDa protein 1A ITGA5 integrin, alpha 5 (fibronectin receptor, alpha polypeptide) VLA-4 Integrin alpha4beta1 LUM lumican MET met proto-oncogene (hepatocyte growth factor receptor) MIF macrophage migration inhibitory factor (glycosylation-inhibiting factor) PGAM1 phosphoglycerate mutase 1 (brain) PGK2 phosphoglycerate kinase 2 PLG plasminogen PPIA peptidylprolyl isomerase A (cyclophilin A) PSAP prosaposin RAB10 RAB10, member RAS oncogene family RAB14 RAB14, member RAS oncogene family RAB1A RAB1A, member RAS oncogene family RAP1A RAP1A, member of RAS oncogene family RAP1B RAP1B, member of RAS oncogene family Rasl2-9 RAS-like, family 2, locus 9 RHOC ras homolog family member C RHOG ras homolog family member G TMEM59 transmembrane protein 59 TSPAN4 tetraspanin 4 TSPAN6 tetraspanin 6 VTN vitronectin Peinado et al. Nature Medicine. (18): (2012)
15 Melanoma signature Circulating exosomes Control Stage I Stage III Stage IV TYRP2 Hsp70 VLA-4 Hsc70 Hsp90 GAPDH TYRP2 VLA-4 HSP70 HSC70
16 TYRP2 expression in circulating exosomes is associated with Stage III melanoma patient progression Retrospective series of plasma from Stage III melanoma patient (4 years followed up) POD progression of disease, NED no evidence of disease Peinado et al. Nature Medicine. (18): (2012)
17 MET is increased in melanoma patient exosomes Peinado et al. Nature Medicine. (18): (2012)
18 C-KIT TIE2 Increased Frequency of MET-expressing Hematopoietic and Nonhematopoietic Progenitor Populations in Melanoma Patient Blood 80 P < Control CD45 - C-KIT low/ % c-kit low/+ MET + cells Stage I III Stage IV MET % c-kit low/+ MET + TIE2 + cells Control I II III IV Stage P < Control I II III IV
19 Proposed model - Role of exosomes in metastasis Increase of BMPC populations Pro-metastatic behavior c-met-driven Circulating exosomes are diagnostic factors of melanoma patients Melanoma signature VLA4 TYRP2 MET Hsp70 Peinado et al. Nature Medicine. (18): (2012)
20 Analysis of circulating exosomes in breast cancer patients Number of Samples Stage 0 20 I 64 II 41 III 9 IV 6 Histology IDC 96 ILC 12 DCIS 25 LCIS 3 Lymph node status LN- 44 LN+ 27 Receptor status ER+/Her2-41 ER+/Her2+ 9 ER-/Her2+ 6 ER-/Her2-13 n=140
21 Analysis of circulating exosomes in breast cancer patients * *** *** protein exo ( µ g) / ml of plasma *** ** control Stage 0 Stage I Stage II Stage III Stage IV n=140
22 Role of exosomes in metastatic organotropism Ayuko Hoshino, PhD Bruno Costa da Silva, PhD
23 Role of exosomes in metastatic organotropism Hoshino et al. Nature (2015) doi: /nature15756
24 Mass Spectrometry profiling in exosomes derived from organotropic models Liver-metastatic Models Uveal Melanoma Colorectal (HCT116, HT29, SW620) Osteosarcoma (BXPC-3, HPAF-II, MiaPaca, PANC1) Gastric Cancer (SNU1, SNU16) Lung-metastatic Models Breast Cancer (4173, 4175, 4180) Melanoma (131/8-2L) Osteosarcoma (143B) Rhabdomyosarcoma (RD, CT10) Wilms Tumor (CCG9911, CSL) Brain-metastatic Models Breast Cancer (831, 231Br) Melanoma (131/4-5B2, SB1B) Hoshino et al. Nature (2015) doi: /nature15756
25 Integrins are the protein family most represented exosomes derived from organotropic models α 6 β 4 α 6 β 1 α v β 5 Hoshino et al. Nature (2015) doi: /nature15756
26 Integrins in circulating exosomes can predict metastatic tissues β 4 integrin lung metastasis α v integrin liver metastasis
27 Proposed model: Tumor-secreted exosomes are determinants of metastasis organotropism Hoshino et al. Nature (2015) doi: /nature15756
28 CNIO, Molecular Oncology Program Laboratory of Microenvironment and Metastasis Ana Amor Angela Di Giannatale Laura Nogues Imaging Teresa Gonzalez New Therapies Lymph node spread Susana Garcia Silvia Campanario Metastasis Innane immunity Alberto Benito New Markers Obesity Lucia Robado Marina Mazariegos Cristina Merino Marta Hergueta
29 Peinado s Lab Microenvironment and Metastasis Molecular Oncology Program CNIO Madrid, Spain Susana García, PhD. Staff Scientist Marta Hergueta, PhD Postdoc Ana Isabel Amor, Severo Ochoa Grad Student Lucia Robado de Lope, La Caixa Grad Student Silvia Campanario Student Teresa Gonzalez Muñoz Student Cristina Merino Tech Marina Mazariegos Tech Alberto Benito Martin, PhD WCMC Angela DiGiannatale, MD WCMC - Italy Estrella Chavero, Res. Tech. Sergio Haro, Undergrad. Diego Barba, Undergrad Macarena Tello Summer Student Wang, Bryan Zichang Summer Student Dr. David Lyden WCMC Dr. Bromberg - MSKCC Dra. Soengas (CNIO, Spain) Dra. Ortega (CNIO, Spain) Dr. Martin (G. Marañon) Dr Quintela (CNIO) Dr. Olmos (CNIO) Dr. Anton, Pazo (Servet, Zaragoza) Dr. Lopez Guerrero (IVO) Drs Proulx, Detmar (Switzerland) Dr. Rutkowski (Poland) Dr. Mehrara (MSKCC) Dr. Rodriguez Peralto, Ortiz (H12O) Dr. Ghajar (FredHuthc)
Critical steps for circulating exosomes analyses
Critical steps for circulating exosomes analyses Héctor Peinado Selgas, PhD. Head, Microenvironment and Metastasis Group Spanish National Cancer Research Centre (CNIO) Where are we? Exosomes in liquid
USE OF EXOSOMES IN TRANSLATIONAL AND CLINICAL RESEARCH. Eva Colás Ortega Postdoc researcher IRBLleida
USE OF EXOSOMES IN TRANSLATIONAL AND CLINICAL RESEARCH Eva Colás Ortega Postdoc researcher IRBLleida ecolas@irblleida.cat THERE ARE DIFFERENT TYPE OF VESICLES RELEASED BY CELLS MICROVESICLES Size: 100-1000nm
Insight into cancer research from discovery to validation
Insight into cancer research from discovery to validation 1 Exosomes in cancer research: from exosome isolation to biomarker discovery Zheng Songyue, PhD Technical Sales Specialists Life Technologies The
Extracellular Vesicle RNA isolation Kits
Extracellular Vesicle RNA isolation Kits Summary Section 4 Introduction 42 Exo-TotalRNA and TumorExo-TotalRNA isolation kits 43 Extracellular Vesicle RNA extraction kits Ordering information Products can
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Exosome DNA Extraction Kits
Exosome DNA Extraction Kits Summary Section 5 Introduction 40 EXO-DNAc 41 EXO-DNA 43 Introduction Genomic DNA Extractiom Kits Ordering informations Products can be purchased directly in our on-line shop:
vol.3 Highlight Product: ExoCap Product Research tools for extracellular vesicles - Exhibition booth at Taiwan on November
vol.3 Feb. 2018 Highlight Product: ExoCap Product Research tools for extracellular vesicles - Exhibition booth at Taiwan on November Exhibition / Webinar on March 2018 is a big year! CELEBRATE MBL 50th
Impact of Prognostic Factors
Melanoma Prognostic Factors: where we started, where are we going? Impact of Prognostic Factors Staging Management Surgical intervention Adjuvant treatment Suraj Venna, MD Assistant Clinical Professor,
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AWARD NUMBER: W81XWH-13-1-0427 TITLE: Organ-tropic metastatic secretomes and exosomes in breast cancer PRINCIPAL INVESTIGATOR: Dr. David Lyden, MD, PhD CONTRACTING ORGANIZATION: Joan & Sanford I Weill
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-13-1-0248 TITLE: Radiolabeled Exosomes for the Early Detection of Metastases and to Predict Breast Cancer Premetastatic Niche PRINCIPAL INVESTIGATOR: Shankar Vallabhajosula, Ph.D.
EXOSOMES & MICROVESICLES
The Sample Preparation Experts EXOSOMES & MICROVESICLES The New Standard in Exosome Purification and RNA Isolation Best-in-Class, Pure & Simple Exosome Purification, Fractionation of Exosomal Free & Circulating
EXO-DNAc Circulating and EV-associated DNA extraction kit
Datasheet EXO-DNAc Circulating and EV-associated DNA extraction kit This product is for research use only. It is highly recommended to read this users guide in its entirety prior to using this product.
Exosomal Del 1 as a potent diagnostic marker for breast cancer : A prospective cohort study
GBCC 2017: ABS-0017 Exosomal Del 1 as a potent diagnostic marker for breast cancer : A prospective cohort study Soo Jung Lee 1, Jeeyeon Lee 2, Jin Hyang Jung 2, Ho Yong Park 2, Chan Hyeong Lee 3, Pyong
Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a
Supplementary Figure 1. Rab27a-KD inhibits speed and persistence of HEp3 cells migrating in the chick CAM. (a) Western blot analysis of Rab27a expression in GFP-expressing HEp3 cells. (b) Representative
MagCapture Exosome Isolation Kit PS Q&A
MagCapture Exosome Isolation Kit PS Q&A Specifications and performance P.1 Comparison of the conventional method P.2 Operation methods and composition P.4 Amount of starting sample P.5 Analysis after exosomes
EXO-DNA Circulating and EV-associated DNA extraction kit
Datasheet EXO-DNA Circulating and EV-associated DNA extraction kit This product is for research use only. It is highly recommended to read this users guide in its entirety prior to using this product.
CONTRACTING ORGANIZATION: Southern Illinois University School of Medicine, Springfield, IL
Award Number: W81XWH-14-1-0019 TITLE: Identification and Reconstruction of Prostate Tumor-Suppressing Exosomes for Therapeutic Applications PRINCIPAL INVESTIGATOR: Daotai Nie CONTRACTING ORGANIZATION:
The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors
Department of Tumor Biology The clinical relevance of circulating, cell-free and exosomal micrornas as biomarkers for gynecological tumors cfdna Copenhagen April 6-7, 2017 Heidi Schwarzenbach, PhD Tumor
Serum exosomes: A liquid biopsy for neurological disease. Michael Buckland RPAH Neuropathology Sydney, Australia
Serum exosomes: A liquid biopsy for neurological disease Michael Buckland RPAH Neuropathology Sydney, Australia Extracellular vesicles Tiny membrane-bound nano-sized vesicles Exosomes (50-100 nm) Microparticles
Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction. Marker Sequence (5 3 ) Accession No.
Supplementary Tables Supplementary Table S1. Primers used for quantitative real-time polymerase chain reaction Marker Sequence (5 3 ) Accession No. Angiopoietin 1, ANGPT1 A CCCTCCGGTGAATATTGGCTGG NM_001146.3
Extracellular vesicles and ceramide: new mediators for macrophage chemotaxis? Natalie J. Torok
Extracellular vesicles and ceramide: new mediators for macrophage chemotaxis? Natalie J. Torok Department of Medicine, Gastroenterology and Hepatology, UC Davis, Sacramento, CA, and Northern California
1. The metastatic cascade. 3. Pathologic features of metastasis. 4. Therapeutic ramifications. Which malignant cells will metastasize?
1. The metastatic cascade 3. Pathologic features of metastasis 4. Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of Paget s disease of the nipple (intraductal
Development of Next-generation Therapeutic
2015 World Biologics Korea Development of Next-generation Therapeutic Antibodies for Treating Ovarian Cancer (Therapeutic Targeting of Tetraspanin8 in Epithelial Ovarian Cancer Invasion and Metastasis)
Biological processes. Mitochondrion Metabolic process Catalytic activity Oxidoreductase
Full name Glyceraldehyde3 phosphate dehydrogenase Succinatesemialdehyde Glutamate dehydrogenase 1, Alcohol dehydrogenase [NADP+] 2',3'cyclicnucleotide 3' phosphodiesterase Dihydropyrimidinaserelated 2
Molecular Oncology, oncology parameters see each test
Molecular Oncology, oncology parameters see each test DPD deficiency Dihydropyrimidine dehydrogenase deficiency (DPD deficiency) is an autosomal recessive metabolic disorder in which there is absent or
Targeting angiogenesis in cancer
New Indigo workshop on Antiparasitic and Antitumour drugs IBMC, 9 th September, 2011 Targeting angiogenesis in cancer Raquel Soares Department of Biochemistry Tumor angiogenesis: therapeutic implications
Liquid Biopsy. Jesus Garcia-Foncillas MD PhD. Director
Liquid Biopsy Jesus Garcia-Foncillas MD PhD Director Main issues about liquid biopsies New paradigm: Precision Medicine Heterogeneity & Dynamics Surrogate mirror for the tumor CTCs in colon cancer ctdna:
Exosomes Immunocapture and Isolation Tools: Immunoplates
Product Insert Exosomes Immunocapture and Isolation Tools: Immunoplates HBM-POF-##/## HBM-POC-##/## Overall Exosome capture from Biological fluids (plasma, urine) Overall Exosome capture from Cell culture
Contemporary Classification of Breast Cancer
Contemporary Classification of Breast Cancer Laura C. Collins, M.D. Vice Chair of Anatomic Pathology Professor of Pathology Beth Israel Deaconess Medical Center and Harvard Medical School Boston, MA Outline
Accelerate Your Research with Conversant Bio
Imagination has given us the steam engine, the telephone, the talkingmachine and the automobile, for these things had to be dreamed of before they became realities. So I believe that dreams... are likely
1.The metastatic cascade. 2.Pathologic features of metastasis. 3.Therapeutic ramifications
Metastasis 1.The metastatic cascade 2.Pathologic features of metastasis 3.Therapeutic ramifications Sir James Paget (1814-1899) British Surgeon/ Pathologist Paget s disease of bone Paget s disease of the
SUPPLEMENTARY INFORMATION
doi:10.1038/nature15260 Supplementary Data 1: Gene expression in individual basal/stem, luminal, and luminal progenitor cells. Box plots show expression levels for each gene from the 49-gene differentiation
Exosomes in cancer development and clinical applications
Received: 13 April 2018 Accepted: 11 June 2018 DOI: 10.1111/cas.13697 REVIEW ARTICLE Exosomes in cancer development and clinical applications Yu-Ling Tai 1,2 Ko-Chien Chen 1 Jer-Tsong Hsieh 2,3 Tang-Long
Tumor Markers Yesterday, Today & Tomorrow. Steven E. Zimmerman M.D. Vice President & Chief Medical Director
Tumor Markers Yesterday, Today & Tomorrow Steven E. Zimmerman M.D. Vice President & Chief Medical Director Tumor Marker - Definition Substances produced by cancer cells or other cells in response to cancer
Comercial Rafer in Zaragoza
Comercial Rafer in Zaragoza 06.04.2017 ~A novel affinity method to isolate and identify intact Exosomes~ Taku Funakoshi (Mr.) Wako Chemicals GmbH Laboratory Chemicals Division Manager Research fields of
BIOLOGY OF CANCER. Definition: Cancer. Why is it Important to Understand the Biology of Cancer? Regulation of the Cell Cycle 2/13/2015
BIOLOGY OF CANCER Why is it Important to Understand the Biology of Cancer? Cynthia Smith, RN, BA, MSN, AOCN Oncology Clinical Nurse Specialist Harrison Medical Center Definition: Cancer Regulation of the
Oncogenes and Tumor Suppressors MCB 5068 November 12, 2013 Jason Weber
Oncogenes and Tumor Suppressors MCB 5068 November 12, 2013 Jason Weber jweber@dom.wustl.edu Oncogenes & Cancer DNA Tumor Viruses Simian Virus 40 p300 prb p53 Large T Antigen Human Adenovirus p300 E1A
Emerging Concepts of Tumor Exosome Mediated Cell Cell Communication
Emerging Concepts of Tumor Exosome Mediated Cell Cell Communication Huang-Ge Zhang Editor Emerging Concepts of Tumor Exosome Mediated Cell Cell Communication 2123 Editor Huang-Ge Zhang University of Louisville
John Bell Centre for Innovative Cancer Therapeutics
Enhancing Oncolytic Virus Activity by Engineering of Artificial micrornas John Bell Centre for Innovative Cancer Therapeutics Affiliated with Affilié à 1 Oncolytic Viruses: A Therapy for Metastatic Cancers?
Neoplasia 18 lecture 8. Dr Heyam Awad MD, FRCPath
Neoplasia 18 lecture 8 Dr Heyam Awad MD, FRCPath ILOS 1. understand the angiogenic switch in tumors and factors that stimulate and inhibit angiogenesis. 2. list the steps important for tumor metastasis
Melanoma exosomes educate bone marrow progenitor cells toward a pro-metastatic phenotype through MET
Supplementary figures Melanoma exosomes educate bone marrow progenitor cells toward a pro-metastatic phenotype through MET Héctor Peinado, Maša Alečković, Simon Lavotshkin, Irina Matei, Bruno Costa-Silva,
Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath
Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant
Circulating Tumor DNA in GIST and its Implications on Treatment
Circulating Tumor DNA in GIST and its Implications on Treatment October 2 nd 2017 Dr. Ciara Kelly Assistant Attending Physician Sarcoma Medical Oncology Service Objectives Background Liquid biopsy & ctdna
Utility of Circulating micrornas in Cardiovascular Disease
Utility of Circulating micrornas in Cardiovascular Disease Pil-Ki Min, MD, PhD Cardiology Division, Gangnam Severance Hospital, Yonsei University College of Medicine Introduction Biology of micrornas Circulating
Production of Exosomes in a Hollow Fiber Bioreactor
Production of Exosomes in a Hollow Fiber Bioreactor John J S Cadwell, President and CEO, FiberCell Systems Inc INTRODUCTION Exosomes are small lipid membrane vesicles (80-120 nm) of endocytic origin generated
Quantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
Robert Newman, Ph.D. and Peiying Yang, Ph.D.
Robert Newman, Ph.D. and Peiying Yang, Ph.D. Department of Experimental Therapeutics and General Oncology The University of Texas, M.D. Anderson Cancer Center 1 Cardiac glycoside extracts from plants and
Robert Newman, Ph.D. and Peiying Yang, Ph.D.
Robert Newman, Ph.D. and Peiying Yang, Ph.D. Department of Experimental Therapeutics and General Oncology The University of Texas, M.D. Anderson Cancer Center Digitalis purpuria: Source of cardiac glycosides
Cancer. October is National Breast Cancer Awareness Month
Cancer October is National Breast Cancer Awareness Month Objectives 1: Gene regulation Explain how cells in all the different parts of your body develop such different characteristics and functions. Contrast
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
T-cell activation T cells migrate to secondary lymphoid tissues where they interact with antigen, antigen-presenting cells, and other lymphocytes:
Interactions between innate immunity & adaptive immunity What happens to T cells after they leave the thymus? Naïve T cells exit the thymus and enter the bloodstream. If they remain in the bloodstream,
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1. (A) Left, western blot analysis of ISGylated proteins in Jurkat T cells treated with 1000U ml -1 IFN for 16h (IFN) or left untreated (CONT); right, western
A View to the Future: The Development of Targeted Therapy for Melanoma. Michael Davies, M.D., Ph.D.
A View to the Future: Science to Survivorship Symposium September 26, 2009 The Development of Targeted Therapy for Melanoma Michael Davies, M.D., Ph.D. Assistant Professor, Melanoma Medical Oncology How
mirna Biomarkers Seena K. Ajit PhD Pharmacology & Physiology Drexel University College of Medicine October 12, 2017
mirna Biomarkers Seena K. Ajit PhD Pharmacology & Physiology Drexel University College of Medicine October 12, 2017 Outline Introduction Circulating mirnas as potential biomarkers for pain Complex regional
Discovery Dataset. PD Liver Luminal B/ Her-2+ Letrozole. PD Supraclavicular Lymph node. PD Supraclavicular Lymph node Luminal B.
Discovery Dataset 11T pt1cpn2am1(liver) 2009 2010 Liver / Her-2+ 2011 Death Letrozole CHT pt1cpn0(sn)m0 Supraclavicular Lymph node Death 12T 2003 2006 2006 2008 Anastrozole Local RT+Examestane Fulvestrant
C-st: 201 bf3. ~~t4lo. Los Angeles, CA Award Number: W81XWH TITLE: The Oncogenic Palmitoyi-Protein Network in Prostate Cancer
AD Award Number: W81XWH-10-1-0106 TITLE: The Oncogenic Palmitoyi-Protein Network in Prostate Cancer PRINCIPAL INVESTIGATOR: Michael R. Freeman, Ph.D. CONTRACTING ORGANIZATION: Cedars-Sinai Medical Center
Targeting the cgmp Pathway to Treat Colorectal Cancer
Thomas Jefferson University Jefferson Digital Commons Department of Pharmacology and Experimental Therapeutics Faculty Papers Department of Pharmacology and Experimental Therapeutics 29 Targeting the cgmp
QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing
QIAGEN Complete Solutions for Liquid Biopsy Molecular Testing Christopher Swagell, PhD Market Development Manager, Advanced Molecular Pathology QIAGEN 1 Agenda QIAGEN Solid Tumor Testing and Liquid Biopsy
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array.
Supplementary Table 1. Genes analysed for expression by angiogenesis gene-array. Gene symbol Gene name TaqMan Assay ID UniGene ID 18S rrna 18S ribosomal RNA Hs99999901_s1 Actb actin, beta Mm00607939_s1
Seeds and soil theory by Stephen Paget at the end of the XIX century.
Seeds and soil theory by Stephen Paget at the end of the XIX century. In The Distribution Of Secondary Growths In Cancer Of The Breast Paget presents and analyzes 735 fatal cases of breast cancer, complete
Update on Genetic Testing for Melanoma
Update on Genetic Testing for Melanoma Emily Y. Chu, M.D., Ph.D. Assistant Professor of Dermatology & Pathology and Laboratory Medicine Hospital of the University of Pennsylvania February 18, 2018 AAD
FGL2 A new biomarker for cancer in a simple blood test
FGL2 A new biomarker for cancer in a simple blood test WHO IS FGL2 Human gene (chromosome 7) is 7 kb long, 2 exons, monomer protein 70 KD, tetramer in solution. Fibrinogen-like protein 2 (Fgl2), a member
DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA
DNA Methylation of Tumor Suppressor and Metastasis Suppressor Genes in Circulating Tumor Cells and corresponding Circulating Tumor DNA Maria Chimonidou 1, Areti Strati 1, Nikos Malamos 2, Vasilis Georgoulias
The Development of Lymphocytes: B Cell Development in the Bone Marrow & Peripheral Lymphoid Tissue Deborah A. Lebman, Ph.D.
The Development of Lymphocytes: B Cell Development in the Bone Marrow & Peripheral Lymphoid Tissue Deborah A. Lebman, Ph.D. OBJECTIVES 1. To understand how ordered Ig gene rearrangements lead to the development
Inflammation in heart failure: biomarker, bystander or mediator
Inflammation in heart failure: biomarker, bystander or mediator Novel matricellular proteins to target Javier Díez, MD, PhD. Centre of Applied Medical Research and University Clinic School of Medicine,
Service and Collaboration
Summary Section 7 Introduction 68 Exosome and Microvesicle Isolation 69 EV protein quantification, sceening and profiling 69 Nanoparticle Tracking Analysis (NTA) 70 EV Nucleic Acid isolation 70 Nucleic
Annual General Meeting Minutes Division Leadership... 3 New AACC Governance Model... 3 Division Bylaws... 3
Message from the Chair Dear Proteomics and Metabolomics Division member, As 2017 comes to a close, it is a great time to review events and activities of this past year and begin planning for the new year.
Identificación de vulnerabilidades en tumores sólidos: aportes hacia una medicina personalizada?
Identificación de vulnerabilidades en tumores sólidos: aportes hacia una medicina personalizada? Alberto Ocana Albacete University Hospital Salamanca May 19th, 2016 WHAT IS PERSONALIZED MEDICINE? Molecular
INDEX INTERNATIONAL COLLABORATIVE TRIALS 2) OBSERVATIONAL STUDIES AND PHASE II TRIALS 3) CLINICAL PRACTICE GUIDELINES AND REVIEWS
INDEX 1) INTERNATIONAL COLLABORATIVE TRIALS 2) OBSERVATIONAL STUDIES AND PHASE II TRIALS 3) CLINICAL PRACTICE GUIDELINES AND REVIEWS 4) TRANSLATIONAL STUDIES FROM 2010-2014 GEM AND ASSOCIATES INTERNATIONAL
Synthesis and Biological Evaluation of Protein Kinase D Inhibitors
Synthesis and Biological Evaluation of Protein Kinase D Inhibitors Celeste Alverez Topic Seminar October 26, 2013 Celeste Alverez @ Wipf Group 10/26/2013 1 Protein Kinase D (PKD) A novel family of serine/threonine
Long term stability of isolated human serum derived exosomes
Long term stability of isolated human serum derived exosomes Candice de Boer (PhD student) Regenerative Medicine Laboratory Supervisor: Associate Professor Neil Davies Exosomes First discovered during
A two-microrna signature in urinary exosomes for diagnosis of prostate cancer
Poster # B4 A two-microrna signature in urinary exosomes for diagnosis of prostate cancer Anne Karin Ildor Rasmussen 1, Peter Mouritzen 1, Karina Dalsgaard Sørensen 3, Thorarinn Blondal 1, Jörg Krummheuer
ccfdna Webinar Series: The Basics and Beyond
ccfdna Webinar Series: The Basics and Beyond Part I Maxwell RSC ccfdna Plasma Kit and Maxwell RSC instrument are For Research Use Only. Not for Use in Diagnostic Procedures. Introduction to Circulating,
MicroRNAs: a new source of biomarkers in radiation response. Simone Moertl, Helmholtz Centre Munich
MicroRNAs: a new source of biomarkers in radiation response Simone Moertl, Helmholtz Centre Munich The RNA World mrna rrna coding snorna trna scarna RNA snrna noncoding lincrna rasirna RNAi anti-sense
Exosomes Immunocapture and Isolation Tools: Immunobeads
Product Insert Exosomes Immunocapture and Isolation Tools: Immunobeads HBM-BOLF-##/##-# HBM-BOLC-##/##-# HBM-BTLF-##/##-# Overall Exosome capture from Human Biological fluids Overall Exosome capture from
IJC International Journal of Cancer
IJC International Journal of Cancer Short Report Exosomes derived from mesenchymal non-small cell lung cancer cells promote chemoresistance Richard J. Lobb 1,2, Rosa van Amerongen 1, Adrian Wiegmans 1,
Toxicity analysis of PbSQDs using nano-sized vesicles (exosome) secretedfrom HEK293 cells
Toxicity analysis of PbSQDs using nano-sized vesicles (exosome) secretedfrom HEK293 cells EunjooKim, Ph. D. Daegu GyeongbukInstitute of Science and Technology (DGIST), Republic of Korea Quantumdots RUSNANO
PARQUE DE LAS CIENCIAS PROGRAM
15 & 16 September 2016 / Granada, Spain PARQUE DE LAS CIENCIAS PROGRAM International symposium on LIQUID BIOPSIES 2016 will provide a platform for presentations, discussions and planning across all aspect
NIH Public Access Author Manuscript Nat Med. Author manuscript; available in PMC 2013 May 06.
NIH Public Access Author Manuscript Published in final edited form as: Nat Med. 2012 June ; 18(6): 883 891. doi:10.1038/nm.2753. Melanoma exosomes educate bone marrow progenitor cells toward a pro-metastatic
The Building blocks of life. Macromolecules
The Building blocks of life Macromolecules 1 copyright cmassengale 2 Organic Compounds Compounds that contain CARBON are called organic. Macromolecules are large organic molecules. 3 LIFE ON EARTH IS CARBON-BASED
DOWNLOAD OR READ : TUMOR BIOLOGY REGULATION OF CELL GROWTH DIFFERENTIATION AND GENETICS IN CANCER PDF EBOOK EPUB MOBI
DOWNLOAD OR READ : TUMOR BIOLOGY REGULATION OF CELL GROWTH DIFFERENTIATION AND GENETICS IN CANCER PDF EBOOK EPUB MOBI Page 1 Page 2 tumor biology regulation of cell growth differentiation and genetics
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure S1: Fibroblast-induced elongation of cancer cells requires direct contact with living fibroblasts. A. Representative images of HT29-GFP cultured in the presence
Circulating tumor cells/dna/etc for Radiation Oncologists
Circulating tumor cells/dna/etc for Radiation Oncologists Andrew Z. Wang, M.D. Associate Professor Director of Clinical and Translational Research Department of Radiation Oncology Carolina Center for Cancer
Supplementary Tables. Supplementary Figures
Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample
The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients
The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
DNA codes for RNA, which guides protein synthesis.
Section 3: DNA codes for RNA, which guides protein synthesis. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review synthesis New RNA messenger RNA ribosomal RNA transfer RNA transcription
BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES. Overview and Mechanism of Action Dr.
BL-8040: BEST-IN-CLASS CXCR4 ANTAGONIST FOR TREATMENT OF ONCOLOGICAL MALIGNANCIES Overview and Mechanism of Action Dr. Leah Klapper, CSO 88 BL-8040: Novel CXCR4 Antagonist For Hematological Cancers Indications:
Immunology CANCER IMMUNOLOGY
Immunology د. عائدة الدرزي Lec. 6 CANCER IMMUNOLOGY Oncogenesis (passes through two stages): 1- Reversible change Normal transformed cells 2- Irreversible change Transformed oncogenic cells Factors causing
Emerging Tissue and Serum Markers
Emerging Tissue and Serum Markers for Immune Checkpoint Inhibitors Kyong Hwa Park MD, PhD Medical Oncology Korea University College of Medicine Contents Immune checkpoint inhibitors in clinical practice
Exosomes secreted by Human Cardiac Progenitors contain mirna with cardioprotective and proangiogenic activities
Exosomes secreted by Human Cardiac Progenitors contain mirna with cardioprotective and proangiogenic activities Elisabetta Cervio, PhD Molecular Cardiology Laboratory Cardiocentro Ticino, Lugano, CH International
Gastrointestinal Oncology
1stMD ANDERSON INTERNATIONAL MEETING IN Gastrointestinal Oncology CURRENT PRACTICE AND CONTROVERSIES in the Era ra o f Pe Perss on onal aliz ized ed M edicine PRELIMINARY PROGRAM Madrid, 29 November -
UMC- Maastricht. UMC- Groningen Erasmus MC VUMC TOTAL. NKI UMC-Utrecht Leiden UMC. 245,000-Linn, PKAinduced. of ERa at serine 305 and
NKI UMC-Utrecht Leiden UMC UMC- Maastricht UMC- Groningen Erasmus MC VUMC TOTAL 224,000-Linn, PKAinduced high PAK1 levels is 224,000-van Diest, to tamoxifen in ER-positive in 2007 TOTAL 224,000 224,000
Organic Compounds. Compounds that contain CARBON are called organic. Macromolecules are large organic molecules.
Macromolecules Organic Compounds Compounds that contain CARBON are called organic. Macromolecules are large organic molecules. Carbon (C) Carbon has 4 electrons in outer shell. Carbon can form covalent
MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Exam Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) All of the following are synthesized along various sites of the endoplasmic reticulum
Macromolecules. copyright cmassengale
Macromolecules 1 Organic Compounds Compounds that contain CARBON are called organic. Macromolecules are large organic molecules. 2 Carbon (C) Carbon has 4 electrons in outer shell. Carbon can form covalent
EXOSOMES AND CANCER EDWIN LEE MD, FACE INSTITUTE FOR HORMONAL BALANCE ORLANDO, FL
EXOSOMES AND CANCER EDWIN LEE MD, FACE INSTITUTE FOR HORMONAL BALANCE ORLANDO, FL DISCLOSURE THE FOLLOWING POTENTIAL CONFLICT OF INTEREST RELATIONSHIPS ARE GERMANE TO MY PRESENTATION. EQUIPMENT: N/A SPEAKERS
Understanding Tumor Markers for Breast and Colorectal Cancers. A Patient s Guide. Recommendations of the American Society of Clinical Oncology
Cover Layout 1 A Patient s Guide Understanding Tumor Markers for Breast and Colorectal Cancers Recommendations of the American Society of Clinical Oncology ... Cover Layout 2 A Patient s Guide Understanding
the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids
the nature and importance of biomacromolecules in the chemistry of the cell: synthesis of biomacromolecules through the condensation reaction lipids and their sub-units; the role of lipids in the plasma