Discovery Dataset. PD Liver Luminal B/ Her-2+ Letrozole. PD Supraclavicular Lymph node. PD Supraclavicular Lymph node Luminal B.

Transcription

1 Discovery Dataset 11T pt1cpn2am1(liver) Liver / Her Death Letrozole CHT pt1cpn0(sn)m0 Supraclavicular Lymph node Death 12T Anastrozole Local RT+Examestane Fulvestrant CHT pt2pn2am0 Supraclavicular Lymph node Death 20T CHT+Anastrozole Local RT+Examestane CHT pt1cpn3am0 Supraclavicular Lymph node Triple Negative PR 33T Anastrozole CHT pt2pn3am0 Pleura PR 34T Anastrozole Examestane Fulvestrant pt1c(m;is)pn1mi / Her-2+ Sternum / Her-2+ PR 41T CHT+Trastuzumab+Letrozole CHT Trastuzumab Supplementary Figure 1 Treatment histories of patients with CYP19A1 amplification in the discovery cohort. Treatment history for the six patients from the AI discovery cohort with acquired CYP19A1 amplification., progressive disease; PR, partial response (according to Response Evaluation Criteria in Solid Tumors: RECIST standards).

2 Validation Dataset pt2(m)pn1am0 Luminal A Vertebra SD 58T Letrozole Fulvestrant Local RT CHT+Zoledronic acid pt2pn1am0 60T 2007 Ilium SD 2016 Anastrozole Examestane Local RT+Densumab+CHT pt1cpn0(sn)m0 Pleura SD 50T Anastrozole Fulvestrant Local RT pt2(m)pn1am0 Luminal A 40T 2005 Liver Death Anastrozole Letrozole Local RT+CHT Examestane pt1cn0(sn)m0 44T 2007 Liver Luminal A 2012 Death 2014 Letrozole CHT+Zoledronic acid pt1bn0(sn)m1 59T 2010 Sternum 2015 SD 2016 Tamoxifen+Triptorelin Letrozole+Triptorelin Supplementary Figure 2 Treatment histories of patients with CYP19A1 amplification in the validation cohort. Treatment history for the six patients from the AI validation cohort with acquired CYP19A1 amplification., progressive disease; PR, partial response (according to Response Evaluation Criteria in Solid Tumors: RECIST standards).

3 n s Frequency% % 8% Frequency% Alteration Frequency 7% % % 4% 3% 2% 1% Deletion Cancer type Amplification Multiple alterations Mutation data CNA data Deletion Amplification Multiple alterations A 10 % 8% 6% 4% 2% pe a ta B 16 % 14% 12% 10 % 8% 6% 4% 2% ACC(TCGA) ACbC(MSKCC/Breast 2015) ACyC(FMI 2014) ACyC(MSKCC, 2013) AML (TCGA) AML (TCGApub) pe ta ata Prostate (SU2C) arian (TCGA) Supplementary Figure 3 Bladder (MSKCC2012) Uterine CS (TCGA) Uterine (TCGA) Uterine (TCGA pub) Thyroid (TCGA) Thyroid (TCGA pub) Stomach (TCGA) Sarcoma (TCGA) Sarcoma (MSKCC) Prostate (TCGA) Pancreas (UTSW) Pancreas (TCGA) Bladder (MSKCC2014) Thyroid (MSKCC 2016) Thymoma(TCGA) Stomach (TCGA pub) Prostate (TCGA 2015) prcc (TCGA) PCPG (TCGA) A pub) Breast Cancer Datasets Bladder (TCGA2014) Uveal melanoma (TCGA) Prostate (MSKCC 2014) Prostate (MSKCC 2010) Prostate (MICH) Prostate (FHCRC, 2016) Bladder (TCGA) Testicular germ cell (TCGA) Prostate (Broad/Cornell 2013) Prostate (Broad/Cornell 2012) Bladder PV(MSKCC) Breast (BCCRCXenograft) Breast (METABRIC) CYP19A1 locus CNAs in primary cancers. Breast (TCGA2015) Breast (TCGApub) Breast (TCGA) CCLE(Novartis/Broad 2012) ccrcc(tcgapub) Breast Cancer Datasets ccrcc(tcga) Cervical (TCGA) Cholangiocarcinoma (TCGA) chrcc(tcga) chrcc(tcga) Colorectal (TCGApub) Colorectal (TCGA) DLBC(TCGA) Esophagus (TCGA) Uterine CS (TCGA) Uterine (TCGA) Deletion Amplification Multiple alterations Uterine (TCGA pub) Thyroid (TCGA) Thyroid (TCGA pub) Stomach (TCGA) Stomach (TCGA pub) Sarcoma (TCGA) Sarcoma (MSKCC) Prostate (TCGA) Prostate (TCGA 2015) Prostate (SU2C) prcc (TCGA) PCPG (TCGA) Pancreas (UTSW) Pancreas (TCGA) Ovarian (TCGA) Ovarian (TCGA pub) NSCLC (TCGA 2016) NCI-60 Primary Cancers CNAs GBM(TCGA2008) Uveal melanoma (TCGA) Thyroid (MSKCC 2016) Thymoma(TCGA) Prostate (MSKCC 2014) Prostate (MSKCC 2010) Prostate (MICH) Prostate (FHCRC, 2016) GBM(TCGA2013) Testicular germ cell (TCGA) Prostate (Broad/Cornell 2013) Prostate (Broad/Cornell 2012) CYP19A1 locus GBM(TCGA) Glioma (TCGA) NEPC (Trento/Cornell/Broad 2016) MPNST (MSKCC) Mesothelioma (TCGA) Melanoma (TCGA) Lung squ (TCGA) Lung squ (TCGA pub) Lung adeno (TCGA) Lung adeno (TCGA pub) Lung adeno (Broad) Liver (TCGA) Liver (AMC) LGG-GBM (TCGA 2016) hnc_mskcc_2016 Head & neck (TCGA) Head & neck (TCGA pub) Glioma (TCGA) GBM (TCGA) GBM (TCGA 2013) GBM (TCGA 2008) s (TCGA) Head &neck (TCGApub) Head &neck (TCGA) hnc_mskcc_2016 LGG-GBM(TCGA2016) Liver (AMC) Liver (TCGA) Lung adeno (Broad) ESR1 locus Lung adeno (TCGApub) Lung adeno (TCGA) Figure Legend Thyroid (M Thymoma(TCGA) Testicular germ cell (TCGA) Stomach (TCGA) Stomach (TCGA pub) Sarcoma (TCGA) Sarcoma (MSKCC) Prostate (TCGA) Prostate (TCGA 2015) Prostate (SU2C) Prostate (MSKCC 2014) Prostate (MSKCC 2010) Prostate (MICH) Prostate (FHCRC, 2016) Prostate (Broad/Cornell 2013) Prostate (Broad/Cornell 2012) Lung squ (TCGApub) NCI-60 Lung squ (TCGA) Melanoma (TCGA) prcc (TCGA) PCPG (TCGA) Mesothelioma (TCGA) Pancreas (UTSW) Pancreas (TCGA) Ovarian (TCGA) MPNST(MSKCC) Ovarian (TCGA pub) NSCLC (TCGA 2016) NEPC(Trento/Cornell/Broad 2016) NCI-60 NSCLC(TCGA2016) Ovarian (TCGApub) NEPC (Trento/Cornell/Broad 2016) MPNST (MSKCC) Mesothelioma (TCGA) Melanoma (TCGA) Lung squ (TCGA) Lung squ (TCGA pub) Lung adeno (TCGA) Lung adeno (TCGA pub) Lung adeno (Broad) Liver (TCGA) Liver (AMC) LGG-GBM (TCGA 2016) hnc_mskcc_2016 Head & neck (TCGA) Head & neck (TCGA pub) Glioma (TCGA) GBM (TCGA) GBM (TCGA 2013) GBM (TCGA 2008) Esophagus (TCGA) DLBC (TCGA) Colorectal (TCGA) Colorectal (TCGA pub) chrcc (TCGA) chrcc (TCGA) Cholangiocarcinoma (TCGA) Cervical (TCGA) ccrcc (TCGA) ccrcc (TCGA pub) CCLE (Novartis/Broad 2012) Breast (TCGA) Breast (TCGA pub) Breast (TCGA 2015) Breast (METABRIC) Breast (BCCRC Xenograft) Bladder PV (MSKCC) Bladder (TCGA) Bladder (TCGA 2014) Bladder (MSKCC 2014) Bladder (MSKCC 2012) AML (TCGA) ML (TCGA pub) C, 2013) Ovarian (TCGA) Pancreas (TCGA) Pancreas (UTSW) CNA meta-analysis of primary breast cancers. (a) CYP19A1 locus. (b) ESR1 locus. Figures were generated using cbioportal. Only datasets with potential CNA data are presented. Cancers are grouped and color-coded based on tissue of origin. CNA analysis was obtained using GISTIC. PCPG(TCGA) prcc(tcga) Prostate (Broad/Cornell 2013) Prostate (Broad/Cornell 2012) PC Prostate (FHCRC, 2016) Pancreas (UTS Pancreas (TCGA) Ovarian (TCGA) Ovarian (TCGA pub) NSCLC (TCGA 2016) NEPC (Trento/Cornell/Broad 2016) NCI-60 Prostate (MICH) Amplification Deletion Multiple Alterations MPNST (MSKCC) Mesothelioma (TCGA) Melanoma (TCGA) Lung squ (TCGA) Lung squ (TCGA pub) Lung adeno (TCGA) Lung adeno (TCGA pub) Lung adeno (Broad) Liver (TCGA) Liver (AMC) Prostate (MSKCC2010) Prostate (MSKCC2014) Prostate (SU2C) Prostate (TCGA2015) Prostate (TCGA) LGG-GBM (TCGA 2016) hnc_mskcc_2016 Sarcoma (MSKCC) Sarcoma (TCGA) Stomach (TCGApub) Stomach (TCGA) Thymoma(TCGA) Testicular germcell (TCGA) Amplification Head & neck (TCGA) Head & neck (TCGA pub) Thyroid (MSKCC2016) Thyroid (TCGApub) Thyroid (TCGA) Uterine (TCGApub) Deletion Multiple Alterations Glioma (TCGA) GBM (TCGA) GBM (TCGA 2013) GBM (TCGA 2008) Esophagus (TCGA) DLBC (TCGA) Colorectal (TCGA) Colorectal (TCGA pub) chrcc (TCGA) chrcc (TCGA) Cholangiocarcinoma (TCGA) Cervical (TCGA) ccrcc (TCGA) ccrcc (TCGA pub) CCLE (Novartis/Broad 2012) Breast (TCGA) Breast (TCGA pub) Breast (TCGA 2015) Breast (METABRIC) Breast (BCCRC Xenograft) Bladder PV (MSKCC) Bladder (TCGA) Bladder (TCGA 2014) Bladder (MSKCC 2014) Bladder (MSKCC 2012) AML (TCGA) AML (TCGA pub) ACyC (MSKCC, 2013) ACyC (FMI 2014) ACC (TCGA) ACbC (MSKCC/Breast 2015) Uterine (TCGA) Uterine CS(TCGA) Uveal melanoma (TCGA)

4 CTC288 BPE-0 BPE-12 CTC223 BA-8 BA-11 MaCa-3366 BA-1 Copy Number (TAQMAN) normalized to normal tissue 26t-v 57t-v 58t-v 60t-v 62t-v 49t-v 46t-v 39t-v 50t-v 40t-v 41t-v 44t-v 48t-v 54t-v 27t-v 13t-v 59t-v 78t-v 80t-v Copy Number (TAQMAN) normalized to normal matched tissue 4t-v 5t-v 12t-v 25t-v 16t-v 3t-v 1t-v 11t-v 31t-v 35t-v 24t-v 36t-v 2t-v 63t-v 64t-v 65t-v 68t-v 70t-v 73t-v A ERα patients Luminal A+B SERM= AI= 0 Primary Surgical Material Validation Dataset Relapse Metastatic Biopsy Co py Number TM CYP19A1/ ESR1/ Normalizer TM TERT/ RNASEP/ GABRB3 FISH (15q21.2 locus) Normalizer FISH (15 α-satellite) 15 yrs. TAM 8 ESR11/ TERT 0/ 19 ESR1/ RNASEP Copy Number Gain 0.5 Copy Number Loss 20 AI ESR1/ TERT 4/ ESR1/ RNASEP B Xs Dataset ESR1/ TERT ESR1/ RNASEP History of AI treatment NA - NA Supplementary Figure 4 ESR1 locus CNAs in metastatic breast cancers and X models. (a) CNA TaqMan analysis for potential ESR1 amplification in the validation cohort. Copy number values are normalized to the adjacent normal tissue and to an internal normalizer (either TERT or RNASEP). (b) CNA TaqMan analysis for potential ESR1 amplifications in the X cohort (obtained from patients treated with SERM/AI as indicated by the lower panel).

5 CTC288 BPE2-0 BPE-12 CTC223 BA-8 BA-11 MaCa-3366 BA-1 Copy Number (TAQMAN) normalized to normal tissue 58T-V 60T-V Copy Number (TAQMAN) normalized to normal matched tissue A Validation GABRB3 normalizer CHR15 GABR3 CYP19A1 Validation dataset AI CYP19A1/ TERT chr5 CYP19A1/ RNASEP chr14 CYP19A1/ GABRB3 chr T-V=potential full chromosome 15 amplification 60T-V=potential focal CYP19A1amplification + loss of one copy of Chr15 5 Xs dataset 4 3 BA-8= potential focal CYP19A1amplification B Combined Clinical datasets AI treated CYP19A1 ESR1 copy number gain copy number loss Tamoxifen treated CYP19A1 ESR1 Supplementary Figure 5 CYP19A1 CNAs can be due to focal amplification as assayed by TaqMan. (a) Graphical representation of GABRB3 locus, and its position with respect to the CYP19A1 locus. Normalization to the GABRB3 locus can help to identify focal (signal at the CYP19A1 locus > GABRB3) vs. whole chromosome amplification (signal at the CYP19A1 locus GABRB3). (b) Combined plot of all clinical datasets.

6 Validation Dataset FISH Metastasis CYP19A1 amp (TaqMan) AR 35 Metastasis CYP19A1 W T(TaqMan) AR 31 Supplementary Figure 6 Probes for FISH Analyses 15 Alpha Satellite probe (green signal) BAC RP11-66L23 (red signal)(cyp19a1) CYP19A1 CNAs can be due to focal amplification as assayed by FISH. Representative FISH images for the validation dataset. One case of CYP19A1 amplified and one case of CYP19A1 wild type are shown. The summary of TaqMan results and FISH ratio (CYP19A1/15 alpha satellite) is reported in the table.

7 Frequency% Breast (TCGA 2015 n=1105, all cases) A 10 9% 8 7 Primary Cancers SNVs Cumulative Mutational Frequency Amplification Deletion Multiple Alterations Mutations B 34% 8% 12% 35% 1% % Cancer type Mutation Data CNVs Data Mutations Truncating Mutations Inframe Mutations C PIK3CA MAP3K1 GATA3 TP53 ESR1 CYP19A1 PAM50 PIK3CA MAP3K1 GATA3 TP53 ESR1 CYP19A1 Supplementary Figure 7 43% 11% 14% 19% 1% Breast (TCGA 2012 n=321, Lum. A/ B) LUM. A LUM.B Breast (TCGA 2012) Breast (TCGA 2015) Lum. A n=235 Lum. B=133 IDC Lum. A n=201 IDC Lum. B n=133 44% 29% 46% 35% 13% 5% 16% 2% 14% 14% 2 18% 11% 29% 14% 43% 1% 1% Mutation Types Missense Inframe Truncating Mutational landscape of breast cancer drivers in patients with primary breast cancer. SNV meta-analysis of primary breast cancers. (a) Cumulative frequency of CNA and SNV mapping at the PIK3CA, MAP3K1, GATA3, TP53, ESR1 and CYP19A1 loci in primary breast cancers. These genes were profiled in our targeted sequencing panel. (b) SNVs for the sequenced genes in a recent TCGA dataset including all breast cancer subtypes. (c) SNVs for the sequenced genes in the 2012 TCGA dataset restricted to luminal A/B (ERα-positive) patients. Mutational frequencies for the Luminal A and subsets are included in the bottom panel (from two different TCGA datasets).

8 Supplementary Figure 8 Mutational landscape of breast cancer drivers in patients with metastatic breast cancer. (a) Total depth of sequencing coverage and statistics for activating ESR1 mutations in Tamoxifen and AI patient samples. Allele frequencies (AF) are also reported as a fraction of the total number of sequenced and aligned reads. SNVs were called against adjacent matched normal tissue. (b) Boxplots for individual patient/mutations in the AI cohorts. DNA was re-extracted from patients included in Figure 2d and re-analyzed on a separate experiment using an Ampliseq custom panel. Patients identifiers from CYP19A1-amplified samples are highlighted in green boxes; ESR1-amplified patients are highlighted in bold. A summary of the mutation frequencies is shown in the table below.

9 normalized read pileup A MCF7T ERα Breast cancer cell adaptation protocol 10-7 M Tamoxifen >1yr LTEDT 10-7 M Tamoxifen >1yr LTED 10-7 M Fulvestrant >1yr E2 deprivation >1yr LTEDF ER- MCF M Fulvestrant >1yr MCF7F ER- B CYP19A1 locus CYP19A1 LTED C MCF7 MCF7T MCF7F LTED LTEDT LTEDF Supplementary Figure 9 CYP19A1 CNAs in breast cancer cell lines. (a) ERα breast cancer cell lines treatment history and derivation. (b) Potential CNV called by MACS within chromosome 15. CYP19A1 is located at the center of the dense cluster (black box). (c) Close up of the CYP19A1 amplicon in the six cell lines. The panels show raw reads (SAM file) at the boundaries of the amplicon

10 SRB (day 6/ day 1.) Relative mrna value (sictrl) Relative mrna value (MCF7) Aromatase activity (arbitrary units) A Aromatisation assay ** * LTED MCF Letrozole B LTED: sicyp19a1 C MCF7: CYP19A1 over expression **** **** exon 2-3 exon 3-4 sictrl sicyp19a1-1 sicyp19a **** **** exon 2-3 exon 3-4 MCF7 MCF7 CYP19A1 D LTED Control Tamoxifen 100nM * Fulvestrant 100nM Supplementary Figure 10 CYP19A1 activity and manipulation in breast cancer cell lines. (a) Aromatase activity assay. Various breast cancer cell lines were assayed for aromatase enzyme activity. Aromatase activity is higher in LTED cells than in MCF7 cells, and it is significantly impaired by letrozole treatment. Columns and bars represent mean and s.e.m. from three independent experiments. Asterisks represent significant difference after one-way ANOVA with Tukey s post-test. (b) CYP19A1 mrna was depleted using two independent sirna. Bar represent fold change in mrna levels measured with qrt-pcr and compared to a control sirna using two alternative intron-spanning primers. Columns and bars represent mean and s.e.m. from three independent experiments. Asterisks represent significant difference after one-way ANOVA with Dunnet s post-test. (c) CYP19A1 was overexpressed using a CYP19A1 ORF. Bar represent fold change in mrna levels measured with qrt-pcr and compared to a control plasmid using two alternative intron-spanning primers. Columns and bars represent mean and s.e.m. from three independent experiments. Asterisks represent significant difference after Student s t-test. (d) Growth of CYP19A1amp LTED cells was tested in response to the SERM Tamoxifen and the SERD Fulvestrant. Data are reported as the ratio of SRB units between day 6 and day 1. Columns and bars represent mean and s.e.m. from three independent experiments. Asterisks represent significant difference after a ANOVA test. Significance levels are as follows: *P < 0.05, **P < 0.01, ****P <

11 CYP19A1 58kDA 36kDA Actin 140 kda 50kDA 45 kda 35 kda 25 kda Supplementary Figure 11 Uncropped western blot for analysis of CYP19A1 in breast cancer cell lines. Top. Lane 1: MW marker. Lanes 2-7: MCF7, MCF7T, MCF7F, LTED, LTEDT and LTEDF. Antibody: CYP19A1. Bottom. Lane1: MW marker. Lanes 2-7: MCF7, MCF7T, MCF7F, LTED, LTEDT and LTEDF. Antibody: β-actin

12 Supplementary Note CYP19A1 probe sequence for RNA-FISH gacgtctggaagatcccgagtcagagggggcaatttagagaaaccatcttgtgttccttgtgtatcgggttca gcatttccacgatgctggtgatgttatcctcataattccacaccaagaggacctggtattgaggatgaatctgc cgtgggagatgagtgtagtagttgcaggcactgactcgcatgaattctccataaatgagtgtttcctctccaga catacttgaggacttgctgaagtttgctgccgaatcgagatatgatgcctttctcatgcgcctgacagagctttc ataacacagactgtgaccatacgactgtccagatgtgttttgagcacatagcccgattcattgggacgcaga agggtcaacacgttagaggtgtccagcatgacagcactttcgtccaaagggaaaccttggattttaaccac gagagcttgccatgcatcaaagaagatgtctggtttgatgaaaatcctgcgtcttttttctttcacattctctcttgt caggcgatcagcatttccaatatagacagacatggtgtcaggaacattagggtgctttgcaatggatttccttt attattgccatcaatctttatgtctctctaccgcatgctctcataaatgcatgaccaagtccacgacagacatca tcttctaaggctttttttcactgggtagccatcgttcaggataatgtttgtcccaaactcgagtctgtgcatcctaaa ttcattgggtttgggggccaaatggctgaaagtacccgatgtactttcctgcacagtgcaatgtcttcacgtgg aatatgctctcaacacactgtcagaacaagtcgtgtatcttctttttagtctcatctgggtggggtaaagatcattt ccagccagacacctgtctgagtttctactgaccagcctctctaggatgagaaatgctccagagt