Chinese Journal of Biochemistry and Molecular Biology MKL P1. 3, Changjun ZHU 3) 1) 2) 3 MKLP1 . MKLP1

Transcription

1 ISSN CN ΠQ Chinese Journal of Biochemistry and Molecular Biology 21 (4) : esirna MKLP1 1) 2) 3, 3, Changjun ZHU 3) 1) 1),,, 1) 3, Wei J IANG 3) ( 1), ; 2), ; 3) Burnham, 92037, ) MKLP1, E coli RNase MKL P1 3 UTR esirna HeLa, RT2PCR Western MKL P1 esirna MKL P1 FACS MKLP1,, MKLP1 MKL P1esiRNA MKL P1 esirna HeLa MKLP1, MKLP1 MKLP1, MKLP1, Π,MKLP1, Π, esirna,, 1 Functional Analysis of Human Kinesin in Cytokinesis Using esirna2mediated RNAi CHEN Wei2Wen 1), ZHAO Jian 2) 3 3, Changjun ZHU 3), KONG Feng 1), WU Wei2Fang 1),ZHANGJian2Ye 1) 3, Wei J IANG 3) ( 1) Institute of Biochemistry and Molecular Biology, School of Medicine, Shandong University, Jinan , China ; 2) Department of Thoracic Surgery, Qilu Hospital of Shandong University, Jinan , China ; 3) Burnham Institute, San diego 92037, USA) Abstract To investigate the role of the human mitotic kinesin2like protein 1 (MKLP1) in mitosis and cytokinesis, E coli RNase 2prepared MKL P1 3 UTR esirna was transfected into HeLa cells quantitive RT2PCR and Western blotting were performed to determine the percentage of the ablation of MKLP1 expression, respectively Thereafter using FACS analysis, immunofluorescence and time2lapse microscopy to evaluate the cell morphology, mitotic index and percentage of cells at different stages of mitosis and cytokinesis after depletion of the MKLP1 expression, and dynamically observed the phenotypes transformation during mitosis and cytokinesis, to systematically analyse the function of MKLP1 Finally testify the specificity of : , : (No ) 3 :Tel : ,E2mail edu cn ; 3 3 Received : December 31,2004 ;Accepted :March 15,2005 Supported by National Natural Science Foundation of China (No ) 3 Corresponding author Tel : ,E2mail edu cn 3 3 Who contributed equally to this article

2 4 :esirna MKLP1 555 MKL P1 esirna by rescue experiment These results indicated that MKL P1 esirnas specifically and effectively suppress the expression of endogenous MKLP1, which can be compensated by the ectopic expression of MKLP1 MKLP1 proteins were localized the spindle midzone in anaphase and early telophase During late telophase and the final stage of cytokinesis, MKLP1 was concentrated on the center of the midbody The depletion of MKLP1 expression result in the severe inhibition of proper formation of the midbody and the completion of cytokinesis Our results demonstrate that MKLP1 acting as midbody or midzone2associated protein is crucial for the midbody formation and the early telophase to late telophase transition and is essential for cytokinesis Key words esirna, kenisin, MKLP1, cytokinesis ( ),, DNA 3 4 sirnas,, sirnas ( sirna, mrna, ), 2002, Yang [9 ] E coli RNase dsrna esirna ( endoribonuclease2prepared, ( kinesin) sirna), [1 ] 1985 [2 ],,,, ATPase (microtubule2based motor protein), sirna HeLa MKLP1,, HeLa, ATP MKLP1, 1 mrna [1 ] 111 esirna, E coli RNase esirna [9 ] ; BLAST 6 5 MKL P1 cdna, ; Vale 25 (,5 3 UTRs) MKL P1, 8 3 UTR( 400 bp) DNA, [3,4 ] 40,, : 5 2GCGTAATACGACTCAC TATAGGGTCCCAGTACTGAAAGAACAT23 ;5 2GCGTAA TACGACTCACTATAGGGACCAGGGCTGGAGAAGTCAC2, Eg5, 3, DNA Kid,CENP2E, PCR MKL P1 3 UTR 400 bp DNA [5 8,MKLP2 ] RNAi 400 bp DNA, MKLP1 ( mitotic kinesin2like protein 1) GACATCTCATCTACCTCCCGGT23 ; 5 2GCGTAATACG sirna ACTCACTATAGGTGCGCCCCCAGAAGCAATTTC23, 5 5 T7 PCR : PCR sirna in vitro T7 transcription kit sirna Π (Ambion) dsrna dsrna DNase, sirnas dsrna RNase (luciferase) cdna, PCR : 5 2GCGTAATACGACTCACTATAG 715 molπl LiCl,70 %(VΠV), 4, 1 gπ l 50 g dsrna 215 g GST2

3 RNase 37 3 h, 20 mmolπl EDTA 24 h, 10 % FBS CO 2, QIAquick spin columns (Qiagen) ( GIBCO), (Sigma), esirna, A 260,4 % Zeiss Axiovert 100 M MKL P1 cdna ( IMAGE EST clone ) p EGFP2C1 Sal 2 Inc1) Sal, p EGFP2MKL P1 115 RT2PCR ( quantitative p EYFP2tubulin p ECFP2H2 B Dr Changjun Zhu, HeLa 113 Π 48 h HeLa, TRIZOL ( Invitrogen),p EYFP2tubulin ( 2tubulin) RNA, cdna, MKLP1 ( EYFP),p ECFP2 H2 B H2B TCCTCGTTGTTTGGACATGA23 ;5 2TTTGGATTGGGCAT ( ECFP), AGCTTC23 GA PDH, DNA ( C t [4,10 ], ) PCR 119,, esirna MKL P1 mrna 2MKLP1 ( 2MKLP1) Santa Cruz Inc, Jackson Immunoresearch Inc 113,, Western MKL P1 esirna FACS p EGFPC1 ( ) MKL P1 esirna HeLa 24, 10 % FBS DMEM MKLP1, MKL P1 cdna, Oligofectamine ( Invitrogen), 3 : 3 UTR) 113, 112 g MKL P1 esirna 112 g p EGFPC12MKL P1 p EGFPC1, 12 h ( luciferase) esirna 48 h, MKL P1 esirna,48 h : Western :1 %NP240 Western, SDS2PAGE, PVDF 2, ; : 3 % 2 % 211 MKLP1 esirna PBS 15 min,10 %, ( 2MKLP ; 2tubulin ) 4,, (1 200 ) DAPI (015 gπml) 1 h 5,Leica DM IRE2, FACS ( 212 qrt2pcr esirna MKL P1, fluorescence2activated cell sorting) : esirna 48 h HeLa,,PI, DNA 114 ( Time2lapse microscopy) HeLa 35 mm, Oligofectamine ( Invitrogen) 5 g p EYFP2, CCD, 2 min 1, 9 10 h, Slidebook 310 ( Intelligent Imaging Innovations, PCR) RT2PCR, qrt2 RT2PCR, : 5 2 Lumina 116 ( rescue) 24 HeLa 3 : p EGFPC12MKL P1 ( EGFP esirnas ( Fig11 ), MKL P1 esirnas luciferase esirnas 20 bp qrt2pcr : 48 h,, MKL P1 esirna HeLa MKL P % 213 Western esirna MKLP1 Western MKL P1 esirna tubulin pecfp2h2 B MKL P1 esirna, Fig12 48 h,

4 4 :esirna MKLP1 557 Fig 2 esirna2mediated MKLP1 gene silencing in HeLa cells determined by Western blotting Fig 1 Agarose gel analysis of purified esirna 1 : DNA marker 2 : luciferase esirna 3 : MKL P1 esirna MKL P1 esirna 4n > 4n, MKL P1 esirna esirna (Fig13) HeLa MKLP1, ( 2tubulin), qrt2pcr 214 FACS, 48 h, Fig 3 DNA content measuring after RNAi by FACS analysis 215 MKLP1, MKLP1, MKL P1 esirna HeLa MKLP1 2MKLP1 esirnas HeLa, 36 h DAPI MKLP1, EYFP2tubulin, ECFP2H2B M, Fig14, ( Fig15) ( Fig15A) MKLP1 3 4 h (midzone), ( ) (midbody) MKL P1 esirna HeLa MKLP1, MKLP1 HeLa (midbody),, MKLP1 (cleavage furrow),,,, 70 % Π, Fig p EYFP2tubulin p ECFP2H2 B MKL P1Π (luciferase) MKL P1 esirnas HeLa ( Fig15B),

5 Fig 4 Effects of depletion of MKLP1 by esirna in HeLa cells HeLa cells were transfected with esirna as in Fig121 Two days post2transfection, cells were fixed and stained with anti2mklp1 antibodies (red), anti2 2tubulin antibody (blue) and DAPI (DNA, white) Fig 5 Time2lapse imaging analyses of HeLa cells treated with control ( luciferase)πmkl P1 esirna during mitosis and cytokinesis The movies were edited using Slidebook 310 software1 Representative images of the movies are shown ( EYFP2tubulin, red, pseudo2colored and ECFP2 H2B, green, pseudo2colored) 1 Arrowheads indicate cells analyzed and the number, indicate times in minutes 217 MKLP1 MKLP1 RNAi, MKL P1 esirna p EGFPC1 HeLa MKLP1 ; MKL P1, RNAi esirna p EGFPC12MKL P1 HeLa [11,12 ] MKLP1, EGFP2 MKL P1 esirna, MKLP1 (rescue) Fig1 6B,,p EGFPC1

6 4 :esirna MKLP1 559 MKL P1 esirna HeLa Π MKL P1 esirna HeLa, Π 70 %, p EGFPC12MKL P1,10 % 20 % (Fig 5A) Fig 6 Rescue of cytokinetic defects in MKL P1 esirna treated cells by ectopic expression of p EGFPC12MKL P1 (A) The percentage of polyploidy cells 1 Schematic histograms show the percentages of polyploidy in p EGFP or p EGFPC12MKL P1 untransfected cells ( EGFP negative) and p EGFPC1 or p EGFPC12MKL P1 transfected cells ( EGFP positive) 1 (B) The expression of the exogenous and endogenous MKLP1 determined by Western blotting 3 E1 coli RNase esirna, Yang [9 ] MKLP1 MKL P1 3 UTR esirna,, MKL P1 esirna : 3 UTR MKLP1,, PCR DNA DNA ; 3 UTR, esirna mrna MKLP1, HeLa MKLP1 esirna ; esirna 3, UTR, 3 UTR cdna, (rescue) RT2PCR Western, Π, MKL P1 esirna MKL P1 MKLP1 [13, 90 % ], p EGFPC12MKL P1 MKL P1 esirna EGFP2MKLP1, MKL P1, esirna, MKL P1 3 UTR esirna MKLP1 (, MKLP1 ), [14 ], MKL P1 esirna HeLa Π, EGFP2MKLP1 MKLP1 MKLP1 MKL P1 esirna,mklp1 MKL P1 esirna MKL P1 HeLa, FACS EGFP2MKLP1, MKLP1 MKLP1 HeLa, MKLP1,

7 MKLP1,,,, MKLP1,, ( References) 1 Vale R D1 The molecular motor toolbox for intracellular transport Cell, 2003, 112(4) : Vale R D, Reese T S, Sheetz M P Identification of a novel force2 generating protein, kinesin, involved in microtubuleity based motility Cell, 1985, 42 : Hildebrandt E R, Hoyt M A Mitotic motors in Saccharomyces cerevisiae Biochim Biophys Acta, 2000, 1496 : Goshima G, Vale R D The roles of microtubule2based motor proteins in mitosis : comprehensive RNAi analysis in the Drosophila S2 cell line J Cell Biol, 2003, 162 (6) : Blangy A, Lane H A, d Herin P, Harper M, Kress M, Nigg E A Phosphorylation by p34cdc2 regulates spindle association of human Eg5, a kinesin2related motor essential for bipolar spindle formation in vivo Cell, 1995, 83(7) : McEwen B F, Chan G K, Zubrowski B, Savoian M S, Sauer M T, Yen TJ CENP2E is essential for reliable bioriented spindle attachment, but chromosome alignment can be achieved via redundant mechanisms in mammalian cells Mol Biol Cell, 2001, 12 (9) : Levesque A A, Compton D A The chromokinesin Kid is necessary for chromosome arm orientation and oscillation, but not congression, on mitotic spindles J Cell Biol, 2001, 154 (6) : Neef R, Preisinger C, Sutcliffe J, Kopajtich R, Nigg E A, Mayer T U, Barr F A Phosphorylation of mitotic kinesin2like protein 2 by polo2like kinase 1 is required for cytokinesis J Cell Biol, (5) : Yang D, Buchholz F, Huang Z, Goga A, Chen C Y, Brodsky F M, Bishop J M Short RNA duplexes produced by hydrolysis with Escherichia coli RNase mediate effective RNA interference in mammalian cells Proc Natl Acad Sci USA, 2002, 99 (15) : Zhu C, Jiang W Cell cycle2dependent translocation of PRC1 on the spindle by Kif4 is essential for midzone formation and cytokinesis Natl Acad Sci USA, 2005, 102 (2) : Proc 11 Jackson A L, Bartz S R, Schelter J, Kobayashi S V, Burchard J, Mao M, Li B, Cavet G, Linsley P S Expression profiling reveals off2target gene regulation by RNAi Nat Biotechnol, 2003, 21 : Snove O Jr, Holen T Many commonly used sirnas risk off2target activity Biochem Biophys Res Commun, 2004, 319 : Matuliene J, Kuriyama R Role of the midbody matrix in cytokinesis : RNAi and genetic rescue analysis of the mammalian motor protein CHO1 Mol Biol Cell, 2004, 15(7) : Cao L G, Wang YL Signals from the spindle midzone are required for the stimulation of cytokinesis in cultured epithelial cells Mol Biol Cell, 1996, 7 :