( neural progeni2 tor cell), ,,,, , (neural crest) (radial glial cell) mrna [2 ]

Transcription

1 246, , 51 (3), Acta Physiologica Sinica 3 P (, ;, ) (nestin),, RA P19,, (neural precursor cell) BMP4, (NF160), ( neural progeni2 tor cell),, : ; P19 ; BMP4 ; : Q71,,,, (nestin), [1 ], 7175 d, mrna, 915 d, mrna 1015 d,, (neural crest) ( somite) 1515 d, mrna (telencephalon ventricular) (subventricular zone) (radial glial cell) (cerebellar primordium), (choroid plexus) mrna [2 ],,,,, [3,4 ],,, (No , ) 3 3

2 3 : P [5, ],, [6,7 ], P19,, 10-6 mol/ L (retinoic acid, RA),,, P19 [8 ] P19 RA, P19 ; RA, 4, [9, ] P19 RA, P19 ( PFA) RA D (poly2d2lysine) N 2 Sigma PVDF EDTA SDS 160 kd (neurofilament, NF160) Amersham [7 ] Superscript TM Taq DNA DMEM/ F12 MEM ( FBS) (normal goat serum, NGS) Proteinase K Trypsin2EDTA Fibronectin (BSA) GIBCO BRL dntp Boehringer Mannheim Corning (petri dish) Fisher FITC2 IgG Dianova FITC2 IgG Tago (acrylammide) N,N 2 (N,N 2methylene2bis2acrylamide,BIS) (sodium dodecy sulfate, SDS) Bio2Rad PCR DNA 112 P19 10 % FBS DMEM/ F12, % CO 2 [9 113 P19 ] 114 PCR P19 RA 4 d N 2 [10 2, 4, 6, 8 d, ] RNA, Super2 script TM, RNA 5 g : 5 : 5 GAATCAGATCGCTCAGATCC 3 ; 3 : 5 GCACGACAC2 CAGTAGAACTG 3 PCR : 12 ng/ l, 115 mmol/ L MgCl 2, 200 mol/ L dntp, 20 mmol/ L Tris2HCl (ph 814), 50 mmol/ L KCl, pmol/ l, Taq 0105 U/ l, 0137 kbq/ l 2 32 P2dATP : s, s, 72 1 min 28 PCR, 5 %,

3 248 51, X BMP4 : 5 : 5 TGCCGCAGCTTCTCTGAGCC 3 ; 3 : 5 GACTGCCTGAT2 CTCAGCGGC 3 : 64 ; 25 ; 115 RA P19, N 2 2, 4, 6, 8 d, 4 % 1 h, PBS, CMA( = 1 2 1) min PBS, 1 % BSA 015 % (normal goat serum, NGS) PBS 30 min, 115 h, kd PBS, FITC2 IgG FITC2 IgG, 30 min, PBS, [7, (western blot) ] P19, RT - PCR mrna RA P19 RA P19, mrna( 1, Lane 1), RA 4 d, ( 1, Lane 2), 4 ( 1, Lane 3, 4), ( 1, Lane 5, 6) (actin) PCR, mrna, actin ( ) 1 P19, mrna Fig. 1 RT2PCR results of nestin ex2 pression during RA induced P19 cell neuronal differentiation RNA samples were extracted from non2induced P19 cells (Lane 1), P19 cell aggregates in2 duced by RA for 4 d (Lane 2), P19 cell neu2 ronal differentiation for 2 d (Lane 3), 4 d (Lane 4), 6 d (Lane 5) and 8 d (Lane 6), respectively. 212 ( NF160) P19 (NF160), RA P19 2A NF160 Western blot, P19 ( 2A Lane 2, ), NF160 ; 2 ( 2A Lane 3, ), NF160 ; ( 2A Lane 4 7, ), NF160, NF160, 8,,,

4 3 : P NF160 ( 2B, ), NF160,, 213 BMP4 P19 RT2PCR, BMP4 P19, RA RA 4 d P19, BMP4 ( 3, Lane 1, 2) RA, N 2 2 d, BMP4 ( 3, Lane 3),, 6 ( 3, Lane 5) BMP4, ( 3, Lane 6) BMP4, RA P19 2 6,, 6,, BMP4, 3 BMP4 RA P19 Fig. 3 RT2PCR results of BMP4 ex2 pression during RA induced P19 cell neuronal differentiation RNA samples were extracted from non2induced P19 cells (Lane 1), P19 cell aggregates in2 duced by RA for 4 d (Lane 2), P19 cell neu2 ronal differentiation for 2 d (Lane 3), 4 d (Lane 4), 6 d (Lane 5) and 8 d (Lane 6), respectively. 214, P , RA P ( 1, Lane 4, 5, 6),,, RA P19, ( 4A, ) RA,,, P19 :,,,, ( 4B, ),,,, ( 4C, ),,, ( 4D, ),,,, ( 4E, )

5 250 51,, ( 4F, ), 3 311,, [11, Notch MASH ], [12 BMP4 ] [13, NF160 ],,, P19, 1 2A 3 RT2PCR Western blots, 5 5, P19, 4, RA P , RA 8 10 NF160 P19, BMP4 6 5 BMP4 NF160 RA P19 Fig. 5 Schematic diagram of the ex2 pression pattern of nestin, BMP4, NF160 during P19 neuron differentiation, RA P19, [14 4 ( 1, 5), MASH21 ],, BMP4 ( 3, 5) BMP4, BMP4,,, (desmin) (keratin) ( GFAP) ( neurofila2 ment, NF) [13 ],,,,, BMP4 NF160, RA P19 : RA, P19, 6, BMP4,

6 3 : P NF160, 6 4, 312, RA P19, 6 8,,,, RA P19 ( 1, 5), :, ;,,,,,, ( 4, ),,,,,,,,,, (NF),,,,, ;, P19,,,, [1 ] Lendahl U, Zimmerman LB, McKay RDG. CNS stem cells express a new class of intermediate filament protein. Cell, 1990, 60 : [2 ] Dahlstrand J, Lardelli M, Lendahl U. Nestin mrna expression correlates with the central nervous system pro2 genitor cell state in many, but not all, regions of developing central nervous system. Dev Brain Res, 1995, 84 : [3 ] Zerlin M, Levison SW, Goldman J E. Early patterns of migration, morphogenesis, and intermediate filament ex2 pression of subventricular zone cells in the postnatal rat forebrain. J Neurosci, 1995, 15 : [4 ] Frisen J, Johansson CB, Torok C, et al. Rapid, widspread, and longlasting induction of nestin contributes to the generation of glial scar tissue after CNS injury. J Cell Biol, 1995, 131 : [5 ] Gallo V, Armstrong RC. Developmental and growth factor2induced regulation of nestin in oligodendrocyte lineage cells. J Neurosci, 1995, 15 : [6 ] Yang J ( ), Bian W ( ), Jing NH ( ). Nestin mrna expression during the development of mouse central nervous system. Acta Physiol Sin ( ), 1997, 49 (6) : (in Chinese with Eng2 lish abstract). [7 ] Jing NH, Kitani H, Morio I, et al. Expression of intermediate filament nestin during mouse brain development. Chin J Physiol Sci, 1996, 12 : 1 9. [8 ] Bain G, Ray WJ, Yao M, et al. From embryonal carcinoma cells to neurons : the P19 pathway. BioEssays,

7 , 16 : [9 ] Sun H, Zhang X, Kitani H, et al. Neuronal induction of embryonic carcinoma cell and nestin expression. Chin J Physiol Sci, 1996, 12 : [10 ] Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning. 2 ed. New York : Cold Spring Harbor Laboratory Press, 1989, [11 ] Lewis J. Neurogenic genes and vertebrate neurogenesis. Curr Opin Neuro, 1996, 6 : [12 ] Tanabe Y, Jesell TM. Diversity and pattern in the developing spinal cord. Science, 1996, 274 : [13 ] Steinert PM, Roop DR. Molecular and cellular biology of intermediate filaments. Ann Rev Biochem, 1988, 57 : [14 ] Jonhsen J E, Zimmerman K, Saito T, et al. Induction and repression of mammalian achaete2scute homologue (MASH) gene expression during neuronal differentiation of P19 embryonal carcinoma cells. Development, 1992, 114 : NESTIN EXPRESSION D URING P19 NEURON DIFFERNTIATION 3 Acta Physiologica Sinica Jun. 1999, 51 (3), BIAN WEI, YANG J ING, TANG KE, J ING NAI2HE 3 3 ( Shanghai Institute of Biochemistry, Chinese Academy of Science; Shanghai Research Center of Life Sciences, Shanghai ) ABSTRACT Mouse nestin, an intermediate filament gene, is transiently expressed during the de2 velopment of the central nervous system. In order to find the clue of its function during neural development, we tried to find out the gene expression pattern during the neuronal differentiation of P19 EC cells induced RA. RT2PCR showed that nestin was transiently expressed during P19 neuron differentiation, with a peak at day 4 of this process. Howev2 er, BMP4, a neural precursor cell marker, was transiently expressed with its highest level at day 6, while NF160 kd a terminal differentiated neuronal marker, was increasingly ex2 pressed during the whole process. These results implied that nestin might play some roles during the process of neural progenitor cells differentiating into neural precursor cells. Moreover, immunostaining showed that nestin was located in the neurite and the growth cone of the P19 neuron, suggesting that nestin might be also involved in the process of the establishment of neural connection. Key words : nestin ; P19 neuron ; BMP4 ; neural filament 3 Supported by the National Natural Science Foundation of China (No , ) 3 3 To whom correspondence should be addressed.