Supplementary Figure 1

Transcription

1 Supplementary Figure 1 Covariate gender, age Exclusion drug (NSAID, Steroid): case and control gastric ulcer, gastric cancer: control GWAS (610,000 SNPs) [DU case] 1,043 [Non-DU control] 21,694 DU Case: Illumina HumanHap 610K Control: Illumina HumanHap 610K P_min < 5 x 10-5 Replication (101 SNPs /42 loci) [DU case] 5,992 [Non-DU control] 3,629 DU Case: Invader assay Control: Illumina HumanHap 550K Supplementary Figure 1 Study design.

2 Supplementary Figure 2 λ=1.014 Supplementary Figure 2 Quantile quantile plot of observed P values (black dots) for the association of all 480,277 SNPs. The P values were obtained by logistic regression analysis upon age and gender adjustment under additive model in 1,043 duodenal ulcer (DU) cases and 21,694 non-du controls. The genetic inflation factor λ (lambda = 1.014) suggested no or minimal inflation.

3 Supplementary Figure 3 A B Supplementary Figure 3 Enlarged regional association plot at rs and rs (A, B) Upper panel; P values of genotyped SNPs (circle) and imputed SNPs (cross) are plotted (as log 10 P value) against their physical position on chromosome 8 (A) and 9 (B) (NCBI Build 36). Estimated recombination rates from HapMap JPT shows the local LD structure. SNP s color indicates LD with rs (A) or rs (B) according to a scale from r 2 = 0 to r 2 = 1 based on pair-wise r 2 values from HapMap JPT. Lower panel; Gene annotations from the University of California Santa Cruz genome browser.

4 Supplementary Figure 4 A PSCA mrna (x10-2 ) B Lymph Node Peripheral blood Spleen Bone Marrow Thymus Testis Placenta Ovary Colon Small Intestine Duodenum Stomach Mammary Gland Prostate Thyroid Pancreas Liver Trachea Lung Bladder Kidney Aorta Skeletal Muscle Heart Pituitary Gland Spinal Cord Brain ABO mrna (x10-3 ) Lymph Node Peripheral blood Spleen Bone Marrow Thymus Testis Placenta Ovary Colon Small Intestine Duodenum Stomach Mammary Gland Prostate Thyroid Pancreas Liver Trachea Lung Bladder Kidney Aorta Skeletal Muscle Heart Pituitary Gland Spinal Cord Brain Supplementary Figure 4 Expression of PSCA and ABO genes in normal tissues. (A) Quantitative PCR analysis of PSCA expression in 27 normal tissues. ACTB was used for normalization of expression levels. (B) Quantitative PCR analysis of ABO expression in 27 normal tissues. ACTB was used for normalization of expression levels.

5 Supplementary Figure 5 pcdna3.1/l-psca EcoRI Kozak sequence gaatcc gccacc atg aag gct gtg ctg ctt gcc ctg ttg atg gca ggc ttg gcc ctg cag cca ggc tag ctcgag XhoI L-PSCA (123 a.a.) M K A V L L A L L Signal sequence M A G L A L Q P G pcdna3.1/s-psca EcoRI Kozak sequence XhoI gaatcc gccacc atg gca ggc ttg gcc ctg cag cca ggc tag ctcgag S-PSCA (114 a.a.) M A G L A L Q P G Supplementary Figure 5 Structure of pcdna3.1/l-psca and pcdna3.1/s-psca. Coding sequence of PSCA (123 a.a. for L-PSCA or 114 a.a. for S-PSCA) with consensus kozak sequence were subcloned into EcoR1/Xho1 site of pcdna3.1 vector.

6 Supplementary Figure 6 A pcdna3.1/l-psca B kda 20 Mock S-PSCA L-PSCA 15 pcdna3.1/s-psca PSCA b-actin C S- PSCA L- PSCA With permeabilization Without permeabilization kda DMSO MG132 DMSO MG PSCA b-actin Supplementary Figure 6 Effects of rs on subcellular localization and stability of PSCA protein. (A) MKN1 cells were transiently transfected with each plasmid. Subcellular localization of PSCA protein was evaluated with anti-psca antibody, either with or without permeabilization (0.2% Triton X-100). Scale bars, 20 mm. (B) Expression of PSCA protein in MKN1 cells after transfection with each expression plasmid. b- actin was used for normalization of expression levels. (C) After transfection with pcdna3.1/l-psca or pcdna3.1/s-psca vector, MKN1 cells were incubated with 10μM of MG132 for 10 h before harvesting. DMSO was used as control. b-actin was used for normalization of expression levels.

7 Supplementary Figure 7 Duodenal ulcer Cancer T lymphocyte activation Growth promotion HLA class I/II Antigen presentation GPI anchor glycosylation Proteasomal degradation C T 9 a.a. Supplementary Figure 7 Hypothetical model. The development of duodenal ulcer and gastric cancer would be regulated by PSCA variations through growth promoting effect of T allele and T cell activation by C allele.

8 Supplementary Table 1. The result of association analysis of duodenal ulcer in the screening stage SNP Chr Position Risk allele Additive Dominant Recessive P a OR a,b P a OR a,b P a OR a,b rs C 2.92 x x x x PSCA rs C 3.01 x x x x PSCA rs A 7.67 x x x x LOC rs T 8.54 x x x x PSCA rs T 1.31 x x x x ARC rs C 1.11 x x x x 10-8 PSCA rs C 1.40 x x x x 10-8 LY6K rs T 2.10 x x x x 10-8 ARC rs T 1.60 x x x x 10-8 ABO rs G 2.94 x x x x 10-8 LYNX1 rs G 7.90 x x x x 10-8 ARC rs C 7.42 x x x 10-8 ABO rs G 3.17 x x x 10-7 ABO rs G 2.57 x x x 10-7 ABO rs G 2.91 x x x 10-7 ABO rs A 4.24 x x x 10-7 ABO rs C x x 10-7 LOC rs A x x 10-7 LOC rs T x x 10-7 LOC rs G 5.40 x x x x 10-7 C8orf55 rs T 5.56 x x x x 10-7 LY6K rs G 5.82 x x x x 10-7 LY6K rs A 2.71 x x x x 10-7 LY6D rs C 3.06 x x x 10-6 THSD4 rs C 6.89 x x x 10-6 OR5BQ1P rs T x x 10-6 LOC rs G x x 10-6 LOC rs T x x 10-6 LOC rs G 1.18 x x x x 10-6 LY6D rs C x x 10-6 GOLIM4 rs G x x 10-6 GOLIM4 rs T 1.98 x x x 10-6 CYP1B1 rs C x x 10-6 LOC rs G 2.03 x x x 10-6 CYP1B1 rs A x x 10-6 GOLIM4 rs T 2.83 x x x x 10-6 SOX5P rs A 2.25 x x x 10-6 CYP1B1 rs C x x 10-6 SDR-O rs A x x 10-5 JAZF1 rs T 1.05 x x x x 10-5 ZNF521 rs G x x 10-5 GOLIM4 rs G 1.14 x x x 10-5 MGC51025 rs T x x 10-5 GOLIM4 rs C 1.99 x x x 10-5 ABO rs A x x 10-5 SDR-O rs T x x 10-5 SDR-O rs C 4.04 x x x x 10-5 ZBTB10 rs T 3.73 x x x 10-5 ATE1 rs C x x 10-5 EGFL11 rs A 4.13 x x x 10-5 ATE1 P _min Gene

9 rs T 4.13 x x x 10-5 ATE1 rs C x x 10-5 EGFL11 rs A 2.13 x x x 10-5 LOC rs A x x 10-5 LOC rs T 8.55 x x x 10-5 LOC rs C 1.83 x x x x 10-5 LOC rs T 7.14 x x x 10-5 SND1 rs A x x 10-5 LOC rs T 1.43 x x x 10-5 C20orf82 rs C x x 10-5 LOC rs G x x 10-5 WDFY3 rs T x x 10-5 SND1 rs G 2.67 x x x x 10-5 ARC rs C x x 10-5 LOC rs G 1.21 x x x x 10-5 COL4A2 rs G 2.77 x x x x 10-5 ARC rs T 2.86 x x x x 10-5 ARC rs A 2.94 x x x x 10-5 C10orf38 rs C 6.24 x x x x 10-5 PEX5L rs G 1.45 x x x 10-5 AF rs T x x 10-5 WDFY3 rs T x x 10-5 WDFY3 rs T x x 10-5 WDFY3 rs T x x 10-5 WDFY3 rs T 3.30 x x x x 10-5 ARC rs C 3.88 x x x 10-5 ABO rs G 1.78 x x x 10-5 LOC rs A 4.91 x x x 10-5 FLJ40298 rs C 6.52 x x x 10-5 TLE4 rs G 7.26 x x x 10-5 SND1 rs G 1.59 x x x 10-5 PRMT7 rs A 1.61 x x x 10-5 PRMT7 rs T 5.43 x x x 10-5 SMAD1 rs A 3.80 x x x x 10-5 FLJ46257 rs G 6.42 x x x 10-5 C5orf15 rs A 5.60 x x x 10-5 SMAD1 rs A 2.04 x x x x 10-5 NIPA1 rs C 4.05 x x x x 10-5 FLJ35379 rs C 1.14 x x x 10-5 RIMBP2 rs A 2.01 x x x 10-5 LOC rs G 3.36 x x x 10-5 PCM1 rs T 4.13 x x x x 10-5 LOC rs T 3.31 x x x 10-5 LOC rs T 6.46 x x x 10-5 ZNF521 rs T 4.29 x x x x 10-5 LOC rs C x x 10-5 DSCAM rs G x x 10-5 LOC rs G x x 10-5 GOLIM4 rs G 4.46 x x x x 10-5 MTDH rs G 4.69 x x x x 10-5 MLLT3 rs A 4.82 x x x x 10-5 BAI1 We analyzed 1,043 duodenal ulcer cases and 21,694 controls in the analysis. Chr.,chromosome; Postion in the NCBI Build a P values and ORs were adjusted for age and gender by logistic regression analysis under three genetic models. b OR, odds ratio was calculated by considering non-risk allele as a reference. P _min, minimum P value from three genetic models.

10 Supplementary Table 2. The result of association analysis of duodenal ulcer in the replication stage SNP Chr Position Gene Risk allele a Model b OR c P c rs LOC A Rec rs AF G Rec rs LOC C Add rs CYP1B1 T Dom rs FLJ40298 A Dom rs LOC T Add rs GOLIM4 C Rec rs PEX5L C Rec rs WDFY3 T Rec rs SMAD1 T Dom rs C5orf15 G Dom rs LOC A Rec rs JAZF1 A Rec rs LOC G Rec rs SND1 T Rec rs PCM1 G Dom rs LOC G Rec x 10-2 rs ZBTB10 C Rec x 10-2 rs d SOX5P T Rec rs MTDH G Add rs PSCA C Rec x rs MLLT3 G Add rs TLE4 C Dom rs ABO T Rec x 10-4 rs C10orf38 A Add rs ATE1 T Rec rs OR5BQ1P C Rec x 10-2 rs SDR-O C Rec rs LOC T Rec rs RIMBP2 C Rec rs FLJ35379 C Add x 10-2 rs COL4A2 G Rec rs NIPA1 A Rec rs THSD4 C Rec rs PRMT7 G Rec rs MGC51025 G Dom rs LOC T Add rs ZNF521 T Add rs LOC A Dom x 10-2 rs C20orf82 T Dom rs DSCAM C Rec rs FLJ46257 A Add x 10-2 We analyzed 5,992 duodenal ulcer cases and 3,629 controls in the analysis. Chr., chromosome; Postion in the NCBI Build a Risk alleles and b Genetic models which provided the minimum P-value in the screenig stage were shown. Non-risk allele was considered as a reference. Add; additive model. Dom; dominant model. Rec; Recessive model. c Odds ratio and P-values adjusted for age and gender by logistic regression analysis under the same genetic model in the screening stage. d Genetyping result of rs in 3,629 control samples were imputed by using a Hidden Markov model programmed in MACH62 and haplotype information from HapMap JPT samples.

11 Supplementary Table 3. Logistic regression analysis for risks of duodenal ulcer OR (95% C.I.) P rs ( ) < 2.00 x rs ( ) 3.49 x Gender 2.12 ( ) < 2.00 x Age 1.01 ( ) < 2.00 x Smoking 1.43 ( ) < 2.00 x p-values are derived from the Wald test. The following explanatory variables were included in the analysis: age (linear), gender (0 female, 1 male), smoking (0; never smoker, 1; smoker), rs (0; TT+CT, 1; CC), rs (0; CC+CT, 1; TT)

12 Supplementary Table 4. Association analyses of two susceptibility loci with Helicobacter pylori prevalence SNP Alelle H. pylori carrier H. pylori negative 1/2 a RAF RAF OR b (95% C.I.) rs C/T ( ) rs T/C ( ) We analyzed 284 H. pylori carriers and 509 H. pylori negative controls. All the subjects were negative for duodenal ulcer. a Allele 1: risk allele for DU, Allele 2; non risk allele for DU. RAF; Risk allele frequency. b P values and ORs were caliculated by logistic regression analysis controlling for age and sex as covariables under recessive model (11 vs 12+22). P b

13 Supplementary Table 5. Association of two SNPs with DU among H. pylori carriers and gastric cancer patients Alelle DU Case Control SNP Group 1/2 a P b OR b (95% C.I.) RAF RAF rs rs H. pylori carrier ( ) C/T Gastric cancer x ( ) H. pylori carrier ( ) T/C Gastric cancer ( ) We analyzed 37 H. pylori carriers with duodenal ulcer, 284 H. pylori carriers without duodenal ulcer, 78 gastric cancer patients with duodenal ulcer, and 1905 gastric cancer patients without duodenal ulcer. a Allele 1: risk allele, Allele 2; non risk allele. RAF; Risk allele frequency. b P values and ORs were caliculated by logistic regression analysis controlling for age and sex as covariates under recessive model (11 vs ).

14 Supplementary Table 6. Association analysis of two susceptible SNPs with duodenal ulcer using healthy controls SNP Alelle Case Control 1/2 a RAF RAF rs C/T x ( ) rs T/C ( ) We analyzed 7,068 duodenal ulcer cases and 1700 healthy controls. a Allele 1: risk allele for DU, Allele 2; non risk allele for DU. RAF; Risk allele frequency. OR; odds ratio. b P values were determined by Fisher's exact test (11 vs 12+22). P b OR (95% C.I.)

15 Supplementary Table 7. Comparison of allelic frequency of two SNPs between disaeas mix controls and healthy controls SNP Alelle Disease mix control Healthy Control 1/2 a RAF RAF rs C/T ( ) rs T/C ( ) We analyzed disease mix and 1700 healthy individuals as controls. a Allele 1: risk allele for DU, Allele 2; non risk allele for DU. RAF; Risk allele frequency. OR; odds ratio. b P values were determined by Fisher's exact test (11 vs 12+22). P b OR (95% C.I.)

16 Supplementary Table 8. The association of rs and rs with Gastric cancer rs rs OR (95% C.I.) a P a OR (95% C.I.) a CC CT TT RAF TT CT CC RAF Gastric cancer ( ) 6.79 x ( ) 0.22 intestinal ( ) 2.20 x ( ) 0.30 diffuse ( ) 7.38 x ( ) control We analyzed 2,346 gastric cancer cases (1,896 cases, intestinal type; 296 cases, diffuse type) and 16,882 controls in the analysis. The subjects with cancer were excluded from controls. RAF, risk allele (for DU) frequency; OR, odds ratio for C allele; CI, confidence interval. a P value and OR are caliculated in an additive model by logistic regression analysis by controlling for age and gender as covariables. P a

17 Supplementary Table 9. Estimation of ABO blood type by two tagging SNPs rs TT CT CC AA N.D. N.D. BB rs AC N.D. BO AB CC OO AO AA

18 Supplementary Table 10. The association between Duodenal ulcer and ABO blood type Blood type Case Duodenal ulcer Control A % % 38.65% B % % 22.15% ( ) O % % 29.25% 2.04 x ( ) AB % % 9.95% ( ) Total Japanese reference a P b OR (95% C.I.) a ref) The distribution of the Rh(D) blood types in Japan. Fujita Y et al. JHG b P values were determined by Fisher's exact test. Blood type A was used as a reference group. reference

19 Supplementary Table 11. The association between Gastric cancer and ABO blood type Blood type Gastric cancer intestinal diffuse Control Japanese Gastric intestinal diffuse n % n % n % n % reference a P b OR (95% C.I.) P b OR (95% C.I.) P b OR (95% C.I.) A % % % % 38.65% reference reference reference B % % % % 22.15% ( ) ( ) ( ) O % % % % 29.25% ( ) ( ) ( ) AB % % % % 9.95% ( ) ( ) ( ) Total a ref) The distribution of the Rh(D) blood types in Japan. Fujita Y et al. JHG b P values were determined by Fisher's exact test. Blood type A was used as a reference group.

20 Supplementary Table 12. Association of variations on candidate genes with duodenal ulcer in the screening stage relative a b SNP Gene Chr Position P_ min model OR (95% C.I.) loc rs IL dom 1.04 ( ) rs IL rec 1.05 ( ) rs IL rec 1.08 ( ) rs IL rec 1.16 ( ) rs IL add 1.02 ( ) rs IL dom 2.23 ( ) rs LTA add 1.07 ( ) rs LTA rec 1.07 ( ) rs LTA dom 1.11 ( ) rs LTA add 1.09 ( ) rs LTA add 1.19 ( ) rs LTA dom 1.11 ( ) rs TNF add 1.05 ( ) rs TNF dom 1.12 ( ) rs VEGFA add 1.03 ( ) rs VEGFA add 1.03 ( ) rs VEGFA add 1.11 ( ) rs VEGFA rec 1.04 ( ) rs VEGFA dom 1.01 ( ) rs IL add 1.17 ( ) rs IL dom 1.10 ( ) rs PTGS1/COX add 1.24 ( ) rs PTGS1/COX add 1.17 ( ) rs PTGS1/COX dom 1.30 ( ) rs PTGS1/COX add 1.07 ( ) rs PTGS1/COX rec 1.11 ( ) rs PTGS1/COX rec 1.33 ( ) We analyzed 1,043 duodenal ulcer cases and 21,694 controls in the analysis. Chr.,chromosome; Postion in the NCBI Build P values and ORs were adjusted for age and gender by logistic regression analysis under three genetic models. a P_min, minimum P value from three genetic models. b OR, odds ratio was calculated by considering non-risk allele as a reference.

21 Supplementary Table 13. Allelic frequency of rs and rs in Hapmap populations a Hapmap population Country PSCA rs ABO rs Population origin collected n CC b CT TT C T n TT b CT CC T C ASW (A) USA African CEU (C) USA European CHB (H) China Asian CHD (D) USA Asian GIH (G) USA Asian JPT (J) Japan Asian LWK (L) Kenya African MEX (M) USA Central American MKK (K) Kenya African TSI (T) Italy European YRI (Y) Nigeria African a Hapmap 3 database: b CC at rs and TT at rs are risk genotype for duodenal ulcer in Japanse population

22 Supplememtary Table 14. Sequence of primers Cloning Forward Reverse L-PSCA AAAGAATTCGCCACCATGAAGGCTGTGCTG TTTCTCGAGCTAGAGCTGGCCGGGTCCCC S-PSCA AAAGAATTCGCCACCATGGCAGGCTTGGCCCTG TTTCTCGAGCTAGAGCTGGCCGGGTCCCC Real time PCR Forward Reverse PSCA CTGCTGTGCTACTCCTGCAA TTGCTGATGACGGTCAGG ABO AACTGTGTTTGCCATCAAGAAAT CCCACCATGAAGTGCTTCTC ACTB CCCTGGAGAAGAGCTACGAG TGAAGGTAGTTTCGTGGATGC

23 Supplementary Notes Sample collections Biobank Japan The BioBank Japan project has been established in 2003 aiming at collection of DNA, serum, and clinical information of patients for the establishment of personalized medicine. The subjects were recruited from 66 medical institutes in Japan, including the Fukujuji Hospital, Iizuka Hospital, Juntendo University, Hospital Iwate Medical University School of Medicine, National Hospital Organization Osaka National Hospital, Nihon University, Nippon Medical School, Shiga University of Medical Science, the Cancer Institute Hospital of the Japanese Foundation for Cancer Research, Tokushukai Hospital and Tokyo Metropolitan Geriatric Hospital. We obtained DNAs of 7,035 subjects with duodenal ulcer from Biobank Japan. Clinical information of each patient including drug history was obtained from clinical record of each participating hospital. A total of 25,323 duodenal ulcer-negative controls were also obtained from Biobank Japan or healthy volunteers from the Midosuji Rotary Club, Osaka, Japan. Controls for GWAS contain the subjects with colon cancer, breast cancer, prostate cancer, lung cancer, pancreatic cancer, liver cancer, diabetes, myocardial infarction, brain infarction, arteriosclerosis obliterans, atrial fibrillation, cholangiocarcinoma, drug eruption, liver cirrhosis, amytrophic lateral sclerosis. Controls for the replication analysis contained healthy volunteers, and patients with cervical cancer, chronic hepatitis B, chronic hepatitis C, esophageal cancer, hematological cancer, ovarian cancer, pulmonary tubeculosis, keroidosis, endometriosis. Controls for gastric cancer contain the subjects with diabetes, myocardial infarction, brain infarction, arteriosclerosis obliterans, atrial fibrillation, drug eruption, liver cirrhosis, amytrophic lateral sclerosis.

24 Aichi cancer center A total of 37 individuals with H. pylori positive duodenal ulcer or 793 healthy controls were randomly selected from non-cancer outpatient visitors to Aichi Cancer Center Hospital (ACCH), Nagoya, Japan, between January 2001 and November These subjects were enrolled at first visit in the Hospital-based Epidemiological Research Program II at ACCH (HERPACC-II). Briefly, all first-visit outpatients at ACCH ages 20 to 79 years are asked to fill out a self-administered questionnaire regarding their lifestyle 1 year prior to visit. All data are loaded into the HERPACC database, which is periodically synchronized with the hospital cancer registry system to update the data on cancer incidence. Our previous study showed that the lifestyle patterns of firstvisit outpatients at ACCH corresponded with those of individuals randomly selected from Nagoya s general population, confirming external validity for the study. H.pylori infection status was confirmed by plasma IgG levels with a commercially available direct ELISA kit (Eiken Kagaku). Positivity for H.pylori infection was defined as an anti- H.pylori IgG antibody level greater than 10 U/mL in serum.