Effect of 17β-estradiol on the migration ability of human osteosarcoma U2OS cells

Size: px
Start display at page:

Download "Effect of 17β-estradiol on the migration ability of human osteosarcoma U2OS cells"

Transcription

1 Original Article Effect of 17β-estradiol on the migration ability of human osteosarcoma U2OS cells Zhengming Yang 1, Minfei Yang 2, Huimin Tao 1, Bin Liu 1, Libin Jin 1 1 Department of Orthopedics, 2 Department of Emergency, The Second Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou 39, China Contributions: (I) Conception and design: H Tao; (II) Administrative support: M Yang; (III) Provision of study materials or patients: B Liu; (IV) Collection and assembly of data: L Jin; (V) Data analysis and interpretation: Z Yang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. Correspondence to: Huimin Tao. Department of Orthopedics, The Second Affiliated Hospital of Zhejiang University School of Medicine, Hangzhou 39, China @zju.edu.cn. Background: To investigate the effect of 17β-estradiol on the migration ability of human osteosarcoma U2OS cells. Methods: Six concentrations of 17β-estradiol were tested in the U2OS cells, and the minimum concentration that could significantly affect the cells migration ability was determined by CCK-8 growth assay and cell scratch test. Furthermore, five concentrations of 17β-estradiol were used to detect the cells proliferation and migration ability by CCK-8 growth test, cell scratch test, transwell invasion assay, and crystal violet staining. Results: Cell viability decreased with increasing concentrations of 17β-estradiol at 24 h, and also exhibited significant changes at the treatment concentration of 1/25 in the CCK-8 test. The cell scratch test and crystal violet staining showed that 17β-estradiol () can significantly inhibit the migration ability of U2OS cells; the transwell invasion assay showed that with increasing concentrations of 17β-estradiol, the number of invading cells began to decrease significantly at the concentration of 1/25. Conclusions: 17β-estradiol can inhibit the migration of U2OS cells, starting at a concentration of, and in a concentration-dependent manner. Keywords: Estrogen; migration; osteosarcoma Submitted Mar 28, 218. Accepted for publication Sep 6, 218. doi: /tcr View this article at: Introduction Osteosarcoma is the most common bone malignancy in children and adolescents. Moreover, 74% of patients with pulmonary metastasis exhibit poor response to chemotherapy and poor prognosis (1). Therefore, it is vital to explore new treatment options to improve the prognosis of osteosarcoma patients with lung metastasis. Osteosarcoma is a disease exhibiting hyperactivity and abnormal proliferation of the osteo blasts and occurs in children and adults between ages 1 and 2 years old, during which period sex hormones are the most active, suggesting that this disease could be related to the in vivo estrogen levels and the abnormal expression of related receptors. Currently, molecular mechanisms of the effect of estrogen and estrogen receptors on tumor metastasis are mainly reported in breast cancer. According to previous studies, estrogen plays a dual role in the occurrence and development of breast cancer; it promotes the growth of breast cancer cells at low concentrations but its long-term deficiency mediates apoptosis of breast cancer cells (2). Studies have reported that through interaction with ERα-Sp1, estradiol (E2) can increase the expression of integrinα5, thereby reducing cell viability and invasiveness (3).

2 1222 Yang et al. Impact of 17β-estradiol on cell migration ability Similarly, in special cases, E2 can activate the adenosine 5'-monophosphate (AMP)-activated protein kinase (AMPK) pathway and c-jun N-terminal kinase (JNK) pathway or inhibit the nuclear factor (NF-kB) pathway, thus regulating the proliferation and invasion of tumor cells (4,5). Certain studies have also confirmed that the occurrence and development of osteosarcoma is closely related to estrogen and ER subtypes. There have been other reports on estrogen promoting the growth of osteosarcoma cells (6-9); it has been recently found that high concentrations of estrogen can inhibit the proliferation of osteosarcoma cells (1). However, there is no research on its effect on the migration ability of osteosarcoma cells. Estrogen and its receptors are closely related to the growth of osteosarcoma cells (11,12). Therefore, investigating the mechanisms of estrogen, through estrogen receptors, in regulating the growth and metastasis of osteosarcoma cells is of great significance, and this can lay the basis for endocrine therapies of osteosarcoma. We investigated the effect of high-concentration 17β-estradiol on the migration ability of U2OS cells, hoping to unveil the effect of different concentrations of estrogen on the migration ability of osteosarcoma cells and lay a theoretical foundation for the treatment of metastatic osteosarcoma. Methods Growth test (CCK-8) The cell counting kit-8 (CCK-8) test was conducted to show surviving cells is widely used in the determination of the activity bioactive factors, antitumor drug screening, cell proliferation test, cytotoxicity test and drug sensitivity test (13). U2OS cells (ATCC cell library, purchased from Tongpaibio, Shanghai, China) at a good growth stage were plated at a density of cells per well in 96-well plates. 17β-estradiol [Cayman (No.-28-2) was added at six concentrations:, 1 12, 1 1, 1 8, 1 6, 1 4 M]. After incubation for 72 h at 37 and 5% CO 2, the plate was stained with CCK-8 and absorbance was measured at λ =4 nm. Meanwhile, the cell proliferation rate of each group was measured according to the following equation: cell proliferation rate (%) = (absorbance of experiment group absorbance of blank group)/(absorbance of control group absorbance of blank group) %. Based on results from the above experiment, five different concentrations of 17β-estradiol were further established together with one blank control group (solvent control):, 1/ , 1/25 1 1, 1/5 1 1, and. Absorbance values were determined by the same method so as to calculate the cell proliferation in each group. Cell scratch test Cells were treated with different concentrations of 17β-estradiol:, 1/ , 1/25 1 1, 1/5 1 1,. A line crossing the well behind the 6-well plates was drawn and μl of the cell suspension was cultured in 6-well plates. Next day, another line perpendicular to the line in the wells was drawn. The cells were washed with phosphate-buffered saline (PBS) thrice, the medium was changed, and cells were cultured in an incubator at 37 and 5% CO 2. Samples were prepared for observation at and 24 h. According to the above results, five different concentrations of 17β-estradiol were further established together with one blank control group (solvent control):, 1/ , 1/25 1 1, 1/5 1 1, and. The cells were sampled and photographed at and 24hby the same method. Transwell invasion assay Cells were treated with different concentrations of 17β-estradiol:, 1/ , 1/25 1 1, 1/5 1 1,. Eighty microliters of diluted Matrigel was added in the Transwell room (4 µg/µl), and Matrigel gel was formed at 37 for 3 min; 2 µl cells/ml suspension was added in transwell (corning). After incubation for 24 h, the medium was discarded, eliminating the layer of cells that did not cross the membrane. Cells were washed with PBS twice, fixed with methanol for 1 min and stained with.1% crystal violet. The cells were dehydrated with.1 ml 33% acetic acid, and absorbance values were measured at 57 nm, which could reflect the number of cells. Morphological observation Cells were treated with different concentrations of 17β-estradiol:, 1/ , 1/25 1 1, 1/5 1 1,. The supernatant was discarded after the treatment period, and cells washed with PBS twice. Next, the cells were fixed with 4% paraformaldehyde at room temperature for 2 min, and washed with PBS three times. Crystal violet staining was performed at room temperature for 3 5 min followed by removal of the supernatant and the cells were then washed with PBS twice.

3 Translational Cancer Research, Vol 7, No 5 October M 1 12 M 1 8 M 1 6 M 1 4 M M 1/125 1/25 1/5 h 12 h 24 h 48 h Time 36 h 48 h Time Figure 1 Comparison of U2OS cell survival rates under different concentrations of 17β-estradiol at different time points. Figure 3 Comparison of U2OS cell survival rates under different concentrations of 17β-estradiol at different time points h 1 24 h NS * ** ** *** NS * ** *** M 1 12 M 1 8 M 1 6 M 1 4 M Concentrations Figure 2 Comparison of U2OS cell survival rates under different concentrations of 17β-estradiol at 24 h. *P<.5, **P<.1, ***P<.1 vs. M. NS, no significance. M 1/125 1/25 1/5 Concentrations Figure 4 Comparison of U2OS cell survival rates under different concentrations of 17β-estradiol at 24 h. *P<.5, **P<.1, ***P<.1 vs. M. NS, no significance. Statistical analysis All the data were analyzed for normality and those that were normally distributed were subjected to an independent sample t-test, with P<.5 considered to indicate statistically significant differences. All statistical analyses were performed using Prism5. Results Growth detection (CCK-8) It can be seen from Figures 1,2 that with increase in time, the survival rate of the cells exhibited an initial increasing trend and stabilized or slightly decreased after a period of 24 h at a concentration. The results (Figures 3,4) showed that under the same concentration of, the survival rate of the cells exhibited a similar trend in a concentrationdependent manner. At 24 h, the cell viability decreased with the increase in 17β-estradiol concentration, and exhibited significant changes at 1/25 (P<.5). Cell scratch test It can be seen from Figures 5,6 that compared to that at h, the cell migration distance at 24 h decreased gradually with the increase in17β-estradiol concentration. It can be seen from Figures 7,8 that compared to that at h, the cell migration distance at 24 h decreased gradually

4 1224 Yang et al. Impact of 17β-estradiol on cell migration ability M 1 12 M 1/124A 1 8 M 1/25A 1 6 M 1 4 M 1/5A Figure 5 Comparison of U2OS cell migration distance at and 24 h under different concentrations of 17β-estradiol ( 2). A 1.3 M 1 12 M 1 8 M 1 6 M 1 4 M Figure 7 Comparison of U2OS cell migration distance at and 24 h under different concentrations of 17β-estradiol ( 2). Relative migration distance.65. Relative migration distance / / / Figure 6 The relative migration distance of streak plate results with different concentrations of 17β-estradiolat and 24 h before incubation. *P<.5, **P<.1 vs. h.. Figure 8 The relative migration distance of streak plate results with different concentrations of 17β-estradiol at and 24 h after incubation. **P<.1 vs. h.

5 Translational Cancer Research, Vol 7, No 5 October M 1/125 M 1/ M 1/25 1/5 1/25 1/5 1-1 M Figure 11 Morphological observation (crystal violet staining, 2). Figure 9 Microscopic results of cell invasion (crystal violet staining, 2). 2 NS Invasion cell number 2 * ** 1 *** 1/125 1/25 1/5 1 17β-estradiol E2 ( ) Figure 1 Statistics of invasive cells after treated with different concentrations of 17β-estradiol. *P<.5, **P<.1, ***P<.1 vs. M. NS, no significance. with 17β-estradiol (, 1/ , 1/25 1 1, 1/5 1 1, and ), the number of invasive cells significantly decreased with the increase in 17β-estradiol concentration, starting from the concentration of 1/25, indicating that 17β-estradiol can inhibit U2OS cell invasion, and this inhibition effect was positively correlated with its concentration. Morphological observation As can be seen from Figure 11, after treatment with 17β-estradiol (, 1/ , 1/25 1 1, 1/5 1 1, and ), the number of spindle cells decreased with increase in 17β-estradiol concentration; the changes at the concentration of 1/ to 1/5 were not conspicuous. The results showed that 17β-estradiol can inhibit the EMT transformation of U2OS cells, decreasing the number of spindle-shaped cells while increasing the number of round cells. Discussion with the increase in 17β-estradiol concentration; the changes at the concentration of 1/ to 17βestradiol were not obvious. Transwell invasion assay As can be seen from Figures 9,1 ( 2), after treatment Osteosarcoma is the most common primary bone malignancy in children and adolescents, and pulmonary metastasis of the tumors is associated with poor prognosis. Chemotherapy is the most important critical method to control lung metastasis, and high-dose methotrexate, doxorubicin, cisplatin, and ifosfamide are considered the most effective chemotherapy drug combination for

6 1226 Yang et al. Impact of 17β-estradiol on cell migration ability the treatment of osteosarcoma (14). However, there exist many side effects of chemotherapy, such as bone marrow suppression, gastrointestinal reactions, and liver and kidney dysfunction. These have become important factors that can affect treatment processes and treatment doses (15). Particularly, 74% of patients with lung metastasis respond poorly to chemotherapy, but enhanced chemotherapy is more likely to induce side effects, and even threaten the lives of patients (1). At present, treatment protocols targeting patients with pulmonary metastasis of osteosarcoma have been positively explored, such as monoclonal antibody immunotherapy of tumorassociated antigens (16) or anti-angiogenesis therapy (17), but none have achieved satisfactory results. Therefore, exploring new treatment options to improve the prognosis of patients with lung metastasis of osteosarcoma has become urgent. Since osteosarcoma is a disease with hyperactivity and abnormal proliferation of osteoblasts, which affects age groups of 1 2 years, and this period is also the period when sex hormones are in the most active state, suggesting that this disease is related to the in vivo estrogen level and abnormal expression of corresponding receptors. Currently, the molecular mechanisms of the impact of estrogen and estrogen receptors on tumor metastasis are mainly reported in breast cancer, and according to previous studies, estrogen plays a dual role in the occurrence and development of breast cancer, wherein it promotes the growth of breast cancer cells at low concentrations but its long-term deficiency mediates apoptosis of breast cancer cells (2). Endocrine therapy for osteosarcoma is worthy of further studies and discussions. There have been many reports on the promotive effects of estrogen toward the growth of osteosarcoma cells (6-9), and it has been reported recently that high-concentration estrogen can inhibit the proliferation osteosarcoma cells (1). However, no related research has been focused on the migration ability of osteosarcoma cells. This study explored the impact of high concentrations of estrogen on the migration ability of osteosarcoma U2OS cells. It can be seen from the results of this study that cell survival was decreased with increase in 17β-estradiol concentration at 24 h, and exhibited significant changes at 1/25 (P<.5). The results of cell scratch test and crystal violet staining also showed that 17β-estradiol () can significantly inhibited the migration ability of U2OS cells. The transwell test proved that with increase in 17β-estradiol concentration, the number of invasive cells began to decrease at 1/25, indicating that 17β-estradiol has a significant inhibitory effect on the migration of U2OS cells, and the degree of inhibition was positively correlated with its concentration. In short, high concentrations of 17β-estradiol can significantly inhibit the migration ability of U2OS cells, the concentration of can significantly inhibit this ability, and this concentration is the lowest for inhibiting the proliferation of U2OS cells. This shows that the inhibitory ability of estrogen toward the migration of osteosarcoma cells is through inhibiting the migration rather than the proliferation of U2OS cells. Furthermore, the inhibition was positively correlated with the concentration of 17β-estradiol. This study has laid the foundation for further exploring estrogen receptor-mediated migration ability of osteosarcoma cells. Currently it has been found that the occurrence and development of osteosarcoma is closely related to estrogen and its ER subtypes. Solakidi et al. (18) reported that ERα is mainly located in the nuclei of osteosarcoma U2OS cells, but ERβ is abundantly expressed in the mitochondria, and its actions are related to the receptors. Dohi et al. (19) found that in MG-63 cells, ERβ accounts for the main part. Monroe et al. (2) reported that the ratio of ERα and ERβ in human osteosarcoma U2OS cells is 1:4. By in vitro experiments of osteosarcoma U2OS cell lines, estradiol-mediated antiosteoblast apoptosis effects are mainly mediated by ERα and ERβ (21). Our study found that high concentrations of estrogen can inhibit the migration ability of osteosarcoma cells, so it can be speculated that estrogen is also most likely to exhibit its effects through estrogen receptors. The roles of classic estrogen receptor pathways (ERα and ERβ) are the worthiest of investigation. In future, we will further research the roles of estrogen receptors in the inhibitory effects of high concentrations of estrogen toward the migration ability of osteosarcoma cells. Conclusions In summary, high concentrations of 17β-estradiol can inhibit the migration ability of osteosarcoma U2OS cells in a concentration-dependent manner beginning from. We will further explore the related mechanisms and relationships of estrogen and the expressions of corresponding receptors with the migration ability of osteosarcoma cells.

7 Translational Cancer Research, Vol 7, No 5 October Acknowledgements None. Footnote Conflicts of Interest: The authors have no conflicts of interest to declare. References 1. Lewis VO, Raymond K, Mirza AN, et al. Outcome of postradiation osteosarcoma does not correlate with chemotherapy response. Clin Orthop Relat Res 26;4: Lipovka Y, Konhilas JP. The complex nature of estrogen signaling in breast cancer: enemy or ally? Biosci Rep 216;36:e Sisci D, Middea E, Morelli C, et al. 17β-Estradiol enhances α5 integrin subunit gene expression through ERα-Sp1 interaction and reduces cell motility and invasion of ERαpositive breast cancer cells. Breast Cancer Res Treat 21;124: Chen H, Wang JP, Santen RJ, et al. Adenosine monophosphate activated protein kinase (AMPK), a mediator of estradiol-induced apoptosis in longterm estrogen deprived breast cancer cells. Apoptosis 215;2: Lewis-Wambi JS, Jordan VC. Estrogen regulation of apoptosis: how can one hormone stimulate and inhibit? Breast Cancer Res 29;11: Walker MJ, Chaudhuri PK, Beattie CW, et al. Steroid receptors in malignant skeletal tumors. Cancer 198;45: Stedman KE, Moore GE, Morgan RT. Estrogen receptor proteins in diverse human tumors. Arch Surg 198;115: Rajabalian S, Hajializadeh Z, Pooraboli I, et al. Establishment characterization and drug sensitivity of a new Ewing sarcoma cell line. J Pediatr Hematol Oncol 21;32:e Saraiva PP, Teixeira SS, Conde SJ, et al. The importance of hormone receptor analysis in osteosarcoma cells growth submitted to treatment with estrogen in association with thyroid hormone. Cell Biochem Funct 28;26: Fang D, Yang H, Lin J, et al. 17β-eEstradiol regulates cell proliferation, colony formation, migration, invasion and promotes apoptosis by upregulating MiR-9 and thus degrades MALAT-1 in osteosarcoma cell MG-63 in an estrogen receptor independent manner. Biochem Biophys Res Commun 215;457: Chen FP, Hsu T, Hu CH, et al. Expression of estrogen receptors alfa and beta mrna and alkaline phosphatase in the differentiation of osteoblasts from elderly posmenopausal women comparison with osteoblasts from osteosarcoma cell lines. Taiwanese J Obstet Gynecol 26;45: Sayeed A, Konduri SD, Liu W, et al. Estrogen receptor A inhibits p53- mediated transcriptional repression Implications for the regulation of apoptosis. Cancer Res 27;67: Tominaga H, Ishiyama M, Ohseto F, et al. A water-soluble tetrazolium salt useful for colorimetric cell viability assay. Anal Commun 1999;36: Kalifa C, Laurence B, Le Deley MC. Neoadjuvant treatment in osteosarcomas. Bull Cancer 26;93: Bruland OS, Pihl A. On the current management of osteosarcoma. A critical evaluation and a proposal for a modified treatment strategy. Eur J Cancer 1997;33: Mori K, Rédini F, Gouin F, et al. Osteosarcoma: current status of immunotherapy and future trends (Review). Oncol Rep 26;15: Quan GM, Choong PF. Anti-angiogenic therapy for osteosarcoma. Cancer Metastasis Rev 26;25: Solakidi S, Psarra AM, Sekeris CE. Differential subcellular distribution of estrogen receptor isoforms: localization of ERalpha in the nucleoli and ERbeta in the mitochondria of human osteosarcoma SaOS-2 and hepatocarcinoma HepG2 cell lines. Biochim Biophys Acta 25;1745: Dohi O, Hatori M, Suzuki T, et al. Sex steroid receptors and hormone induced cell proliferation in human osteosarcoma. Cancer Sci 28;99: Monroe DG, Secreto FJ, Subramaniam M, et al. Estrogen receptor alpha and beta heterodimers exert unique effects on estrogen and tamoxifen dependent gene expression in human U2OS osteosarcoma cells. Mol Endocrinol 25;19: Kallio A, Guo T, Lamminen E, et al. Estrogen and the selective estrogen receptor modulator protection against cell death in estrogen receptor alpha and beta expressing U2OS cells. Mol Cell Endocrinol 28;289: Cite this article as: Yang Z, Yang M, Tao H, Liu B, Jin L. Effect of 17β-estradiol on the migration ability of human osteosarcoma U2OS cells. Transl Cancer Res 218;7(5): doi: /tcr

Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients

Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients 1568 Correlation between estrogen receptor β expression and the curative effect of endocrine therapy in breast cancer patients LIYING GUO 1, YU ZHANG 2, WEI ZHANG 3 and DILIMINA YILAMU 1 1 Department of

More information

Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma

Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma Characterization and significance of MUC1 and c-myc expression in elderly patients with papillary thyroid carcinoma Y.-J. Hu 1, X.-Y. Luo 2, Y. Yang 3, C.-Y. Chen 1, Z.-Y. Zhang 4 and X. Guo 1 1 Department

More information

TRACP & ALP double-stain Kit

TRACP & ALP double-stain Kit Table of Content I. Description... 2 II. Introduction... 2 III. Principles... 2 IV. Kit components... 3 V. Storage... 3 VI. Preparation of reagents... 3 VII. Methods... 4-7 Cell fixation... 4 Activity

More information

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016)

Advances in Computer Science Research, volume 59 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) 7th International Conference on Education, Management, Computer and Medicine (EMCM 2016) Expression of Beta-Adrenergic Receptor in Glioma LN229 Cells and Its Effect on Cell Proliferation Ping Wang1, Qingluan

More information

Effects of estradiol and progesterone on the growth of HeLa cervical cancer cells

Effects of estradiol and progesterone on the growth of HeLa cervical cancer cells European Review for Medical harmacological Sciences 2017; 21: 3959-3965 Effects of estradiol and progesterone on the growth of HeLa cervical cancer cells Y. LIU 1, L.-B. TIAN 2, H.-Y. YANG 1, H.-P. ZHANG

More information

Inhibition of cisplatin-resistant tumor cells on activated CD4+ T cells in ovarian cancer and its mechanism

Inhibition of cisplatin-resistant tumor cells on activated CD4+ T cells in ovarian cancer and its mechanism Pharmaceutical Inhibition of cisplatin-resistant tumor cells on activated CD4+ T cells in ovarian cancer and its mechanism Objective: To investigate the inhibition of cisplatin-resistant tumor cells on

More information

Cancer cells in vitro

Cancer cells in vitro Supplementary Figure S1 Cancer cells in vitro Pretreatment with Control IgG (18h) Pretreatment with anti-u-par (18h) Acid Wash/Pretreatment with Control IgG (18h) Acid Wash/Pretreatment with anti-u-par

More information

Research on the inhibitory effect of metformin on human oral squamous cell carcinoma SCC-4 and CAL-27 cells and the relevant molecular mechanism.

Research on the inhibitory effect of metformin on human oral squamous cell carcinoma SCC-4 and CAL-27 cells and the relevant molecular mechanism. Biomedical Research 2017; 28 (14): 6350-6354 ISSN 0970-938X www.biomedres.info Research on the inhibitory effect of metformin on human oral squamous cell carcinoma SCC-4 and CAL-27 cells and the relevant

More information

Crosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea

Crosstalk between Adiponectin and IGF-IR in breast cancer. Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Crosstalk between Adiponectin and IGF-IR in breast cancer Prof. Young Jin Suh Department of Surgery The Catholic University of Korea Obesity Chronic, multifactorial disorder Hypertrophy and hyperplasia

More information

Effects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells

Effects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells Effects of metallothionein-3 and metallothionein-1e gene transfection on proliferation, cell cycle, and apoptosis of esophageal cancer cells Z.Q. Tian 1, Y.Z. Xu 1, Y.F. Zhang 1, G.F. Ma 1, M. He 1 and

More information

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG)

In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) In vitro scratch assay: method for analysis of cell migration in vitro labeled fluorodeoxyglucose (FDG) 1 Dr Saeb Aliwaini 13/11/2015 Migration in vivo Primary tumors are responsible for only about 10%

More information

A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified

A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Cell culture and animal model A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum at 37 C in humidified atmosphere containing

More information

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer

An epithelial-to-mesenchymal transition-inducing potential of. granulocyte macrophage colony-stimulating factor in colon. cancer An epithelial-to-mesenchymal transition-inducing potential of granulocyte macrophage colony-stimulating factor in colon cancer Yaqiong Chen, Zhi Zhao, Yu Chen, Zhonglin Lv, Xin Ding, Renxi Wang, He Xiao,

More information

Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan

Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao

More information

Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM. Real-time automated measurements of cell motility inside your incubator

Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM. Real-time automated measurements of cell motility inside your incubator Cell Migration and Invasion Assays INCUCYTE LIVE-CELL ANALYSIS SYSTEM Real-time automated measurements of cell motility inside your incubator See the whole story Real-time cell motility visualization and

More information

Nuclear Receptors. Estrogen and Thyroid Hormone Receptors and their Interaction. Estrogen Hormone Receptor.

Nuclear Receptors. Estrogen and Thyroid Hormone Receptors and their Interaction. Estrogen Hormone Receptor. SZENT ISTVÁN UNIVERSITY FACULTY OF VETERINARY MEDICINE Nuclear Receptors Estrogen and Thyroid Hormone Receptors and their Interaction Lior Kerner Budapest, 2012 What are Nuclear Receptors? o Proteins located

More information

Clinical significance of CD44 expression in children with hepatoblastoma

Clinical significance of CD44 expression in children with hepatoblastoma Clinical significance of CD44 expression in children with hepatoblastoma H.-Y. Cai 1 *, B. Yu 1 *, Z.-C. Feng 2, X. Qi 1 and X.-J. Wei 1 1 Department of General Surgery, General Hospital of Beijing Military

More information

Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer

Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer Correlation between expression and significance of δ-catenin, CD31, and VEGF of non-small cell lung cancer X.L. Liu 1, L.D. Liu 2, S.G. Zhang 1, S.D. Dai 3, W.Y. Li 1 and L. Zhang 1 1 Thoracic Surgery,

More information

CytoSelect Tumor- Endothelium Adhesion Assay

CytoSelect Tumor- Endothelium Adhesion Assay Product Manual CytoSelect Tumor- Endothelium Adhesion Assay Catalog Number CBA- 215 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cancer metastasis comprises several

More information

10/11/2016. Richard J. Santen, MD. Disclosures. Key Question Regarding MHT and Breast Cancer Development. NAMS 2016 Translational Science Symposium

10/11/2016. Richard J. Santen, MD. Disclosures. Key Question Regarding MHT and Breast Cancer Development. NAMS 2016 Translational Science Symposium Richard J. Santen, MD NAMS 2016 Translational Science Symposium Risks and Benefits Related to the Breast Disclosures Current Grant Funding: Pfizer Previous Advisory Boards: Pfizer, Teva, Novo-Nordisk,

More information

Mechanisms of hormone drug resistance

Mechanisms of hormone drug resistance Mechanisms of hormone drug resistance Ljiljana Stamatović Institute for Oncology and Radiology of Serbia Tenth UMOS Conference, Belgrade, 16-17 th May 2015. Hormone receptor-positive breast cancer (HR+

More information

Mitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit

Mitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit PROTOCOL Mitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit DESCRIPTION Mitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit Sufficient materials

More information

AMPK Phosphorylation Assay Kit

AMPK Phosphorylation Assay Kit AMPK Phosphorylation Assay Kit Catalog Number KA3789 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 Principle

More information

The effect of insulin on chemotherapeutic drug sensitivity in human esophageal and lung cancer cells

The effect of insulin on chemotherapeutic drug sensitivity in human esophageal and lung cancer cells The effect of insulin on chemotherapeutic drug sensitivity in human esophageal and lung cancer cells Published in: Natl Med J China, February 10, 2003; Vol 83, No 3, Page 195-197. Authors: JIAO Shun-Chang,

More information

Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury

Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Research progress on the use of estrogen receptor agonist for treatment of spinal cord injury Swapan K. Ray, PhD Professor, Department of Pathology, Microbiology, and Immunology USC School of Medicine,

More information

Chinese Pharmacological Bulletin 2012 Sep ~ 6. http / /www. cnki. net /kcms /detail / R html

Chinese Pharmacological Bulletin 2012 Sep ~ 6. http / /www. cnki. net /kcms /detail / R html 1262 1262 ~ 6 2012-8 - 14 17 19 http / /www. cnki. net /kcms /detail /34. 1086. R. 20120814. 1719. 018. html MG - 63 1 1 2 2 1. 453003 2. 361005 doi 10. 3969 /j. issn. 1001-1978. 2012. 09. 018 A 1001-1978

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Annexin V APC Assay Kit

Annexin V APC Assay Kit Annexin V APC Assay Kit Item No. 601410 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION 3 Materials

More information

High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer.

High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer. Biomedical Research 2017; 28 (18): 7779-7783 ISSN 0970-938X www.biomedres.info High expression of fibroblast activation protein is an adverse prognosticator in gastric cancer. Hu Song 1, Qi-yu Liu 2, Zhi-wei

More information

TRACP & ALP Assay Kit

TRACP & ALP Assay Kit Cat. # MK301 For Research Use TRACP & ALP Assay Kit Product Manual Table of Contents I. Description...3 II. III. IV. Introduction...3 Components...4 Materials Required but not Provided...4 V. Storage...4

More information

SENSITIZATION OF HUMAN OSTEOSARCOMA CELL LINE 143B WITH CALCITRIOL FOR CISPLATIN THERAPY. Surya Priyanka Bhamidi Lakshmi

SENSITIZATION OF HUMAN OSTEOSARCOMA CELL LINE 143B WITH CALCITRIOL FOR CISPLATIN THERAPY. Surya Priyanka Bhamidi Lakshmi SENSITIZATION OF HUMAN OSTEOSARCOMA CELL LINE 143B WITH CALCITRIOL FOR CISPLATIN THERAPY BY Surya Priyanka Bhamidi Lakshmi Submitted to the graduate degree program in Dietetics and Nutrition and the Graduate

More information

Genetic variability of genes involved in DNA repair influence treatment outcome in osteosarcoma

Genetic variability of genes involved in DNA repair influence treatment outcome in osteosarcoma Genetic variability of genes involved in DNA repair influence treatment outcome in osteosarcoma M.J. Wang, Y. Zhu, X.J. Guo and Z.Z. Tian Department of Orthopaedics, Xinxiang Central Hospital, Xinxiang,

More information

Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion and metastasis

Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion and metastasis European Review for Medical and Pharmacological Sciences 2016; 20: 4445-4451 Up-regulation of long non-coding RNA BCAR4 predicts a poor prognosis in patients with osteosarcoma, and promotes cell invasion

More information

Anti-Aging Activity Of Cucurbita moschata Ethanolic Extract Towards NIH3T3 Fibroblast Cells Induced By Doxorubicin

Anti-Aging Activity Of Cucurbita moschata Ethanolic Extract Towards NIH3T3 Fibroblast Cells Induced By Doxorubicin Indonesian Journal of Cancer Chemoprevention, 2016, 7(2): 49-53 ISSN: 2088 0197 Anti-Aging Activity Of Cucurbita moschata Ethanolic Extract Towards NIH3T3 Fibroblast Cells Induced By Doxorubicin Laeli

More information

Synthesis and Biological Evaluation of Protein Kinase D Inhibitors

Synthesis and Biological Evaluation of Protein Kinase D Inhibitors Synthesis and Biological Evaluation of Protein Kinase D Inhibitors Celeste Alverez Topic Seminar October 26, 2013 Celeste Alverez @ Wipf Group 10/26/2013 1 Protein Kinase D (PKD) A novel family of serine/threonine

More information

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production

Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim

More information

Effects of Kanglaite Injedction on Reversing Multiple Drug Resistance (MDR) of Tumor Cells

Effects of Kanglaite Injedction on Reversing Multiple Drug Resistance (MDR) of Tumor Cells Effects of Kanglaite Injedction on Reversing Multiple Drug Resistance (MDR) of Tumor Cells Yang Hua, Wang Xianping, Yu, Linlin, Zheng Shu, Zhejiang Medical University Cancer Institute Abstract Multiple

More information

Nuclear Extraction Kit

Nuclear Extraction Kit Nuclear Extraction Kit Item No. 10009277 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION 3 Materials

More information

McAb and rhil-2 activated bone marrow on the killing and purging of leukemia cells

McAb and rhil-2 activated bone marrow on the killing and purging of leukemia cells Effects of McAb and rhil-2 activated bone marrow on the killing and purging of leukemia cells X.C. Wei, D.D. Yang, X.R. Han, Y.A. Zhao, Y.C. Li, L.J. Zhang and J.J. Wang Institute of hematological research,

More information

(PDGF), 9 ( -2 (FGF-2), SMO

(PDGF), 9 ( -2 (FGF-2), SMO Abstract An ethanol extract from shark muscle has been shown to have potent angiogenic activity when mixed together with olive oil in a ratio of 1part extract to 9 parts olive oil. This mixture has been

More information

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer

Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer Low levels of serum mir-99a is a predictor of poor prognosis in breast cancer J. Li 1, Z.J. Song 2, Y.Y. Wang 1, Y. Yin 1, Y. Liu 1 and X. Nan 1 1 Tumor Research Department, Shaanxi Provincial Tumor Hospital,

More information

Study on the expression of MMP-9 and NF-κB proteins in epithelial ovarian cancer tissue and their clinical value

Study on the expression of MMP-9 and NF-κB proteins in epithelial ovarian cancer tissue and their clinical value Study on the expression of MMP-9 and NF-κB proteins in epithelial ovarian cancer tissue and their clinical value Shen Wei 1,a, Chen Juan 2, Li Xiurong 1 and Yin Jie 1 1 Department of Obstetrics and Gynecology,

More information

Effect of lncrna LET on proliferation and invasion of osteosarcoma cells

Effect of lncrna LET on proliferation and invasion of osteosarcoma cells European Review for Medical and Pharmacological Sciences 2018; 22: 1609-1614 Effect of lncrna LET on proliferation and invasion of osteosarcoma cells G. KONG 1, X.-J. QI 2, J.-F. WANG 3 1 Department of

More information

CytoPainter Lysosomal Staining Kit - Blue Fluorescence

CytoPainter Lysosomal Staining Kit - Blue Fluorescence ab112135 CytoPainter Lysosomal Staining Kit - Blue Fluorescence Instructions for Use For staining Lysosomes in suspension and adherent cells by using our proprietary blue fluorescence probe This product

More information

Caspase-3 Assay Cat. No. 8228, 100 tests. Introduction

Caspase-3 Assay Cat. No. 8228, 100 tests. Introduction Introduction Caspase-3 Assay Cat. No. 8228, 100 tests Caspase-3 is a member of caspases that plays a key role in mediating apoptosis, or programmed cell death. Upon activation, it cleaves a variety of

More information

MOLECULAR MEDICINE REPORTS 14: , 2016

MOLECULAR MEDICINE REPORTS 14: , 2016 MOLECULAR MEDICINE REPORTS 14: 2685-2690, 2016 Resveratrol inhibits phosphorylation within the signal transduction and activator of transcription 3 signaling pathway by activating sirtuin 1 in SW1353 chondrosarcoma

More information

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases

Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Brief Communication Downregulation of serum mir-17 and mir-106b levels in gastric cancer and benign gastric diseases Qinghai Zeng 1 *, Cuihong Jin 2 *, Wenhang Chen 2, Fang Xia 3, Qi Wang 3, Fan Fan 4,

More information

Lipid Droplets Fluorescence Assay Kit

Lipid Droplets Fluorescence Assay Kit Lipid Droplets Fluorescence Assay Kit Item No. 500001 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION

More information

Corning BioCoat Matrigel Invasion Chamber

Corning BioCoat Matrigel Invasion Chamber Corning BioCoat Matrigel Invasion Chamber Catalog No. 354480, 354481 Guidelines for Use Discovery Labware, Inc., Two Oak Park, Bedford, MA 01730, Tel: 1.978.442.2200 (U.S.) CLSTechServ@Corning.com www.corning.com/lifesciences

More information

Total Phosphatidic Acid Assay Kit

Total Phosphatidic Acid Assay Kit Product Manual Total Phosphatidic Acid Assay Kit Catalog Number MET- 5019 100 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Phosphatidic Acid (PA) is a critical precursor

More information

Regulatory role of microrna184 in osteosarcoma cells

Regulatory role of microrna184 in osteosarcoma cells Regulatory role of microrna184 in osteosarcoma cells G.R. Yin 1,2, Q. Wang 3, X.B. Zhang 2 and S.J. Wang 1 1 Department of Joint Surgery, The Second Hospital of Shandong University, Jinan, China 2 Department

More information

RCD24, B7-H4 and PCNA expression and clinical significance in ovarian cancer

RCD24, B7-H4 and PCNA expression and clinical significance in ovarian cancer JBUON 2019; 24(2): 715-719 ISSN: 1107-0625, online ISSN: 2241-6293 www.jbuon.com E-mail: editorial_office@jbuon.com ORIGINAL ARTICLE RCD24, B7-H4 and PCNA expression and clinical significance in ovarian

More information

Inhibiting mirna-30a-3p has anti-tumor effects in glioma cancer via PTEN

Inhibiting mirna-30a-3p has anti-tumor effects in glioma cancer via PTEN Inhibiting mirna-30a-3p has anti-tumor effects in glioma cancer via PTEN Liexiang Zhang 1,3,*, Wei Jin 2, Jing Zheng 3, Yuxiang Dai 2,Yue Song 1, Hongbin Ni 2, 1. Department of Neurosurgery, Nanjing Drum

More information

The Process of Angiogenesis & Inhibition of Angiogenesis and/or Lymphangiogenesis

The Process of Angiogenesis & Inhibition of Angiogenesis and/or Lymphangiogenesis The Process of Angiogenesis & Inhibition of Angiogenesis and/or Lymphangiogenesis Nam Deuk Kim, Ph.D. Pusan National University Contents Part 1. The process of angiogenesis Part 2. The role of angiopoietins

More information

Cellular Physiology and Biochemistry

Cellular Physiology and Biochemistry Original Paper 2015 The Author(s). 2015 Published The Author(s) by S. Karger AG, Basel Published online: November 27, 2015 www.karger.com/cpb Published by S. Karger AG, Basel 2194 1421-9778/15/0376-2194$39.50/0

More information

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei,

Doctoral Degree Program in Marine Biotechnology, College of Marine Sciences, Doctoral Degree Program in Marine Biotechnology, Academia Sinica, Taipei, Cyclooxygenase 2 facilitates dengue virus replication and serves as a potential target for developing antiviral agents Chun-Kuang Lin 1,2, Chin-Kai Tseng 3,4, Yu-Hsuan Wu 3,4, Chih-Chuang Liaw 1,5, Chun-

More information

IN VITRO CELLULAR RESPONSES TO AUTOLOGOUS TUMOR EXTRACT DETECTED BY INHIBITION OF MACROPHAGE MIGRATION*1

IN VITRO CELLULAR RESPONSES TO AUTOLOGOUS TUMOR EXTRACT DETECTED BY INHIBITION OF MACROPHAGE MIGRATION*1 [Gann, 66, 167-174; April, 1975] IN VITRO CELLULAR RESPONSES TO AUTOLOGOUS TUMOR EXTRACT DETECTED BY INHIBITION OF MACROPHAGE MIGRATION*1 Tsuyoshi AKIYOSHI, Akira HATA, and Hideo TSUJI Department of Surgery,

More information

[Abstract] Objective: Investigate the effect of KLT on the expression of Fas/Apo-1, FasL and PCNA genes in renal carcinoma cell line (GRC-1).

[Abstract] Objective: Investigate the effect of KLT on the expression of Fas/Apo-1, FasL and PCNA genes in renal carcinoma cell line (GRC-1). Study on Effect of Kanglaite Injection(KLT) on the Expression of Fas/Apo-1, FasL and PCNA in Renal Carcinoma Cell Lines Wang Junjie, Sun Xinchen, Sheng Wenjiang, Yu Lizhang [Abstract] Objective: Investigate

More information

Human IL-2. Pre-Coated ELISA Kit

Human IL-2. Pre-Coated ELISA Kit Human IL-2 (Interleukin 2) Pre-Coated ELISA Kit Catalog No: 90-2083 1 96 well Format (96 tests) Detection Range: 31.2 2000 pg/ml Sensitivity: < 18.75 pg/ml This immunoassay kit allows for the in vitro

More information

Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer

Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer European Review for Medical and Pharmacological Sciences 2019; 23: 2353-2359 Long noncoding RNA DARS-AS1 acts as an oncogene by targeting mir-532-3p in ovarian cancer K. HUANG, W.-S. FAN, X.-Y. FU, Y.-L.

More information

This brings me to my point. Disease starts when there is a surplus or deficiency of certain nutritive or non-nutritive substances in the human body.

This brings me to my point. Disease starts when there is a surplus or deficiency of certain nutritive or non-nutritive substances in the human body. WHAT IS DISEASE? A pathological condition of a part of an organ, or system of an organism resulting from various causes, such as infection, genetic defect, or environmental stress, and characterized by

More information

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway

Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through mir-93/ PTEN/Akt Signaling Pathway Chen Accepted: et al.: February Berberine 24, Sensitizes 2015 Ovarian Cancer Cells to Cisplatin www.karger.com/cpb 956 1421-9778/15/0363-0956$39.50/0 Original Paper This is an Open Access article licensed

More information

Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening

Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Protocol for A-549 VIM RFP (ATCC CCL-185EMT) TGFβ1 EMT Induction and Drug Screening Introduction: Vimentin (VIM) intermediate filament (IF) proteins are associated with EMT in lung cancer and its metastatic

More information

ab Lysosome/Cytotoxicity Dual Staining Kit

ab Lysosome/Cytotoxicity Dual Staining Kit ab133078 Lysosome/Cytotoxicity Dual Staining Kit Instructions for Use For studying lysosome function at the cellular level. This product is for research use only and is not intended for diagnostic use.

More information

It is a malignancy originating from breast tissue

It is a malignancy originating from breast tissue 59 Breast cancer 1 It is a malignancy originating from breast tissue including both early stages which are potentially curable, and metastatic breast cancer (MBC) which is usually incurable. Most breast

More information

William Weidong Du 1,3, Ling Fang 1,2, Weining Yang 1,3, Wang Sheng 1,2, Yaou Zhang 1,2, Arun Seth 1,2, Burton B Yang 1,2 and Albert J Yee 1,3,4*

William Weidong Du 1,3, Ling Fang 1,2, Weining Yang 1,3, Wang Sheng 1,2, Yaou Zhang 1,2, Arun Seth 1,2, Burton B Yang 1,2 and Albert J Yee 1,3,4* Du et al. BMC Cancer 212, 12:341 http://www.biomedcentral.com/1471-247/12/341 RESEARCH ARTICLE Open Access The role of versican domain in regulating breast cancer cell motility including effects on osteoblast

More information

ab Membrane Fractionation Kit Instructions for Use For the rapid and simple separation of membrane, cytosolic and nuclear cellular fractions.

ab Membrane Fractionation Kit Instructions for Use For the rapid and simple separation of membrane, cytosolic and nuclear cellular fractions. ab139409 Membrane Fractionation Kit Instructions for Use For the rapid and simple separation of membrane, cytosolic and nuclear cellular fractions. This product is for research use only and is not intended

More information

SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric*

SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric* SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric* Catalog # 72146 Kit Size 500 Assays (96-well plate) Optimized Performance: This kit is optimized to detect alkaline phosphatase activity Enhanced

More information

Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway

Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway Jieyuan Zhang, Xiaolin Liu, Haiyan Li, Chunyuan Chen, Bin Hu, Xin Niu, Qing

More information

IN VITRO HORMESIS EFFECTS OF SODIUM FLUORIDE ON KIDNEY CELLS OF THREE-DAY-OLD MALE RATS

IN VITRO HORMESIS EFFECTS OF SODIUM FLUORIDE ON KIDNEY CELLS OF THREE-DAY-OLD MALE RATS 292 Tang, An, Du, Zhang, Zhou 292 IN VITRO HORMESIS EFFECTS OF SODIUM FLUORIDE ON KIDNEY CELLS OF THREE-DAY-OLD MALE RATS Qin-qing Tang, a Xiao-jing An, a Jun Du, a Zheng-xiang Zhang, a Xiao-jun Zhou a

More information

In-vitro assay for Cytotoxicity activity in ethonolic extract of fruit rind of Couropita Guianensis aubl

In-vitro assay for Cytotoxicity activity in ethonolic extract of fruit rind of Couropita Guianensis aubl ISSN: 2319-7706 Volume 3 Number 10 (2014) pp. 169-176 http://www.ijcmas.com Original Research Article In-vitro assay for Cytotoxicity activity in ethonolic extract of fruit rind of Couropita Guianensis

More information

ENVIRONMENTAL HEALTH PERSPECTIVES

ENVIRONMENTAL HEALTH PERSPECTIVES ehp ehponline.org ENVIRONMENTAL HEALTH PERSPECTIVES Bisphenol A at Low Nanomolar Doses Confers Chemoresistance in Estrogen Receptor Alpha Positive and Negative Breast Cancer Cells Elizabeth W. LaPensee,

More information

Recombinant Trypsin, Animal Origin Free

Recombinant Trypsin, Animal Origin Free Recombinant Trypsin, Animal Origin Free PRODUCT INFORMATION: BioGenomics r-trypsin powder is ready to use, animal origin free optimized for cell culture applications. It is derived by r-dna technology.

More information

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1

Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 CHRISTOPH RADER, 2 MIKHAIL POPKOV, JOHN A. NEVES, AND CARLOS F. BARBAS III 2 Department of Molecular Biology and The

More information

Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108

Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108 Li et al. Journal of Experimental & Clinical Cancer Research (2018) 37:108 https://doi.org/10.1186/s13046-018-0774-7 CORRECTION Correction to: Novel smac mimetic APG- 1387 elicits ovarian cancer cell killing

More information

7-AAD/CFSE Cell-Mediated Cytotoxicity Assay Kit

7-AAD/CFSE Cell-Mediated Cytotoxicity Assay Kit 7-AAD/CFSE Cell-Mediated Cytotoxicity Assay Kit Item No. 600120 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS

More information

Lecture 15. Signal Transduction Pathways - Introduction

Lecture 15. Signal Transduction Pathways - Introduction Lecture 15 Signal Transduction Pathways - Introduction So far.. Regulation of mrna synthesis Regulation of rrna synthesis Regulation of trna & 5S rrna synthesis Regulation of gene expression by signals

More information

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the

Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student

More information

CytoSelect 24- Well Cell Invasion Assay (Basement Membrane, Fluorometric Format)

CytoSelect 24- Well Cell Invasion Assay (Basement Membrane, Fluorometric Format) Product Manual CytoSelect 24- Well Cell Invasion Assay (Basement Membrane, Fluorometric Format) Catalog Number CBA- 111 12 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction

More information

International Conference on Biomedical and Biological Engineering (BBE 2016)

International Conference on Biomedical and Biological Engineering (BBE 2016) International Conference on Biomedical and Biological Engineering (BBE 2016) Injury Mechanism of Sub-Micron Calcium Oxalate Monohydrate and Dihydrate Crystals on Renal Epithelial Cells Poonam BHADJA, Kai

More information

8. CHAPTER IV. ANTICANCER ACTIVITY OF BIOSYNTHESIZED SILVER NANOPARTICLES

8. CHAPTER IV. ANTICANCER ACTIVITY OF BIOSYNTHESIZED SILVER NANOPARTICLES 8. CHAPTER IV. ANTICANCER ACTIVITY OF BIOSYNTHESIZED SILVER NANOPARTICLES 8.1. Introduction Nanobiotechnology, an emerging field of nanoscience, utilizes nanobased-systems for various biomedical applications.

More information

Long non-coding RNA UCA1 regulates the proliferation, migration and invasion of human lung cancer cells by modulating the expression of microrna-143

Long non-coding RNA UCA1 regulates the proliferation, migration and invasion of human lung cancer cells by modulating the expression of microrna-143 European Review for Medical and Pharmacological Sciences 2018; 22: 8343-8352 Long non-coding RNA UCA1 regulates the proliferation, migration and invasion of human lung cancer cells by modulating the expression

More information

Nitin Telang1, Guo Li2, Meena Katdare3,4 Daniel w. Sepkovic5,

Nitin Telang1, Guo Li2, Meena Katdare3,4 Daniel w. Sepkovic5, Preventive Efficacy of the Chinese Nutritional Herb Epimedium grandiflorum in a Preclinical Cell Culture Model for Luminal A Molecular Subtype of Breast Cancer Nitin Telang1, Guo Li2, Meena Katdare3,4

More information

Annals of Oncology Advance Access published January 10, 2005

Annals of Oncology Advance Access published January 10, 2005 Annals of Oncology Advance Access published January 10, 2005 Original article Annals of Oncology doi:10.1093/annonc/mdi077 Expression of survivin and bax/bcl-2 in peroxisome proliferator activated receptor-g

More information

MTS assay in A549 cells

MTS assay in A549 cells Project: VIGO MTS assay in A549 cells Detection of cell viability/activity AUTHORED BY: DATE: Cordula Hirsch 20.01.2014 REVIEWED BY: DATE: Harald Krug 10.04.2014 APPROVED BY: DATE: DOCUMENT HISTORY Effective

More information

The Schedule and the Manual of Basic Techniques for Cell Culture

The Schedule and the Manual of Basic Techniques for Cell Culture The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293

More information

BIT 120. Copy of Cancer/HIV Lecture

BIT 120. Copy of Cancer/HIV Lecture BIT 120 Copy of Cancer/HIV Lecture Cancer DEFINITION Any abnormal growth of cells that has malignant potential i.e.. Leukemia Uncontrolled mitosis in WBC Genetic disease caused by an accumulation of mutations

More information

Implications of Progesterone Receptor Status for the Biology and Prognosis of Breast Cancers

Implications of Progesterone Receptor Status for the Biology and Prognosis of Breast Cancers 日大医誌 75 (1): 10 15 (2016) 10 Original Article Implications of Progesterone Receptor Status for the Biology and Prognosis of Breast Cancers Naotaka Uchida 1), Yasuki Matsui 1), Takeshi Notsu 1) and Manabu

More information

In Vitro Studies of the Aurora-Kinase Inhibitor MLN8237 in Prostate Cancer Cell Lines

In Vitro Studies of the Aurora-Kinase Inhibitor MLN8237 in Prostate Cancer Cell Lines In Vitro Studies of the Aurora-Kinase Inhibitor MLN837 in Prostate Cancer Cell Lines Nicole V. Julian Mentor: Ana Aparicio, M.D. Special Thanks to Brittany Kleb Department of Genitourinary Medical Oncology

More information

Supplementary Figure 1. Tamoxifen does not promote chemotaxis or chemokinesis in the absence of additional stimulation. Transwell chemotaxis assays

Supplementary Figure 1. Tamoxifen does not promote chemotaxis or chemokinesis in the absence of additional stimulation. Transwell chemotaxis assays Supplementary Figure 1. Tamoxifen does not promote chemotaxis or chemokinesis in the absence of additional stimulation. Transwell chemotaxis assays revealed that tamoxifen treatment alone did not stimulate

More information

MicroRNA-1908 is a biomarker for poor prognosis in human osteosarcoma

MicroRNA-1908 is a biomarker for poor prognosis in human osteosarcoma European Review for Medical and Pharmacological Sciences MicroRNA-1908 is a biomarker for poor prognosis in human osteosarcoma D. LIAN 1, Z.-Z. WANG 2, N.-S. LIU 1 1 Department of Orthopedics, Linyi People

More information

Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival

Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival European Review for Medical and Pharmacological Sciences 2017; 21: 3397-3401 Expression of long non-coding RNA linc-itgb1 in breast cancer and its influence on prognosis and survival W.-X. LI 1, R.-L.

More information

Cell Lysis Buffer. Catalog number: AR0103

Cell Lysis Buffer. Catalog number: AR0103 Cell Lysis Buffer Catalog number: AR0103 Boster s Cell Lysis Buffer is a ready-to-use Western blot related reagent solution used for efficient extraction of total soluble protein in nondenatured state

More information

Supporting Information Nitric oxide releasing photoresponsive nanohybrids as excellent therapeutic agent for cervical cancer cell lines

Supporting Information Nitric oxide releasing photoresponsive nanohybrids as excellent therapeutic agent for cervical cancer cell lines upporting Information itric oxide releasing photoresponsive nanohybrids as excellent therapeutic agent for cervical cancer cell lines Priya udhesh a, Kaviyarasan Tamilarasan a, Palaniappan Arumugam a and

More information

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small

More information

Inhibition of cell migration and endothelial cell tubulogenesis by compounds. found in black raspberries. A Senior Honors Thesis

Inhibition of cell migration and endothelial cell tubulogenesis by compounds. found in black raspberries. A Senior Honors Thesis Inhibition of cell migration and endothelial cell tubulogenesis by compounds found in black raspberries A Senior Honors Thesis Presented in Partial Fulfillment of the Requirements for Graduation with research

More information

Frontiers of Science Foundation Scholar. Toby Bothwell. Freshman, University of Arkansas. final research manuscripts

Frontiers of Science Foundation Scholar. Toby Bothwell. Freshman, University of Arkansas. final research manuscripts Frontiers of Science Foundation Scholar Toby Bothwell Oklahoma city, OKlahoma Freshman, University of Arkansas final research manuscripts The Effect of Estradiol and Estrogen Receptors α and β on Bone

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy

Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong

More information

Hyponatremia in small cell lung cancer is associated with a poorer prognosis

Hyponatremia in small cell lung cancer is associated with a poorer prognosis Original Article Hyponatremia in small cell lung cancer is associated with a poorer prognosis Wenxian Wang 1, Zhengbo Song 1,2, Yiping Zhang 1,2 1 Department of Chemotherapy, Zhejiang Cancer Hospital,

More information