TRANSCRIPTIONAL REGULATION OF THE CDK INHIBITOR p16 INK4" GENE BY A NOVEL prb-associated REPRESSOR, RBAR1

Transcription

1 BOCHEMSTRY andmolecular BOLOGY NTERNATONAL pages Received September 21,1998 Accepted September 22, 1998 TRANSCRPTONAL REGULATON OF THE CDK NHBTOR p16 NK4" GENE BY A NOVEL prb-assocated REPRESSOR, RBAR1 Satoshi K_anel,,o:, Junji Nishioka 2, MLinoru Tanaka:, (unio Nakashin:a: mid Tsutomu Nobori 2 Departments qf Biochemistry and 2Laboratoly Medicine, Mie University Faculty of Medicine, 2-74 Edobashi, Tsu, Mie , Japan SUMMARY p16, also known as NK4a, CDKN2, or MTS1, plays an important role in the control of the cell cycle progression, and retinoblastoma protein (prb) is suggested to be involved in the transcriptional regulation of p16. However, it is not fully understood how prb regulates transcription of the p16 gene. NUclear proteins prepared only from the prb-nonfunctional human tumor cells were found to bind to the 5'-flanking sequence of the pt6 gene in the presence of Zn z+ by electrophoretic mobility shift assay (EMSA). EMSA using mutagenized 5'-flanking sequences as competitors suggested that the sequence at position -97 to -87 relative to first ATG of the p16 gene was critical for protein binding. Transient reporter assay indicated that the sequence identified by EMSA acted as a silencer element in the prb-nonfunctional tumor cells, showing the presence of a transcriptional repressor associated with functional prb (RBAR1). Key words: p16; NK4a; prb; Transcription factor; c/s-element; Repressor; RBAR1 NTRODUCTON The progression from G1 to S phase in mammalian cells is controlled by the cell cycle regulators that include D-type cyclins and cyclin-dependent kinases (CDKs) (reviewed in Ref. 1 ). D-type cyclins, expressed at the highest level in mid and late G1 phases by mitogens or growth factors, bind to and activate the specific CDKs (2, 3). Cyclin D-CDK complexes phosphorylate the retinoblastoma tumor suppressor gene prcxtuct (prb). The hypophsphorylated prb binds to and inactivates the transcription factors, such as E2F necessary for the cells to enter into the S phase. The hyperphosphorylated prb promotes the G/S transition by releasing and activating these transcription factors (reviewed in Ref. 4). Recently, p16, also known as NK4a, CDKN2, or MTS 1, has been identified as a CDK inhibitor (5). The chromosome 9p21 region containing the p16 gene is frequently deleted homozygously in a number of human tumor cell lines including malignant melanomas, gliomas, lung cancers and leukemias (6, 7). The ectopic overexpression of p16 induces the G1 arrest in the pl6-negative tumor cells that retain functional prb, but it does not induce the G1 arrest in the tumor cells in which prb is nonfunctional (8, 9). p16 regulates negatively the cell cycle progression by inhibiting the catalytic activity of CDK4 and CDK6. Previous studies have suggested that prb is involved in the transcriptional regulation of p16. 2O5 Copyright UBMB /99 $

2 VoL 47, No. 2, February 1999 BOCHEMSTRY and MOLECULAR BOLOGY NTERNATONAL The transcription of pl6 in prb-nonfunctional cells is higher than that in the prb-functional cells (10). The ectopic expression of prb represses the transcription of pl6 in the prb-nonfunctional cells (11, 12). However, the E2F binding site is not found in the 3 kb upstream sequences of the p16 gene (12). Thus the transcriptional regulation of the p16 gene is not fully understood yet. To clarify the transcriptional regulation mechanism of the p16 gene, we carried out promoter analysis of p16. MATERALS AND METHODS Cell culture -- Human cervical carcinoma cell lines HeLa and C33a, osteosarcoma cells lines Saos-2 and U-20S and lung carcinoma H460 cells were grown in Dulbecco'ff,rnodified Eagle's medium (Gibco BRL) supplemented with 10% fetal bovine serum in a humidified incubator at 37~ under an atmosphere of 5% CO,_ 95% air. Electrophoretic Mobility Shift Assay (EMSA) -- Nuclear extracts were prepared from HeLa, C33a, Saos-2, U-20S and H460 cells as described previously (13). EMSA was carried out as described (14) with following modifications. The DNA fragment, -136 to -82, relative to the ATG in the 5'-flanking region of the p16 gene, was synthesized by polymerase chain reaction (PCR) with a 5' primer containing EcoR restriction enzyme site and a 3' primer containing Xba restriction enzyme site at their 5' termini. The digested DNA fragment with EcoR and Xba restriction enzymes was subcloned in the pgem3zf(+) vector (Promega). The mutated DNA fragments as competitors were synthesized by mutagenic PCR as described (15). The constructs were verified by DNA sequence analysis. The DNA fragment (-136 to -82) that recovered by digestion with EcoR and Xbal was end-labeled with [ctyp]dctp with Klenow fragment. The nuclear extract (1,ug protein) was mixed with 1 ug of poly(d-dc)-poly(d-dc)(pharmacia), 10/A of 2 x binding buffer (1:100 mm KC1, 40 mm HEPES, ph 7.9, 1 mm EDTA, 20% glycerol, 0.5 mm PMSF, and 0.5 mm DTT, 2:100 mm KC1, 40 mm HEPES, ph 7.9, 20 mm MgC12, 20% glycerol, 0,5 mm PMSF, and 0.5 mm DT', 3:100 mm KC1, 40 mm HEPES-KOH ph 7.9, 0.2 mm ZnC12, 20% glycerol, 0.5 mm PMSF, and 0.5 mm DTT) and 2 x 10 s cpm (35 fmol) of the 32P-labeled probe in a final volume bringing to 20,ul with distilled H20, and incubated at 30~ for 30 rain. For competition experiments, molar excess 2 amount (50 fold) of unlabeled DNA fragments were added to the binding mixture prior to the P-labeled probe. The reaction mixtures after incubation were electrophoresed on 4% low-ionic strength native polyacrylamide gel with buffer circulating at 4~ The gel was dried and autoradio~raphed with an intensifu screen at -80~ Plasmid C~onstruction -- Several DNA fragments from the 5'-flanking region of the pl6 gene at positions -867 to-1, -301 to -1, -247 to-1, and-82 to-1 (relative to the ATG), were amplified by PCR with 5' primers containing Xba restriction enzyme site and 3' primers containing Bgl restriction enzyme site at their 5' termini. The digested DNA fragment with Xba and Bgl was subcloned inbetween the Nhe and Bg sites in the luciferase expression plasmid pgl2-basic (Promega), The mutagenized DNA fragments, deleted at -97 to -87 and inverted at -867 to -797, which were amplified by mutagenic PCR as described (16) were also subcloned in the pgl2- Basic vector. The constructs were verified by DNA sequence analysis. Transfection and Transient luciferase reporter assay -- The plasmids were punlled lor translectlon by the alkaline-sds method followed by affinity chromatography on a Qiagen column (Qiagen). Transfections of HeLa cells and H460 cells were carried out on cells at 50-80% confluence using 206

3 BOCHEMSTRY and MOLECULAR BOLOGY NTERNATONAL TfxVM20 reagent (Promega) according to the manufacturer's protocol. To control the transfection efficiency, the p16 promoter constructs were co-transfected with pcmvb vector which designed to express 13-galactosidase from the cytomegalovirus promoter (Clontech). Cell lysates were prepared using the reporter lysis buffer (Promega). The luciferase activity was measured with the PicaGene luminescence kit (Toyo ink). The g-galactosidase activity was measured with the g- galactosidase enzyme assay system (Promega). The total protein of cell lysates were measured with BCA protein assay reagent (Pierce). The results were normalized by total protein content and 13-galactosidase activity. RESULTS Finding of the DNA binding proteins and dentification of these cis.elements by Electrophoretic Mobility Shift Assay (EMSA) --Two DNA binding proteins, major and minor, that specifically bound to the nucleotide sequence at positions -136 to -82, relative to the ATG, in the 5'-flanking region of p16 gene were found in nuclear extracts from HeLa cells by EMSA. These proteins required zinc ions to bind specifically to DNA (Fig. 1). To determine the recognized DNA sequence, four DNA fragments, F1 (-106 to -82), F2 (-116 to -96), F3 (-126 to - 106) and F4 (-136 to -116), were used as competitors against the 32P-labeled probe WT (-136 to - 82) in the competitor experiments in EMSA. Only a fragment, F1 (-106 to -82) competed against 3zP-labeled WT (Fig. 2). This result suggested that the cis-element which was recognized by the DNA binding proteins was in the nucleotide sequence at positions -106 to -82. Moreover, to investigate the cis-element, we prepared two site-deleted competitors and four mutated competitors to carry out the competitor experiment in EMSA. A deleted competitor, D1 (-136 to -82) was deleted 10 nucleotides, GAGGAAGAAA, at-107 to -98. Another deleted competitor, D2 (-136 to -82) was deleted 11 nucleotides, GAGGAGGGGCT, at -97 to -87. Four mutated competitors whose two nucleotides in the region from -136 to -82 were mutated as followings: M1 was mutated from GA to TC at positions -97 and -96, M2 was mutated from GA to TC at positions -94 and -93, M3 was mutated from GG to T" at -91 and -90, and M4 was mutated from CT to AG at - 88 and -87. The deleted competitor D1 and the non-labeled WT competed against 32p-labeled WT completely, but D2 did not compete against 3zP-labeled WT. The competition of mutated competitors M and M2 against 32p-labeled WT was weaker than D1 and non-labeled WT. M3 and M4 were more competitive than M1 and M2 (Fig. 3). These results suggested that major and minor DNA binding protein recognized the same sequence, GAGGAGGGGCT, and the GAGGAG sequence was the important sequence. Then we investigated the GAGGAG sequence in more detail using 6 mutated competitors: M5 mutated from G tot at -97, M6 mutated from A to C at -96, M7 mutated from G to T at -95, M8 mutated from G to T at -94, M9 mutated from A to C at -93, and M10 mutated from G tot at -92. The mutated competitors M5, M9, M10 and non- labeled WT competed against 32P-labeled WT completely. The competitions by M6, M7 and M8 against 3~P-labeled WT were weaker than those by M5, M9, M10 and non-labeled WT (Fig. 4). These results suggested that the AGG sequence at positions -96 to -94 was particularly important sequence to be recognized by the zinc-dependent DNA binding proteins in the GAGGAGGGGCT sequence at positions -97 to

4 BOCHEMSTRY andmolecular BOLOGY NTERNATONAL Fig. 1 free Mg 2+ Zn, , ill added cations probe competitor Free probe 208

5 BOCHEMSTRY and MOLECULAR BOLOGY NTERNATONAL A -136 WT~ F1 B F2 F3 F Fig '1 WT WT F1 F2 F3 F4 i P robe -82 competitor free probe

6 BOCHEMSTRY andmolecular BOLOGY NTERNATONAL Fig. 3 A WT --gaggaagaaagaggaggggctggctg55bp D1 D2 M1 M2 M3 M4 B --~gaggaggggctggct --gaggaagaaa~ggctg wild WPe 45bp deletion 44bp deletion --gaggaagaaatoggaggggctggctg 55bp mutation --gaggaagaaagags 55bp mutation --gaggaagaaagaggagttgctggctg 55bp mutation --gaggaagaaagaggaggggagggctg 55bp mutation WT probe - WT D1 D2 M1 M2 M3 M4 competitor 210

7 BOCHEMSTRY and MOLECULAR BOLOGY NTERNATONAL Fig. 4 A -136 WT M5,,. M6 M7 M8 M9... M gaggaagaaagaggaggggctggctg 55bp wild type gaggaagaaataggaggggctggctg 55bp mutation gaggaagaaagcggaggggctggctg 55bp mutation gaggaagaaagatgaggggctggctg 55bp mutation gaggaagaaagag%.aggggctggctg 55bp mutation gaggaagaaagaggcggggctggctg 55bp mutation gaggaagaaagaggatgggctggctg 55bp mutation B WT lprobe - WT M5 M6 M7 M8 M9 M10~competitor 211

8 BOCHEMSTRY and MOLECULAR BOLOGY NTERNATONAL Comparison between the prb-nonfunctional and the prb-functional cell lines- Two zinc-dependent DNA binding proteins, major and minor, were found in the nuclear extracts from HeLa cells in which prb was nonfunctional. Since prb was involved in the transcriptional regulation of the p16 gene, we compared the prb-nonfunctional tumor cell lines HeLa, C33a and Saos-2 cells with the prb-functional tumor cell lines U20S and H460 cells by EMSA. The nuclear extracts from HeLa, C33a and Saos-2 cells formed the DNA-protein complexes, but those from U20S and H460 did not form the DNA-protein complexes (Fig. 5). Fig. 5 A cell line cell type prb functionality HeLa cervical carcinoma non-functional C33a cervical carcinoma non-functional Saos-2 osteosarcoma non-functional U20S osteosarcoma functional H 460 lung carcinoma functional B HeLa C33a Saos-2 U20S H460 nuclear extracts probe competitor 212

9 BOCHEMSTRY andmolecular BOLOGY NTERNATONAL Function of the sequence GAGGAGGGGCT as cis-acting element--to determine the function of the zinc-dependent DNA binding proteins associated to the sequence GAGGAGGGGCT, we constructed several reporter plasmids in which variously sized and mutated 5'-flanking fragments of the p16 gene were inserted into a upstream region of the luciferase gene in the pgl2-basic vector (Fig. 6). These constructs were transfected into the prbnonfunctional cell line, HeLa cells, and the prb-functional cell line, H460 cells. While the -82/-1 fragment has the basal p16 promoter activity, the promoter activity of the -247/-1 and the -301/-1 fragments increased 3 fold over the -82/-1 fragment in HeLa cells. The promoter activities of the wild-type -867/-1 fragment and the inverted -867/-1 fragment, in which the sequence from -867 to -797 was inverted, increased 7 fold over the -82/-1 fragment in HeLa cells. The promoter activity of the -867/-1 deletion fragment, which lacked the sequence between -97 and -87, increased 12 fold over the-82/-1 fragment in HeLa cells. However the significant difference among the three - 867/-1 fragments was not detected in the prb-functional cell line, H460 cells (Fig. 6). These results indicated that the sequence GAGGAGGGGCT was c/s-element which acted as a silencer element in the p16 promoter gene in Heka cells. Fig wild-type t//l Luc deletion(-87~-97) inversion(-797~-867) '-flanking region of p16 gene 0 9 HeLa [] H460 i i { i i i Relative luciferase activity (fold over -82/-1 )

10 BOCHEMSTRYandMOLECULAR BOLOGY NTERNATONAL DSCUSSON The 5'-flanking sequence of the p16 gene have been reported by Ham et ol. (11). They have shown that the 5'-flanking sequence between -869 and -1, relative to the ATG, have maximum promoter activity in the prb-nonfunctional cell lines, and ectopic expression of prb represses the promoter activity (11). Another group, Li et al., have also reported similar results (12). We also obtained the same result that the p16 promoter activity in the prb-nonfunctional HeLa cells was higher than that in the prb-functional H460 ceils (Fig. 6). t is suggested that the prb-associated enhancer elements are present in the 5'-flanking region between -867 to -82. However sequences for the prb-associated enhancer elements, like an apparent E2F binding site, have not yet been identified in the 5'-flanking region. n this study, we have found two DNA binding proteins, major and minor, in the nuclear extracts from the prb-nonfunctional cell line, HeLa cells. These proteins recognized the specific sequence GAGGAGGGGCT between -97 to -87, relative to the ATG, in the 5'-flanking region of the p16 gene and required zinc ions to bind to that sequence (Figs. 1, 2, 3 and 4). t was predicted that these proteins were acting as the transcription factors since many transcription factors including Spl, GAAT-factors and the nuclear receptors have zinc binding motifs called the zinc fingers (17, 18). n our study, these proteins were found in the prb-nonfunctional cell lines, HeLa cells, C33a ceils and Saos-2 ceils, and were not found in the prb-functional cell lines, U2 OS cells and H460 cells (Fig. 5). prb was involved in the specific DNA binding activity of these proteins directly or indirectly. The results of transient luciferase reporter assay have suggested that the sequence GAGGAGGGGCT acts as a silencer element in the prb-nonfunctional HeLa cells. However, this element did not act in the prb-functional H460 cells (Fig. 6). We consider that these zinc-dependent DNA binding proteins may act as prb-associated transcriptional repressor. This is the first report that identifies the prb-associated cis-acting silencer element in the transcriptional regulation mechanism of the p16 gene. We also showed the presence of a prbassociated repressor and designated it as prb-associated repressor 1 (RBAR1), which bound to the cis-acfing silencer element in the prb-nonfunctional human tumor cell lines. A more detailed understanding awaits the identification and characterization of RBAR1. REFERENCES 1.Sherr, C. J. (1993) Cell 73, Kato, JY, Matsuoka, M., Strom, D. K. and Sherr, C. J. (1994) Mol. Cell. Biol. 14, Matsushime, H., Quelle, D. E., Shurtleff, S. A., Shibuya, M., Sherr, C. J. and Kato, JY. (1994) Mol. Cel. Biol. 14, Weinberg, R. A. (1995) Cell 8 1, Serrano, M., Hannon, G. J. and Beach, D. (1993)Nature 366, Kamb, A.,. Gruis, N. A., Weaver-Feldhaus, J., Liu, Q., Harshman, K., Tavitgian, S.V., Stockert, E., Day, R. S.., Johnson, B. E. and Skolnick, M. H. (1994) Science 264,

11 BOCHEMSTRYandMOLECULAR BOLOGY NTERNATONAL 7.Nobori, T., Miura, K., Wu, D. J., Lois, A., Takabayashi, K. and Carson, D. A.(1994) Nature 36 8, Lukas, J., Parry, D., Aagaard, L., Mann, D. J., Bartkova, J., Strauss, M., Peters, G. and Bartek, J. (1995) Nature 375, Medema, R. H, Herrera, R. E., Lam, F. and Weinberg, R. A. (1995) Proc. Natl. Acad. Sci, USA 9 2, Tam, S. W., Shay, J. W. and Pagano, M. (1994)CancerRes. 54, l.hara, E., Smith, R., Parry, D., Tahara, H., Stone, S. and Peters, G. (1996) Mol. Cell. Biol. 16, Li, Y., Nichols, M. A., Shay, J. W., and Xiong, Y. (1994) Cancer Res. 5 4, Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K. (1993) Curr. Prot. Mol. Biol Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K. (1993) Curr. Prot. Mol. Biol Dieffenbach, C. W. and Dveksler, G. S. (1995) PCR Primer a Laboratory Manual Dieffenbach, C. W. and Dveksler, G. S. (1995) PCR Primer a Laboratory Manua Coleman, J. E. (1992) Annu. Rev. Biochem. 6 1, Pabo, C. O. and Sauer, R. T. (1992)Annu. Rev, Biochem. 6 1,