Supporting Information
|
|
- Merilyn Poole
- 5 years ago
- Views:
Transcription
1 Supporting Information A Systemic Study on the Biogenic Pathways of Yezo otogirins: Total Synthesis and Antitumor Activities of (±)-Yezo otogirin C and its Structural Analogues Wei Yang, Jingming Cao, Mengxun Zhang, Rongfeng Lan, Lizhi Zhu, Guangyan Du, Shuzhong He, * and Chi-Sing Lee, * Laboratory of Chemical Genomics, School of Chemical Biology and Biotechnology, Peking University Shenzhen Graduate School, Shenzhen University Town, Xili, Shenzhen , China; lizc@pkusz.edu.cn Institute of Research and Continuing Education, Hong Kong Baptist University (Shenzhen), Shenzhen , China School of Pharmaceutical Sciences, Guizhou University, Guiyang, Guizhou , China; she48@wisc.edu Table of Contents X-ray structure of compound 8 (Figure S1)...S2 X-ray structure of compound 9 (Figure S2)...S3 MTT assays of compound 3, 7-9 and 15on human cancer cells (Figure S3 and S4)...S4-5 Flow cytometry cell cycle analysis of Hela cells with compound 3, 7-9 and 15 (Figure S5 and Table S1)...S6-S7 NMR spectra of compound 3, 5-6, 7-9 and S8-S32 NMR spectra of compound 6 and the C6-epmier (a roughly 1:1 mixture)...s33-34 S1
2 X-ray structure of compound 8 Figure S1. X-ray structure of compound 8. The crystals of compound 8 were obtained by recrystallization from n-hexane S2
3 X-ray structure of compound 9 Figure S2. X-ray structure of compound 9. The crystals of compound 9 were obtained by recrystallization from n- hexane S3
4 MTT assays of compound 3, 7-9 and 15 on human cancer cells (a) (b) (c) Figure S3. Cell growth inhibitory effects of compound 3, 7-9 and 15 on (a) HeLa, (b) SMMC-7721 and (c) MGc80-3. S4
5 Cell cycle analysis of Hela cells with compound 3, 7-9 and 15 Figure S4. Cell cycle analysis of HeLa cells treated with compound 3, 7-9 and 15. The representative microscopic images of HeLa cells incubated with the chemicals, DMSO panel were parallel performed as control. Scale bar = 80 μm. S5
6 Flow cytometry analysis the cell cycle of HeLa cells treated with compound 3, 7-9 and 15 Figure S5. The representative histograms results of the Flow cytometry analysis (graphed by FlowJo 7.6.1). 2N and 4N indicate the diploid cells and replicated diploid cells, respectively. S6
7 Table S1. Flow cytometry data of the cell cycle analysis for Figure S5 (a-e) a G1 G2 S sub-g1 DMSO 64.8± ± ± ± (10 μm) 65.82± ± ± ± (20 μm) 71.61± ± ± ± (30 μm) 60.98± ± ± ± (40 μm) 63.37± ±0.98 ** 25.95± ± (50 μm) 62.02± ±0.93 ** 27.45± ± (60 μm) 56.99± ±0.63 ** 33.38± ± (10 μm) 67.77± ± ± ± (20 μm) 64.56± ± ± ± (30 μm) 64.49± ± ± ± (40 μm) 68.85± ±0.93 ** 19.83± ± (50 μm) 64.57± ±0.99 ** 22.97± ± (60 μm) 67.69± ±0.64 ** 21.46± ± (10 μm) 72.74±0.52 ** 8.78± ± ± (20 μm) 71.59±0.96 ** 5.74± ± ± (30 μm) 77.40±1.34 ** 7.47± ± ± (40 μm) 79.74±0.41 ** 6.62± ± ± (50 μm) 83.21±2.71 ** 7.04± ± ±0.35 8(60 μm) 80.65±1.23 ** 11.22±0.36 ** 8.14± ± (10 μm) 64.51±2.10 * 6.84± ± ±2.89 9(20 μm) 63.61±0.30 ** 9.08± ± ± (30 μm) 65.43±2.54 ** 0.68± ± ± (40 μm) 68.42±1.09 ** 1.45± ± ± (50 μm) 68.27±2.14 ** 0.47± ± ± (60 μm) 68.87±2.81 ** 0.49± ± ± (10 μm) 62.92± ±0.60 * 27.54± ± (20 μm) 67.14± ±0.80 * 24.21± ± (30 μm) 73.33± ±2.28 ** 12.47± ± (40 μm) 62.27± ±1.71 ** 9.33± ± (50 μm) 47.47± ±0.51 ** 8.73± ± (60 μm) 29.22± ±4.00 ** 18.41± ±4.93 a All values are the average of three assays (average ± S.D., * P<0.05, ** P<0.01). Tri-duplicates were performed for each concentration of the compounds. The sub-g1 values were showed independently, that is the percent from the whole cell population in the FACS sorting (sub G1%=sub-G1/(sub-G1+G1+G2+S) 100%). S7
8 1 H and 13 C NMR of compound 12 S8
9 1 H and 13 C NMR of compound 13 S9
10 1 H and 13 C NMR spectra of compound 5 (a mixture of β-keto esters) S10
11 1 H and 13 C NMR of compound 14 (single diastereomer) S11
12 1 H and 13 C NMR spectra of compound 6 S12
13 HSQC and COSY spectra of compound 6 S13
14 NOESY spectrum and the stereochemistry assignment of compound 6 S14
15 1 H and 13 C NMR spectra of compound 7 S15
16 HSQC and COSY spectra of compound 7 S16
17 NOESY spectra and the stereochemistry assignment of compound 7 S17
18 1 H and 13 C NMR spectra of compound 8 S18
19 HSQC and COSY spectra of compound 8 S19
20 NOESY spectra and the stereochemistry assignment of compound 8 S20
21 1 H and 13 C NMR spectra of compound 15 S21
22 HSQC and COSY spectra of compound 15 S22
23 NOESY spectra and the stereochemistry assignment of compound 15 S23
24 1 H and 13 C NMR spectra of compound 16 S24
25 1 H and 13 C NMR spectra of compound 17 S25
26 1 H and 13 C NMR spectra of compound 18 (a mixture of alcohol diastereomers) S26
27 1 H and 13 C NMR spectra of compound 9 S27
28 HSQC and COSY spectra of compound 9 S28
29 NOESY spectra and the stereochemistry assignment of compound 9 S29
30 1 H and 13 C NMR spectra of (±)-yezo otogirin C (3) S30
31 HSQC and COSY spectra of (±)-yezo otogirin C (3) S31
32 NOESY spectra and the stereochemistry assignment of (±)-yezo otogirin C (3) S32
33 1 H NMR and 13 C NMR spectra of 6 and epi-6-6 (a roughly 1:1 mixture) S33
34 NOESY spectra of the 1:1 mixture and the partial stereochemistry assignment of epi-6-6 S34
Marine Streptomyces sp. derived antimycin analogues. suppress HeLa cells via depletion HPV E6/E7 mediated by
Marine Streptomyces sp. derived antimycin analogues suppress HeLa cells via depletion HPV E6/E7 mediated by ROS-dependent ubiquitin proteasome system Weiyi Zhang 1, +, Qian Che 1, 2, +, Hongsheng Tan 1,
More informationA highly selective AIE fluorogen for lipid droplet imaging in live cells and green algae
Electronic Supporting Information highly selective IE fluorogen for lipid droplet imaging in live cells and green algae Erjing Wang, ab Engui Zhao, ab Yuning Hong, ab Jacky W. Y. Lam, ab and en Zhong Tang*
More informationElectronic Supplementary Information (ESI) A unique dansyl-based chromogenic chemosensor for rapid and ultrasensitive hydrazine detection
Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information (ESI) A unique dansyl-based chromogenic
More informationSUPPORTING INFORMATION FOR
SUPPORTING INFORMATION FOR Cytotoxic bagremycins from Mangrove-derived Streptomyces sp. Q22 Lei Chen, Weiyun Chai, Wenling Wang, Tengfei Song, Xiao-Yuan Lian,*,, Zhizhen Zhang,*, *Corresponding Authors.
More informationSupporting Information
Supporting Information A Selective Glutathione Probe based on AIE Fluorogen and its Application in Enzymatic Activity Assay Xiaoding Lou, 1,2, Yuning Hong, 2, Sijie Chen, 2 Chris Wai Tung Leung, 2 Na Zhao,
More informationGuajavadimer A, a dimeric caryophyllene-derived meroterpenoid with a new carbon skeleton from the leaves of Psidium guajava.
Guajavadimer A, a dimeric caryophyllene-derived meroterpenoid with a new carbon skeleton from the leaves of Psidium guajava. Chuang-Jun Li, Jie Ma, Hua Sun, Dan Zhang, and Dong-Ming Zhang* State Key Laboratory
More informationSupplementary Information
Supplementary Information New Highly Oxygenated Germacranolides from Carpesium divaricatum and their Cytotoxic Activity Tao Zhang, 1 Jin-Guang Si, 1, 2 Qiu-Bo Zhang, 1 Gang Ding, 1 and Zhong-Mei Zou 1*
More information2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein
Supplementary Information 2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked amino-modification products by acrolein Ayumi Tsutsui and Katsunori Tanaka* Biofunctional Synthetic Chemistry Laboratory, RIKEN
More informationChukvelutins A-C, 16-norphragmalin limonoids with unprecedented skeletons from Chukrasia tabularis var. velutina
Chukvelutins A-C, 16-norphragmalin limonoids with unprecedented skeletons from Chukrasia tabularis var. velutina Jun Luo, Jun-Song Wang, Jian-Guang Luo, Xiao-Bing Wang, and Ling-Yi Kong* Department of
More informationSupporting Information For
Supporting Information For MicroRNA-Catalyzed Cancer Therapeutics Based on DNA-Programmed Nanoparticle Complex Xucheng Luo, 1 Zhi Li, 1 Ganglin Wang, 1 Xuewen He, 2,3 Xiaoqin Shen, 1 Quanhong Sun, 1 Li
More informationZn 2+ Triggered Amide Tautomerization Produces a Highly Zn 2+ Selective, Cell Permeable and Ratiometric Fluorescent Sensor
Supporting Information For Zn 2+ Triggered Amide Tautomerization Produces a Highly Zn 2+ Selective, Cell Permeable and Ratiometric Fluorescent Sensor Zhaochao Xu,*,, Kyung-Hwa Baek, Ha Na Kim, Jingnan
More informationPreparation and Characterization of Cysteine Adducts of Deoxynivalenol
Preparation and Characterization of Cysteine Adducts of Deoxynivalenol Ana Stanic, Silvio Uhlig, Anita Solhaug, Frode Rise, Alistair L. Wilkins, Christopher O. Miles S1 Figure S1. 1 H spectrum of 1 (DON)
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information MnO 2 -induced synthesis of fluorescent polydopamine nanparticles
More informationDevelopment of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells
Supporting Information for Development of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells Sasa Zhu, Weiying Lin,* Lin Yuan State Key Laboratory of Chemo/Biosensing
More informationAcaulins A and B, Trimeric Macrodiolides from Acaulium. Table of Contents
Supporting Information Acaulins A and B, Trimeric Macrodiolides from Acaulium sp. H-JQSF Ting Ting Wang, Ying Jie Wei, Hui Ming Ge, Rui Hua Jiao, Ren Xiang Tan* * Corresponding author. E-mail: rxtan@nju.edu.cn
More informationElectronic Supporting Information for
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Electronic Supporting Information for Rhodamine based Turn-On Fluorescent Probe for Pb(II)
More informationSupporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting Information Enzyme-activatable Probe with a Self-immolative Linker for Rapid and Sensitive
More informationLoss of protein association causes cardiolipin degradation in Barth syndrome
SUPPLEMENTARY INFORMATION Loss of protein association causes cardiolipin degradation in Barth syndrome Yang Xu 1, Colin K.L. Phoon 2, Bob Berno 5, Kenneth D Souza 6, Esthelle Hoedt 4, Guoan Zhang 4, Thomas
More informationGraphene Quantum Dots-Band-Aids Used for Wound Disinfection
Supporting information Graphene Quantum Dots-Band-Aids Used for Wound Disinfection Hanjun Sun, Nan Gao, Kai Dong, Jinsong Ren, and Xiaogang Qu* Laboratory of Chemical Biology, Division of Biological Inorganic
More informationNature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA.
Supplementary Figure 1 Fluorescent titration of probe CPDSA. Fluorescent titration of probe CPDSA (10 um) upon addition of GSH in HEPES (10 mm, ph = 7.4) containing 10% DMSO. Each spectrum was recorded
More informationA smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging
More informationSupporting Information. Dichloroimidazolidinedione-Activated Beckmann Rearrangement of. Ketoximes for Accessing Amides and Lactams
Supporting Information Dichloroimidazolidinedione-Activated Beckmann Rearrangement of Ketoximes for Accessing Amides and Lactams Yu Gao, Jingjing Liu, Zhenjiang Li, Tianfo Guo, Songquan Xu, Hui Zhu, Fulan
More informationSupplementary Information
Supplementary Information J. Braz. Chem. Soc., Vol. 24, No. 12, S1-S21, 2013. Printed in Brazil - 2013 Sociedade Brasileira de Química 0103-5053 $6.00+0.00 SI Rui He, a,b,c Bochu Wang,*,b Toshiyuki Wakimoto,
More informationSelf-assembled ZnO nanoparticle capsules for carrying and delivering isotretinoin to cancer cells
Supporting Information Self-assembled ZnO nanoparticle capsules for carrying and delivering isotretinoin to cancer cells Wei Zhao, Ji-Shi Wei, Peng Zhang, Jie Chen, Ji-Lie Kong,,, * Lian-Hua Sun, Huan-Ming
More informationSynthesis, evaluation of anti-hiv-1 and anti-hcv activity of novel 2,3 -dideoxy- 2,2 -difluoro-4 -azanucleosides
Synthesis, evaluation of anti-hiv-1 and anti-hcv activity of novel 2,3 -dideoxy- 2,2 -difluoro-4 -azanucleosides Saúl Martínez-Montero, a,b Susana Fernández, a Yogesh S. Sanghvi, c Emmanuel A. Theodorakis,*
More informationSupplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
More informationSupporting Information
Supporting Information Cells cultured on core-shell photonic crystal barcodes for drug screening Fanfan Fu, Luoran Shang, Fuyin Zheng, Zhuoyue Chen, Huan Wang, Jie Wang, Zhongze Gu, Yuanjin Zhao* State
More informationSupporting Information
Supporting Information A single design strategy for dual sensitive ph probe with a suitable range to map ph in living cells Kang-Kang Yu, Ji-Ting Hou, Kun Li, * Qian Yao, Jin Yang, Ming-Yu Wu, Yong-Mei
More informationSUPPLEMENTAL DATA. Cytochrome P450-type hydroxylation and epoxidation in a tyrosine-liganded hemoprotein, catalase-related allene oxide synthase
SUPPLEMENTAL DATA Cytochrome P450-type hydroxylation and epoxidation in a tyrosine-liganded hemoprotein, catalase-related allene oxide synthase William E. Boeglin & Alan R. Brash Fig. S1 SP-HPLC separation
More informationSupporting information
Supporting information Conformationally Induced Off-On Cell Membrane Chemosensor Targeting Receptor Protein-Tyrosine Kinases for in Vivo and in Vitro Fluorescence Imaging of Cancers Yang Jiao,, Jiqiu Yin,
More informationA novel quinoline-based two-photon fluorescent probe for detecting Cd 2+ in vitro and in vivo
Supporting Information A novel quinoline-based two-photon fluorescent probe for detecting Cd 2+ in vitro and in vivo Yiming Li, a,b Hanbao Chong, a Xiangming Meng,* a Shuxin Wang, a Manzhou Zhu a and Qingxiang
More informationTWO NEW ELLAGIC ACID GLYCOSIDES FROM LEAVES OF DIPLOPANAX STACHYANTHUS
Journal of Asian Natural Products Research, December 2004, Vol. 6 (4), pp. 271 276 TWO NEW ELLAGIC ACID GLYCOSIDES FROM LEAVES OF DIPLOPANAX STACHYANTHUS XIAO-HONG YAN and YUE-WEI GUO* State Key Laboratory
More informationSupporting Information. Design of LVFFARK and LVFFARK-Functionalized Nanoparticles. for Inhibiting Amyloid β-protein Fibrillation and Cytotoxicity
Supporting Information Design of LVFFARK and LVFFARK-Functionalized Nanoparticles for Inhibiting Amyloid β-protein Fibrillation and Cytotoxicity Neng Xiong, Xiao-Yan Dong, Jie Zheng, Fu-Feng Liu, * and
More informationApplying Molecular Networking for the Detection of
Supporting Information Applying Molecular Networking for the Detection of Natural Sources and Analogues of the Selective Gq Protein Inhibitor FR900359 Raphael Reher, Markus Kuschak, Nina Heycke, Suvi Annala,
More informationSupporting Information. Light-enhanced hypoxia-response of conjugated polymer nanocarrier. for successive synergistic photodynamic and chemo-therapy
Supporting Information Light-enhanced hypoxia-response of conjugated polymer nanocarrier for successive synergistic photodynamic and chemo-therapy Xiaolong Zhang a,d, Ming Wu a,d, Jiong Li a,c,d, Shanyou
More informationReal-Time the Monitoring Mitophagy Process by A Photostable. Fluorescent Mitochondrion-Specific Bioprobe with AIE. Characteristic
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Real-Time the Monitoring Mitophagy Process by A Photostable
More informationThermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein
Supplementary Methods Thermal shift assays Thermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein unfolding was examined by monitoring the fluorescence of ANS (1-anilinonaphthalene-8-
More informationSupporting Information
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting Information A Red Emitting Mitochondrial-targeted AIE Probe as an Indicator for Membrane
More informationCarbon-1 versus carbon-3 linkage of D-galactose to porphyrins: Synthesis, uptake, and photodynamic efficiency
Supporting information for Carbon-1 versus carbon-3 linkage of D-galactose to porphyrins: Synthesis, uptake, and photodynamic efficiency Patrícia M. R. Pereira #, Waqar Rizvi #, N. V. S. Dinesh K. Bhupathiraju,
More informationSupplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.
Supplementary Information Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Various concentrations of Ent, DHBA or ABAH were pre-incubated for 10 min with LPO (50
More informationTHE JOURNAL OF ANTIBIOTICS. Polyketomycin, a New Antibiotic from Streptomyces sp. MK277-AF1. II. Structure Determination
THE JOURNAL OF ANTIBIOTICS Polyketomycin, a New Antibiotic from Streptomyces sp. MK277-AF1 II. Structure Determination ISAO MOMOSE, WEI CHEN, HIKARU NAKAMURA, HIROSHI NAGANAWA, HIRONOBU IINUMA and TOMIO
More informationSupplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the
Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid
More informationFig.S1 ESI-MS spectrum of reaction of ApA and THPTb after 16 h.
Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Experiment Cleavage of dinucleotides Dinucleotides (ApA, CpC, GpG, UpU) were purchased from
More informationYu Ping Feng San reverses cisplatin-induced multi-drug resistance in lung cancer cells via regulating drug transporters and p62/traf6 signaling
Yu Ping Feng San reverses cisplatin-induced multi-drug resistance in lung cancer cells via regulating drug transporters and p/traf signaling Jian-shu Lou,,LuYan, Cathy W. C. Bi,, Gallant K.L. Chan,Qi-YunWu,
More informationSupporting Information
Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 212. Supporting Information for Adv. Funct. Mater., DOI:.2/adfm.2122233 MnO Nanocrystals: A Platform for Integration of MRI and Genuine
More informationScheme S1. Synthesis of glycose-amino ligand.
Scheme S1. Synthesis of glycose-amino ligand. 5-Chloro-1-pentyl-2,3,4,6-tetra-O-acetyl-ß-D-glucopyranoside S2 To a solution of penta-o-acetyl-ß-d-glucopyranoside S1 (3.0 g, 7.69 mmol) and 5-chloropentan-1-ol
More informationHyaluronic Acid - Conjugated Graphene Oxide / Photosensitizer. Nanohybrids for Cancer Targeted Photodynamic Therapy
Supporting Information Hyaluronic Acid - Conjugated Graphene Oxide / Photosensitizer Nanohybrids for Cancer Targeted Photodynamic Therapy Fangyuan Li, a Sin-Jung Park, b Daishun Ling b, Wooram Park b,
More informationSupporting Information
Supporting Information Discovery of Pentacyclic Triterpenes as Potential Entry Inhibitors of Influenza Viruses Maorong Yu*,,, Longlong Si,, Yufei Wang, Yiming Wu, Fei Yu,, Pingxuan Jiao, Yongying Shi,
More informationNature Medicine: doi: /nm.2109
HIV 1 Infects Multipotent Progenitor Cells Causing Cell Death and Establishing Latent Cellular Reservoirs Christoph C. Carter, Adewunmi Onafuwa Nuga, Lucy A. M c Namara, James Riddell IV, Dale Bixby, Michael
More informationA Single fluorescent probe for Dual-imaging Viscosity and H 2 O 2 in Mitochondria with Different Fluorescence Signals in Living Cells
Supporting Information for A Single fluorescent probe for Dual-imaging Viscosity and H 2 O 2 in Mitochondria with Different Fluorescence Signals in Living Cells Mingguang Ren, Beibei Deng, Kai Zhou, Xiuqi
More informationDual-Responsive Polymer Micelles for. Target-Cell-Specific Anticancer Drug Delivery
Dual-Responsive Polymer Micelles for Target-Cell-Specific Anticancer Drug Delivery Xing Guo, Chunli Shi, Guang Yang, Jie Wang, Zhenghong Cai, and Shaobing Zhou,, * Key Laboratory of Advanced Technologies
More informationCoordination-responsive Selenium-containing Polymer Micelles for. Supporting information
Electronic Supplementary Material (ESI) for Chemical Science Coordination-responsive Selenium-containing Polymer Micelles for Controlled Drug Release Wei Cao, a Yang Li, b Yu Yi, a Shaobo Ji, a Lingwu
More informationSupporting Information. Chemoenzymatic Synthesis of Galectin Binding. Glycopolymers
Supporting Information Chemoenzymatic Synthesis of Galectin Binding Glycopolymers Jessica H. Ennist, Henry R. Termuehlen, Samuel P. Bernhard, Mackenzie S. Fricke, and Mary J. Cloninger* Department of Chemistry
More informationFabrication of Bio-based Polyelectrolyte Capsules and Their Application for Glucose-Triggered Insulin Delivery
Supporting Information for Fabrication of Bio-based Polyelectrolyte Capsules and Their Application for Glucose-Triggered Insulin Delivery Dongjian Shi a*, Maoshuang Ran a, Li Zhang a, He Huang a, Xiaojie
More informationSUPPLEMENTAL FIGURE LEGENDS
SUPPLEMENTAL FIGURE LEGENDS Fig. S1. SDSPAGE of crosslinked Aβ42 oligomers after SEC. After crosslinking of Aβ42 with or without Myr or RA, APS and Ru(bpy) were removed by SEC. The resulting products were
More informationDual-site Controlled and Lysosome-targeted ICT-PET-FRET. Fluorescent Probe for Monitoring ph Changes in Living Cells
Supporting information for Dual-site Controlled and Lysosome-targeted ICT-PET-FRET Fluorescent Probe for Monitoring ph Changes in Living Cells Baoli Dong, Xuezhen Song, Chao Wang, Xiuqi Kong, Yonghe Tang
More informationElectronic Supplementary Information. Quinine/Selectfluor Combination Induced Asymmetric Semipinacol Rearrangement of
Electronic Supplementary Information Quinine/Selectfluor Combination Induced Asymmetric Semipinacol Rearrangement of Allylic Alcohols: An Effective and Enantioselective Approach to α Quaternary β Fluoro
More informationSupplementary Figure 1. Structure models of the c4 variant proteins based on the structures of maltose binding protein (MBP) in red and TEM-1
Supplementary Figure 1. Structure models of the c4 variant proteins based on the structures of maltose binding protein (MBP) in red and TEM-1 β-lactamase (BLA) in blue. (a) c4 model and the close-up view
More informationSupporting Information
Supporting Information A new series of cytotoxic pyrazoline derivatives as potential anticancer agents induces cell cycle arrest and apoptosis Hong Wang 1,, Jinhong Zheng 1,, Weijie Xu 1, Cheng Chen 1,
More informationSerrata) Alkaline Phosphatase
Vol. 41, No. 5, April 1997 BIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL Pages 951-959 An Essential Tryptophan Residue of Green Crab (Syclla Serrata) Alkaline Phosphatase Wen-Zhu Zheng 1, Qing-Xi Chen
More informationSUPPORTING INFORMATION. For. ACS Applied Materials & Interfaces
SUPPRTIG IFRMATI For ACS Applied Materials & Interfaces S-1 Specific Fluorescence Probes for Lipid Droplets Based on Simple AIEgens Zhiming Wang,,,, # Chen Gui,,, Engui Zhao,, Jing Wang, # Xiaodong Li,
More informationPhotoswitchable micelles for the control of singlet-oxygen generation in. photodynamic therapies
Supporting Information for Photoswitchable micelles for the control of singlet-oxygen generation in photodynamic therapies Yan Zhai, Henk J. Busscher,,* Yong Liu, Zhenkun Zhang, Theo G. van Kooten, Linzhu
More informationInsight into aggregation-induced emission characteristics of red-emissive quinoline-malononitrile by cell tracking and real-time trypsin detection
Electronic Supplementary Information (ESI) Insight into aggregation-induced emission characteristics of red-emissive quinoline-malononitrile by cell tracking and real-time trypsin detection Andong Shao,
More informationA Photostable AIE Luminogen for Specific Mitochondrial
SUPPORTING INFORMATION A Photostable AIE Luminogen for Specific Mitochondrial Imaging and Tracking Chris Wai Tung Leung,,# Yuning Hong,,# Sijie Chen, Engui Zhao, Jacky Wing Yip Lam, and Ben Zhong Tang
More informationSupplementary Materials: An NMR Guided Screening Method for Selective Fragment Docking and Synthesis of a Warhead Inhibitor
Molecules 216, 21, 846; doi:1.339/molecules217846 S1 of S14 Supplementary Materials: An NMR Guided Screening Method for Selective Fragment Docking and Synthesis of a Warhead Inhibitor Ram B. Khattri, Daniel
More informationCellometer Image Cytometry for Cell Cycle Analysis
Cellometer Cytometry for Cell Cycle Analysis Importance of Cell Cycle Research Oncology: Since cancer cells often undergo abnormal cell division and proliferation, it is important to understand the cell
More informationRapid parallel measurements of macroautophagy and mitophagy in
Supplemental Figures Rapid parallel measurements of macroautophagy and mitophagy in mammalian cells using a single fluorescent biosensor Sargsyan A, Cai J, Fandino LB, Labasky ME, Forostyan T, Colosimo
More informationhttp / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology A431 . Western aza-dC FUT4-siRNA
ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2015 8 31 8 836 ~ 842 DOI 10 13865 /j cnki cjbmb 2015 08 09 FUT4-siRNA 5-aza-dC 1 3 * 1 1 3
More informationIn situ drug-receptor binding kinetics in single cells: a quantitative label-free study of anti-tumor drug resistance
Supplementary Information for In situ drug-receptor binding kinetics in single cells: a quantitative label-free study of anti-tumor drug resistance Wei Wang 1, Linliang Yin 2,3, Laura Gonzalez-Malerva
More informationGade Hyldgaard, Mette; Purup, Stig; Bond, Andrew David; Frete, Xavier; Qu, Haiyan; Teglgaard Jensen, Katrine; Christensen, Lars Porskjær
Syddansk Universitet Guaianolides and a seco-eudesmane from the resinous exudates of cushion bush (Leucophyta brownii) and evaluation of their cytostatic and anti-inflammatory activity Gade Hyldgaard,
More informationPart-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death
Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated
More informationBiodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery
Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing
More informationSupplementary materials. Multivalent mannose displaying nanoparticles constructed from
Supplementary materials Multivalent mannose displaying nanoparticles constructed from poly{styrene-co-[(maleic anhydride)-alt-styrene]} Rongming Su a, Lei Li b, Xiaoping Chen a, Jiahuai Han c, Shoufa Han*,a
More informationChemical composition, antioxidant and antibacterial activities of Tamarix balansae J. Gay aerial parts
SUPPLEMENTARY MATERIAL Chemical composition, antioxidant and antibacterial activities of Tamarix balansae J. Gay aerial parts Abbes Benmerache a, Mounira Benteldjoune a, Abdulmagid Alabdul Magid b, Amin
More informationFirst Detection of Unprotected 1,2-Anhydro Aldopyranoses
First Detection of Unprotected 1,2-Anhydro Aldopyranoses Kazunari Serizawa, Masato Noguchi, Gefei Li, and Shin-ichiro Shoda* Department of Biomolecular Engineering, Graduate School of Engineering, Tohoku
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Phosphine-Mediated Disulfide Metathesis in Aqueous Media Rémi Caraballo, Morakot Sakulsombat, and Olof Ramström* KTH - Royal Institute of Technology, Department of Chemistry Teknikringen
More informationSynthesis and preliminary evaluation of biological activity of glycoconjugates, analogues of acyclic uridine derivatives
Supporting information Synthesis and preliminary evaluation of biological activity of glycoconjugates, analogues of acyclic uridine derivatives Roman Komor 1*, Gabriela Pastuch-Gawołek 1,2 *,Ewelina Krol
More informationSupporting information
Supporting information Rhabdopeptide/Xenortide-like Peptides from Xenorhabdus innexi with Terminal Amines Showing Potent Anti-protozoal Activity Lei Zhao,, Marcel Kaiser,, Helge B. Bode *,, Molekulare
More informationMetal swap between Zn 7 metallothionein 3 and amyloid β Cu protects against amyloid β toxicity
Metal swap between Zn 7 metallothionein 3 and amyloid β Cu protects against amyloid β toxicity Supplementary Information Gabriele Meloni 1, Vanessa Sonois 2,3, Tamara Delaine 2, Luc Guilloreau 2, Audrey
More informationStudent Handout. This experiment allows you to explore the properties of chiral molecules. You have
Student Handout This experiment allows you to explore the properties of chiral molecules. You have learned that some compounds exist as enantiomers non-identical mirror images, such as your left and right
More informationFigure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
More informationCytochalasins from an Australian marine sediment-derived Phomopsis sp. (CMB-M0042F): Acid-mediated intra-molecular cycloadditions enhance
SUPPORTING INFORMATION Cytochalasins from an Australian marine sediment-derived Phomopsis sp. (CMB-M42F): Acid-mediated intra-molecular cycloadditions enhance chemical diversity Zhuo Shang, Ritesh Raju,
More informationSynthesis of an Alleged Byproduct Precursor in Iodixanol Preparation
SUPPORTING INFORMATION Synthesis of an Alleged Byproduct Precursor in Iodixanol Preparation Marianne Bore Haarr, Emil Lindbäck, Torfinn Håland, * and Magne O. Sydnes * Department of Mathematics and Natural
More informationSix novel steroids from culture of basidiomycete Polyporus ellisii
Regular Article Nat. Prod. Bioprospect. 2012, 2, 240 244 DOI 10.1007/s13659-012-0058-4 Six novel steroids from culture of basidiomycete Polyporus ellisii Shuang WANG, a,b Ling ZHANG, a Liang-Yan LIU, a,b
More informationSupporting Information. Metabolic plasticity in CLL: Adaptation to the hypoxic niche
Supporting Information Metabolic plasticity in CLL: Adaptation to the hypoxic niche Katarzyna M. Koczula a, Christian Ludwig a, Rachel Hayden b, Laura Cronin b, Guy Pratt a,d, Helen Parry a, Daniel Tennant
More informationProtein tyrosine phosphatase 1B targets PITX1/p120RasGAP. thus showing therapeutic potential in colorectal carcinoma
Protein tyrosine phosphatase 1B targets PITX1/p120RasGAP thus showing therapeutic potential in colorectal carcinoma Hao-Wei Teng, Man-Hsin Hung, Li-Ju Chen, Mao-Ju Chang, Feng-Shu Hsieh, Ming-Hsien Tsai,
More informationbio-mof-1 DMASM Wavenumber (cm -1 ) Supplementary Figure S1 FTIR spectra of bio-mof-1, DMASMI, and bio-mof-1 DMASM.
bio-mof-1 Transmittance bio-mof-1 DMASM DMASMI 2000 1500 1000 500 Wavenumber (cm -1 ) Supplementary Figure S1 FTIR spectra of bio-mof-1, DMASMI, and bio-mof-1 DMASM. Intensity (a.u.) bio-mof-1 DMASM as
More informationSupporting Information
Supporting Information Developing Activity Localization Fluorescence Peptide Probe Using Thiol-Ene Click Reaction for Spatially Resolved Imaging of Caspase-8 in Live Cells Wei Liu,, Si-Jia Liu,, Yong-Qing
More informationIdentification of novel endophenaside antibiotics produced by Kitasatospora sp. MBT66
SUPPORTING INFORMATION belonging to the manuscript: Identification of novel endophenaside antibiotics produced by Kitasatospora sp. MBT66 by Changsheng Wu 1, 2, Gilles P. van Wezel 1, *, and Young Hae
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationSupplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),
Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence
More informationLysine analogue of Polymyxin B as a significant opportunity for photodynamic antimicrobial chemotherapy
SUPPORTING INFORMATION Lysine analogue of Polymyxin B as a significant opportunity for photodynamic antimicrobial chemotherapy Florent Le Guern, Tan-Sothea Ouk *, Catherine Ouk, Regis Vanderesse +, Yves
More informationNature Protocols: doi: /nprot Supplementary Figure 1
Supplementary Figure 1 Traditional electronic gating strategy for analysing cell death based on A5-FITC and 7-AAD. a, Flow cytometry analysis showing the traditional two-stage electronic gating strategy
More informationSupplementary Material (ESI) for Chemical Communications This journal is (c) The Royal Society of Chemistry 2008
Experimental Details Unless otherwise noted, all chemicals were purchased from Sigma-Aldrich Chemical Company and were used as received. 2-DOS and neamine were kindly provided by Dr. F. Huang. Paromamine
More informationA pillar[2]arene[3]hydroquinone which can self-assemble to a molecular zipper in the solid state
A pillar[2]arene[3]hydroquinone which can self-assemble to a molecular zipper in the solid state Mingguang Pan, Min Xue* Department of Chemistry, Zhejiang University, Hangzhou 310027, P. R. China Fax:
More informationSUPPLEMENTARY INFORMATION
Figure S1. Cleavage of uniquitin AAA -CPP TAT in vitro and in cells. a, b. In vitro two-dimensional 1 H- 15 N correlation spectrum of ubiquitin AAA -CPP TAT before (a) and after (b) Yeast Ubiquitin Hydrolase
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Simpterpenoid A, a Meroterpenoid with a Highly Functionalized Cyclohexadiene Moiety Featuring gem-propane-1,2-dione and Methylformate Groups, from the Mangrove-Derived Penicillium
More informationSulfate Radical-Mediated Degradation of Sulfadiazine by CuFeO 2 Rhombohedral Crystal-Catalyzed Peroxymonosulfate: Synergistic Effects and Mechanisms
Supporting Information for Sulfate Radical-Mediated Degradation of Sulfadiazine by CuFeO 2 Rhombohedral Crystal-Catalyzed Peroxymonosulfate: Synergistic Effects and Mechanisms Submitted by Yong Feng, Deli
More informationSupporting information. Thermosensitive Lipid Bilayer-Coated Mesoporous Carbon. Nanoparticles for Synergistic Thermochemotherapy of Tumor
Supporting information Thermosensitive Lipid Bilayer-Coated Mesoporous Carbon Nanoparticles for Synergistic Thermochemotherapy of Tumor Xian Li, Xiudan Wang, Luping Sha, Da Wang, Wei Shi, Qinfu Zhao*,,
More information