Supporting Information

Size: px
Start display at page:

Download "Supporting Information"

Transcription

1 Supporting Information A Systemic Study on the Biogenic Pathways of Yezo otogirins: Total Synthesis and Antitumor Activities of (±)-Yezo otogirin C and its Structural Analogues Wei Yang, Jingming Cao, Mengxun Zhang, Rongfeng Lan, Lizhi Zhu, Guangyan Du, Shuzhong He, * and Chi-Sing Lee, * Laboratory of Chemical Genomics, School of Chemical Biology and Biotechnology, Peking University Shenzhen Graduate School, Shenzhen University Town, Xili, Shenzhen , China; lizc@pkusz.edu.cn Institute of Research and Continuing Education, Hong Kong Baptist University (Shenzhen), Shenzhen , China School of Pharmaceutical Sciences, Guizhou University, Guiyang, Guizhou , China; she48@wisc.edu Table of Contents X-ray structure of compound 8 (Figure S1)...S2 X-ray structure of compound 9 (Figure S2)...S3 MTT assays of compound 3, 7-9 and 15on human cancer cells (Figure S3 and S4)...S4-5 Flow cytometry cell cycle analysis of Hela cells with compound 3, 7-9 and 15 (Figure S5 and Table S1)...S6-S7 NMR spectra of compound 3, 5-6, 7-9 and S8-S32 NMR spectra of compound 6 and the C6-epmier (a roughly 1:1 mixture)...s33-34 S1

2 X-ray structure of compound 8 Figure S1. X-ray structure of compound 8. The crystals of compound 8 were obtained by recrystallization from n-hexane S2

3 X-ray structure of compound 9 Figure S2. X-ray structure of compound 9. The crystals of compound 9 were obtained by recrystallization from n- hexane S3

4 MTT assays of compound 3, 7-9 and 15 on human cancer cells (a) (b) (c) Figure S3. Cell growth inhibitory effects of compound 3, 7-9 and 15 on (a) HeLa, (b) SMMC-7721 and (c) MGc80-3. S4

5 Cell cycle analysis of Hela cells with compound 3, 7-9 and 15 Figure S4. Cell cycle analysis of HeLa cells treated with compound 3, 7-9 and 15. The representative microscopic images of HeLa cells incubated with the chemicals, DMSO panel were parallel performed as control. Scale bar = 80 μm. S5

6 Flow cytometry analysis the cell cycle of HeLa cells treated with compound 3, 7-9 and 15 Figure S5. The representative histograms results of the Flow cytometry analysis (graphed by FlowJo 7.6.1). 2N and 4N indicate the diploid cells and replicated diploid cells, respectively. S6

7 Table S1. Flow cytometry data of the cell cycle analysis for Figure S5 (a-e) a G1 G2 S sub-g1 DMSO 64.8± ± ± ± (10 μm) 65.82± ± ± ± (20 μm) 71.61± ± ± ± (30 μm) 60.98± ± ± ± (40 μm) 63.37± ±0.98 ** 25.95± ± (50 μm) 62.02± ±0.93 ** 27.45± ± (60 μm) 56.99± ±0.63 ** 33.38± ± (10 μm) 67.77± ± ± ± (20 μm) 64.56± ± ± ± (30 μm) 64.49± ± ± ± (40 μm) 68.85± ±0.93 ** 19.83± ± (50 μm) 64.57± ±0.99 ** 22.97± ± (60 μm) 67.69± ±0.64 ** 21.46± ± (10 μm) 72.74±0.52 ** 8.78± ± ± (20 μm) 71.59±0.96 ** 5.74± ± ± (30 μm) 77.40±1.34 ** 7.47± ± ± (40 μm) 79.74±0.41 ** 6.62± ± ± (50 μm) 83.21±2.71 ** 7.04± ± ±0.35 8(60 μm) 80.65±1.23 ** 11.22±0.36 ** 8.14± ± (10 μm) 64.51±2.10 * 6.84± ± ±2.89 9(20 μm) 63.61±0.30 ** 9.08± ± ± (30 μm) 65.43±2.54 ** 0.68± ± ± (40 μm) 68.42±1.09 ** 1.45± ± ± (50 μm) 68.27±2.14 ** 0.47± ± ± (60 μm) 68.87±2.81 ** 0.49± ± ± (10 μm) 62.92± ±0.60 * 27.54± ± (20 μm) 67.14± ±0.80 * 24.21± ± (30 μm) 73.33± ±2.28 ** 12.47± ± (40 μm) 62.27± ±1.71 ** 9.33± ± (50 μm) 47.47± ±0.51 ** 8.73± ± (60 μm) 29.22± ±4.00 ** 18.41± ±4.93 a All values are the average of three assays (average ± S.D., * P<0.05, ** P<0.01). Tri-duplicates were performed for each concentration of the compounds. The sub-g1 values were showed independently, that is the percent from the whole cell population in the FACS sorting (sub G1%=sub-G1/(sub-G1+G1+G2+S) 100%). S7

8 1 H and 13 C NMR of compound 12 S8

9 1 H and 13 C NMR of compound 13 S9

10 1 H and 13 C NMR spectra of compound 5 (a mixture of β-keto esters) S10

11 1 H and 13 C NMR of compound 14 (single diastereomer) S11

12 1 H and 13 C NMR spectra of compound 6 S12

13 HSQC and COSY spectra of compound 6 S13

14 NOESY spectrum and the stereochemistry assignment of compound 6 S14

15 1 H and 13 C NMR spectra of compound 7 S15

16 HSQC and COSY spectra of compound 7 S16

17 NOESY spectra and the stereochemistry assignment of compound 7 S17

18 1 H and 13 C NMR spectra of compound 8 S18

19 HSQC and COSY spectra of compound 8 S19

20 NOESY spectra and the stereochemistry assignment of compound 8 S20

21 1 H and 13 C NMR spectra of compound 15 S21

22 HSQC and COSY spectra of compound 15 S22

23 NOESY spectra and the stereochemistry assignment of compound 15 S23

24 1 H and 13 C NMR spectra of compound 16 S24

25 1 H and 13 C NMR spectra of compound 17 S25

26 1 H and 13 C NMR spectra of compound 18 (a mixture of alcohol diastereomers) S26

27 1 H and 13 C NMR spectra of compound 9 S27

28 HSQC and COSY spectra of compound 9 S28

29 NOESY spectra and the stereochemistry assignment of compound 9 S29

30 1 H and 13 C NMR spectra of (±)-yezo otogirin C (3) S30

31 HSQC and COSY spectra of (±)-yezo otogirin C (3) S31

32 NOESY spectra and the stereochemistry assignment of (±)-yezo otogirin C (3) S32

33 1 H NMR and 13 C NMR spectra of 6 and epi-6-6 (a roughly 1:1 mixture) S33

34 NOESY spectra of the 1:1 mixture and the partial stereochemistry assignment of epi-6-6 S34

Marine Streptomyces sp. derived antimycin analogues. suppress HeLa cells via depletion HPV E6/E7 mediated by

Marine Streptomyces sp. derived antimycin analogues. suppress HeLa cells via depletion HPV E6/E7 mediated by Marine Streptomyces sp. derived antimycin analogues suppress HeLa cells via depletion HPV E6/E7 mediated by ROS-dependent ubiquitin proteasome system Weiyi Zhang 1, +, Qian Che 1, 2, +, Hongsheng Tan 1,

More information

A highly selective AIE fluorogen for lipid droplet imaging in live cells and green algae

A highly selective AIE fluorogen for lipid droplet imaging in live cells and green algae Electronic Supporting Information highly selective IE fluorogen for lipid droplet imaging in live cells and green algae Erjing Wang, ab Engui Zhao, ab Yuning Hong, ab Jacky W. Y. Lam, ab and en Zhong Tang*

More information

Electronic Supplementary Information (ESI) A unique dansyl-based chromogenic chemosensor for rapid and ultrasensitive hydrazine detection

Electronic Supplementary Information (ESI) A unique dansyl-based chromogenic chemosensor for rapid and ultrasensitive hydrazine detection Electronic Supplementary Material (ESI) for Journal of Materials Chemistry B. This journal is The Royal Society of Chemistry 2014 Electronic Supplementary Information (ESI) A unique dansyl-based chromogenic

More information

SUPPORTING INFORMATION FOR

SUPPORTING INFORMATION FOR SUPPORTING INFORMATION FOR Cytotoxic bagremycins from Mangrove-derived Streptomyces sp. Q22 Lei Chen, Weiyun Chai, Wenling Wang, Tengfei Song, Xiao-Yuan Lian,*,, Zhizhen Zhang,*, *Corresponding Authors.

More information

Supporting Information

Supporting Information Supporting Information A Selective Glutathione Probe based on AIE Fluorogen and its Application in Enzymatic Activity Assay Xiaoding Lou, 1,2, Yuning Hong, 2, Sijie Chen, 2 Chris Wai Tung Leung, 2 Na Zhao,

More information

Guajavadimer A, a dimeric caryophyllene-derived meroterpenoid with a new carbon skeleton from the leaves of Psidium guajava.

Guajavadimer A, a dimeric caryophyllene-derived meroterpenoid with a new carbon skeleton from the leaves of Psidium guajava. Guajavadimer A, a dimeric caryophyllene-derived meroterpenoid with a new carbon skeleton from the leaves of Psidium guajava. Chuang-Jun Li, Jie Ma, Hua Sun, Dan Zhang, and Dong-Ming Zhang* State Key Laboratory

More information

Supplementary Information

Supplementary Information Supplementary Information New Highly Oxygenated Germacranolides from Carpesium divaricatum and their Cytotoxic Activity Tao Zhang, 1 Jin-Guang Si, 1, 2 Qiu-Bo Zhang, 1 Gang Ding, 1 and Zhong-Mei Zou 1*

More information

2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein

2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein Supplementary Information 2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked amino-modification products by acrolein Ayumi Tsutsui and Katsunori Tanaka* Biofunctional Synthetic Chemistry Laboratory, RIKEN

More information

Chukvelutins A-C, 16-norphragmalin limonoids with unprecedented skeletons from Chukrasia tabularis var. velutina

Chukvelutins A-C, 16-norphragmalin limonoids with unprecedented skeletons from Chukrasia tabularis var. velutina Chukvelutins A-C, 16-norphragmalin limonoids with unprecedented skeletons from Chukrasia tabularis var. velutina Jun Luo, Jun-Song Wang, Jian-Guang Luo, Xiao-Bing Wang, and Ling-Yi Kong* Department of

More information

Supporting Information For

Supporting Information For Supporting Information For MicroRNA-Catalyzed Cancer Therapeutics Based on DNA-Programmed Nanoparticle Complex Xucheng Luo, 1 Zhi Li, 1 Ganglin Wang, 1 Xuewen He, 2,3 Xiaoqin Shen, 1 Quanhong Sun, 1 Li

More information

Zn 2+ Triggered Amide Tautomerization Produces a Highly Zn 2+ Selective, Cell Permeable and Ratiometric Fluorescent Sensor

Zn 2+ Triggered Amide Tautomerization Produces a Highly Zn 2+ Selective, Cell Permeable and Ratiometric Fluorescent Sensor Supporting Information For Zn 2+ Triggered Amide Tautomerization Produces a Highly Zn 2+ Selective, Cell Permeable and Ratiometric Fluorescent Sensor Zhaochao Xu,*,, Kyung-Hwa Baek, Ha Na Kim, Jingnan

More information

Preparation and Characterization of Cysteine Adducts of Deoxynivalenol

Preparation and Characterization of Cysteine Adducts of Deoxynivalenol Preparation and Characterization of Cysteine Adducts of Deoxynivalenol Ana Stanic, Silvio Uhlig, Anita Solhaug, Frode Rise, Alistair L. Wilkins, Christopher O. Miles S1 Figure S1. 1 H spectrum of 1 (DON)

More information

Electronic Supplementary Information

Electronic Supplementary Information Electronic Supplementary Material (ESI) for Nanoscale. This journal is The Royal Society of Chemistry 2016 Electronic Supplementary Information MnO 2 -induced synthesis of fluorescent polydopamine nanparticles

More information

Development of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells

Development of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells Supporting Information for Development of a near-infrared fluorescent probe for monitoring hydrazine in serum and living cells Sasa Zhu, Weiying Lin,* Lin Yuan State Key Laboratory of Chemo/Biosensing

More information

Acaulins A and B, Trimeric Macrodiolides from Acaulium. Table of Contents

Acaulins A and B, Trimeric Macrodiolides from Acaulium. Table of Contents Supporting Information Acaulins A and B, Trimeric Macrodiolides from Acaulium sp. H-JQSF Ting Ting Wang, Ying Jie Wei, Hui Ming Ge, Rui Hua Jiao, Ren Xiang Tan* * Corresponding author. E-mail: rxtan@nju.edu.cn

More information

Electronic Supporting Information for

Electronic Supporting Information for Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2015 Electronic Supporting Information for Rhodamine based Turn-On Fluorescent Probe for Pb(II)

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting Information Enzyme-activatable Probe with a Self-immolative Linker for Rapid and Sensitive

More information

Loss of protein association causes cardiolipin degradation in Barth syndrome

Loss of protein association causes cardiolipin degradation in Barth syndrome SUPPLEMENTARY INFORMATION Loss of protein association causes cardiolipin degradation in Barth syndrome Yang Xu 1, Colin K.L. Phoon 2, Bob Berno 5, Kenneth D Souza 6, Esthelle Hoedt 4, Guoan Zhang 4, Thomas

More information

Graphene Quantum Dots-Band-Aids Used for Wound Disinfection

Graphene Quantum Dots-Band-Aids Used for Wound Disinfection Supporting information Graphene Quantum Dots-Band-Aids Used for Wound Disinfection Hanjun Sun, Nan Gao, Kai Dong, Jinsong Ren, and Xiaogang Qu* Laboratory of Chemical Biology, Division of Biological Inorganic

More information

Nature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA.

Nature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA. Supplementary Figure 1 Fluorescent titration of probe CPDSA. Fluorescent titration of probe CPDSA (10 um) upon addition of GSH in HEPES (10 mm, ph = 7.4) containing 10% DMSO. Each spectrum was recorded

More information

A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly

A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging

More information

Supporting Information. Dichloroimidazolidinedione-Activated Beckmann Rearrangement of. Ketoximes for Accessing Amides and Lactams

Supporting Information. Dichloroimidazolidinedione-Activated Beckmann Rearrangement of. Ketoximes for Accessing Amides and Lactams Supporting Information Dichloroimidazolidinedione-Activated Beckmann Rearrangement of Ketoximes for Accessing Amides and Lactams Yu Gao, Jingjing Liu, Zhenjiang Li, Tianfo Guo, Songquan Xu, Hui Zhu, Fulan

More information

Supplementary Information

Supplementary Information Supplementary Information J. Braz. Chem. Soc., Vol. 24, No. 12, S1-S21, 2013. Printed in Brazil - 2013 Sociedade Brasileira de Química 0103-5053 $6.00+0.00 SI Rui He, a,b,c Bochu Wang,*,b Toshiyuki Wakimoto,

More information

Self-assembled ZnO nanoparticle capsules for carrying and delivering isotretinoin to cancer cells

Self-assembled ZnO nanoparticle capsules for carrying and delivering isotretinoin to cancer cells Supporting Information Self-assembled ZnO nanoparticle capsules for carrying and delivering isotretinoin to cancer cells Wei Zhao, Ji-Shi Wei, Peng Zhang, Jie Chen, Ji-Lie Kong,,, * Lian-Hua Sun, Huan-Ming

More information

Synthesis, evaluation of anti-hiv-1 and anti-hcv activity of novel 2,3 -dideoxy- 2,2 -difluoro-4 -azanucleosides

Synthesis, evaluation of anti-hiv-1 and anti-hcv activity of novel 2,3 -dideoxy- 2,2 -difluoro-4 -azanucleosides Synthesis, evaluation of anti-hiv-1 and anti-hcv activity of novel 2,3 -dideoxy- 2,2 -difluoro-4 -azanucleosides Saúl Martínez-Montero, a,b Susana Fernández, a Yogesh S. Sanghvi, c Emmanuel A. Theodorakis,*

More information

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle

Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong

More information

Supporting Information

Supporting Information Supporting Information Cells cultured on core-shell photonic crystal barcodes for drug screening Fanfan Fu, Luoran Shang, Fuyin Zheng, Zhuoyue Chen, Huan Wang, Jie Wang, Zhongze Gu, Yuanjin Zhao* State

More information

Supporting Information

Supporting Information Supporting Information A single design strategy for dual sensitive ph probe with a suitable range to map ph in living cells Kang-Kang Yu, Ji-Ting Hou, Kun Li, * Qian Yao, Jin Yang, Ming-Yu Wu, Yong-Mei

More information

SUPPLEMENTAL DATA. Cytochrome P450-type hydroxylation and epoxidation in a tyrosine-liganded hemoprotein, catalase-related allene oxide synthase

SUPPLEMENTAL DATA. Cytochrome P450-type hydroxylation and epoxidation in a tyrosine-liganded hemoprotein, catalase-related allene oxide synthase SUPPLEMENTAL DATA Cytochrome P450-type hydroxylation and epoxidation in a tyrosine-liganded hemoprotein, catalase-related allene oxide synthase William E. Boeglin & Alan R. Brash Fig. S1 SP-HPLC separation

More information

Supporting information

Supporting information Supporting information Conformationally Induced Off-On Cell Membrane Chemosensor Targeting Receptor Protein-Tyrosine Kinases for in Vivo and in Vitro Fluorescence Imaging of Cancers Yang Jiao,, Jiqiu Yin,

More information

A novel quinoline-based two-photon fluorescent probe for detecting Cd 2+ in vitro and in vivo

A novel quinoline-based two-photon fluorescent probe for detecting Cd 2+ in vitro and in vivo Supporting Information A novel quinoline-based two-photon fluorescent probe for detecting Cd 2+ in vitro and in vivo Yiming Li, a,b Hanbao Chong, a Xiangming Meng,* a Shuxin Wang, a Manzhou Zhu a and Qingxiang

More information

TWO NEW ELLAGIC ACID GLYCOSIDES FROM LEAVES OF DIPLOPANAX STACHYANTHUS

TWO NEW ELLAGIC ACID GLYCOSIDES FROM LEAVES OF DIPLOPANAX STACHYANTHUS Journal of Asian Natural Products Research, December 2004, Vol. 6 (4), pp. 271 276 TWO NEW ELLAGIC ACID GLYCOSIDES FROM LEAVES OF DIPLOPANAX STACHYANTHUS XIAO-HONG YAN and YUE-WEI GUO* State Key Laboratory

More information

Supporting Information. Design of LVFFARK and LVFFARK-Functionalized Nanoparticles. for Inhibiting Amyloid β-protein Fibrillation and Cytotoxicity

Supporting Information. Design of LVFFARK and LVFFARK-Functionalized Nanoparticles. for Inhibiting Amyloid β-protein Fibrillation and Cytotoxicity Supporting Information Design of LVFFARK and LVFFARK-Functionalized Nanoparticles for Inhibiting Amyloid β-protein Fibrillation and Cytotoxicity Neng Xiong, Xiao-Yan Dong, Jie Zheng, Fu-Feng Liu, * and

More information

Applying Molecular Networking for the Detection of

Applying Molecular Networking for the Detection of Supporting Information Applying Molecular Networking for the Detection of Natural Sources and Analogues of the Selective Gq Protein Inhibitor FR900359 Raphael Reher, Markus Kuschak, Nina Heycke, Suvi Annala,

More information

Supporting Information. Light-enhanced hypoxia-response of conjugated polymer nanocarrier. for successive synergistic photodynamic and chemo-therapy

Supporting Information. Light-enhanced hypoxia-response of conjugated polymer nanocarrier. for successive synergistic photodynamic and chemo-therapy Supporting Information Light-enhanced hypoxia-response of conjugated polymer nanocarrier for successive synergistic photodynamic and chemo-therapy Xiaolong Zhang a,d, Ming Wu a,d, Jiong Li a,c,d, Shanyou

More information

Real-Time the Monitoring Mitophagy Process by A Photostable. Fluorescent Mitochondrion-Specific Bioprobe with AIE. Characteristic

Real-Time the Monitoring Mitophagy Process by A Photostable. Fluorescent Mitochondrion-Specific Bioprobe with AIE. Characteristic Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Electronic Supplementary Information Real-Time the Monitoring Mitophagy Process by A Photostable

More information

Thermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein

Thermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein Supplementary Methods Thermal shift assays Thermal shift binding experiments were carried out using Thermofluor 384 ELS system. Protein unfolding was examined by monitoring the fluorescence of ANS (1-anilinonaphthalene-8-

More information

Supporting Information

Supporting Information Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2015 Supporting Information A Red Emitting Mitochondrial-targeted AIE Probe as an Indicator for Membrane

More information

Carbon-1 versus carbon-3 linkage of D-galactose to porphyrins: Synthesis, uptake, and photodynamic efficiency

Carbon-1 versus carbon-3 linkage of D-galactose to porphyrins: Synthesis, uptake, and photodynamic efficiency Supporting information for Carbon-1 versus carbon-3 linkage of D-galactose to porphyrins: Synthesis, uptake, and photodynamic efficiency Patrícia M. R. Pereira #, Waqar Rizvi #, N. V. S. Dinesh K. Bhupathiraju,

More information

Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.

Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Supplementary Information Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Various concentrations of Ent, DHBA or ABAH were pre-incubated for 10 min with LPO (50

More information

THE JOURNAL OF ANTIBIOTICS. Polyketomycin, a New Antibiotic from Streptomyces sp. MK277-AF1. II. Structure Determination

THE JOURNAL OF ANTIBIOTICS. Polyketomycin, a New Antibiotic from Streptomyces sp. MK277-AF1. II. Structure Determination THE JOURNAL OF ANTIBIOTICS Polyketomycin, a New Antibiotic from Streptomyces sp. MK277-AF1 II. Structure Determination ISAO MOMOSE, WEI CHEN, HIKARU NAKAMURA, HIROSHI NAGANAWA, HIRONOBU IINUMA and TOMIO

More information

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the

Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the Supplementary Figure 1. Establishment of prostacyclin-secreting hmscs. (a) PCR showed the integration of the COX-1-10aa-PGIS transgene into the genomic DNA of hmscs (PGI2- hmscs). Native hmscs and plasmid

More information

Fig.S1 ESI-MS spectrum of reaction of ApA and THPTb after 16 h.

Fig.S1 ESI-MS spectrum of reaction of ApA and THPTb after 16 h. Electronic Supplementary Material (ESI) for RSC Advances. This journal is The Royal Society of Chemistry 2014 Experiment Cleavage of dinucleotides Dinucleotides (ApA, CpC, GpG, UpU) were purchased from

More information

Yu Ping Feng San reverses cisplatin-induced multi-drug resistance in lung cancer cells via regulating drug transporters and p62/traf6 signaling

Yu Ping Feng San reverses cisplatin-induced multi-drug resistance in lung cancer cells via regulating drug transporters and p62/traf6 signaling Yu Ping Feng San reverses cisplatin-induced multi-drug resistance in lung cancer cells via regulating drug transporters and p/traf signaling Jian-shu Lou,,LuYan, Cathy W. C. Bi,, Gallant K.L. Chan,Qi-YunWu,

More information

Supporting Information

Supporting Information Copyright WILEY-VCH Verlag GmbH & Co. KGaA, 69469 Weinheim, Germany, 212. Supporting Information for Adv. Funct. Mater., DOI:.2/adfm.2122233 MnO Nanocrystals: A Platform for Integration of MRI and Genuine

More information

Scheme S1. Synthesis of glycose-amino ligand.

Scheme S1. Synthesis of glycose-amino ligand. Scheme S1. Synthesis of glycose-amino ligand. 5-Chloro-1-pentyl-2,3,4,6-tetra-O-acetyl-ß-D-glucopyranoside S2 To a solution of penta-o-acetyl-ß-d-glucopyranoside S1 (3.0 g, 7.69 mmol) and 5-chloropentan-1-ol

More information

Hyaluronic Acid - Conjugated Graphene Oxide / Photosensitizer. Nanohybrids for Cancer Targeted Photodynamic Therapy

Hyaluronic Acid - Conjugated Graphene Oxide / Photosensitizer. Nanohybrids for Cancer Targeted Photodynamic Therapy Supporting Information Hyaluronic Acid - Conjugated Graphene Oxide / Photosensitizer Nanohybrids for Cancer Targeted Photodynamic Therapy Fangyuan Li, a Sin-Jung Park, b Daishun Ling b, Wooram Park b,

More information

Supporting Information

Supporting Information Supporting Information Discovery of Pentacyclic Triterpenes as Potential Entry Inhibitors of Influenza Viruses Maorong Yu*,,, Longlong Si,, Yufei Wang, Yiming Wu, Fei Yu,, Pingxuan Jiao, Yongying Shi,

More information

Nature Medicine: doi: /nm.2109

Nature Medicine: doi: /nm.2109 HIV 1 Infects Multipotent Progenitor Cells Causing Cell Death and Establishing Latent Cellular Reservoirs Christoph C. Carter, Adewunmi Onafuwa Nuga, Lucy A. M c Namara, James Riddell IV, Dale Bixby, Michael

More information

A Single fluorescent probe for Dual-imaging Viscosity and H 2 O 2 in Mitochondria with Different Fluorescence Signals in Living Cells

A Single fluorescent probe for Dual-imaging Viscosity and H 2 O 2 in Mitochondria with Different Fluorescence Signals in Living Cells Supporting Information for A Single fluorescent probe for Dual-imaging Viscosity and H 2 O 2 in Mitochondria with Different Fluorescence Signals in Living Cells Mingguang Ren, Beibei Deng, Kai Zhou, Xiuqi

More information

Dual-Responsive Polymer Micelles for. Target-Cell-Specific Anticancer Drug Delivery

Dual-Responsive Polymer Micelles for. Target-Cell-Specific Anticancer Drug Delivery Dual-Responsive Polymer Micelles for Target-Cell-Specific Anticancer Drug Delivery Xing Guo, Chunli Shi, Guang Yang, Jie Wang, Zhenghong Cai, and Shaobing Zhou,, * Key Laboratory of Advanced Technologies

More information

Coordination-responsive Selenium-containing Polymer Micelles for. Supporting information

Coordination-responsive Selenium-containing Polymer Micelles for. Supporting information Electronic Supplementary Material (ESI) for Chemical Science Coordination-responsive Selenium-containing Polymer Micelles for Controlled Drug Release Wei Cao, a Yang Li, b Yu Yi, a Shaobo Ji, a Lingwu

More information

Supporting Information. Chemoenzymatic Synthesis of Galectin Binding. Glycopolymers

Supporting Information. Chemoenzymatic Synthesis of Galectin Binding. Glycopolymers Supporting Information Chemoenzymatic Synthesis of Galectin Binding Glycopolymers Jessica H. Ennist, Henry R. Termuehlen, Samuel P. Bernhard, Mackenzie S. Fricke, and Mary J. Cloninger* Department of Chemistry

More information

Fabrication of Bio-based Polyelectrolyte Capsules and Their Application for Glucose-Triggered Insulin Delivery

Fabrication of Bio-based Polyelectrolyte Capsules and Their Application for Glucose-Triggered Insulin Delivery Supporting Information for Fabrication of Bio-based Polyelectrolyte Capsules and Their Application for Glucose-Triggered Insulin Delivery Dongjian Shi a*, Maoshuang Ran a, Li Zhang a, He Huang a, Xiaojie

More information

SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTAL FIGURE LEGENDS SUPPLEMENTAL FIGURE LEGENDS Fig. S1. SDSPAGE of crosslinked Aβ42 oligomers after SEC. After crosslinking of Aβ42 with or without Myr or RA, APS and Ru(bpy) were removed by SEC. The resulting products were

More information

Dual-site Controlled and Lysosome-targeted ICT-PET-FRET. Fluorescent Probe for Monitoring ph Changes in Living Cells

Dual-site Controlled and Lysosome-targeted ICT-PET-FRET. Fluorescent Probe for Monitoring ph Changes in Living Cells Supporting information for Dual-site Controlled and Lysosome-targeted ICT-PET-FRET Fluorescent Probe for Monitoring ph Changes in Living Cells Baoli Dong, Xuezhen Song, Chao Wang, Xiuqi Kong, Yonghe Tang

More information

Electronic Supplementary Information. Quinine/Selectfluor Combination Induced Asymmetric Semipinacol Rearrangement of

Electronic Supplementary Information. Quinine/Selectfluor Combination Induced Asymmetric Semipinacol Rearrangement of Electronic Supplementary Information Quinine/Selectfluor Combination Induced Asymmetric Semipinacol Rearrangement of Allylic Alcohols: An Effective and Enantioselective Approach to α Quaternary β Fluoro

More information

Supplementary Figure 1. Structure models of the c4 variant proteins based on the structures of maltose binding protein (MBP) in red and TEM-1

Supplementary Figure 1. Structure models of the c4 variant proteins based on the structures of maltose binding protein (MBP) in red and TEM-1 Supplementary Figure 1. Structure models of the c4 variant proteins based on the structures of maltose binding protein (MBP) in red and TEM-1 β-lactamase (BLA) in blue. (a) c4 model and the close-up view

More information

Supporting Information

Supporting Information Supporting Information A new series of cytotoxic pyrazoline derivatives as potential anticancer agents induces cell cycle arrest and apoptosis Hong Wang 1,, Jinhong Zheng 1,, Weijie Xu 1, Cheng Chen 1,

More information

Serrata) Alkaline Phosphatase

Serrata) Alkaline Phosphatase Vol. 41, No. 5, April 1997 BIOCHEMISTRY and MOLECULAR BIOLOGY INTERNATIONAL Pages 951-959 An Essential Tryptophan Residue of Green Crab (Syclla Serrata) Alkaline Phosphatase Wen-Zhu Zheng 1, Qing-Xi Chen

More information

SUPPORTING INFORMATION. For. ACS Applied Materials & Interfaces

SUPPORTING INFORMATION. For. ACS Applied Materials & Interfaces SUPPRTIG IFRMATI For ACS Applied Materials & Interfaces S-1 Specific Fluorescence Probes for Lipid Droplets Based on Simple AIEgens Zhiming Wang,,,, # Chen Gui,,, Engui Zhao,, Jing Wang, # Xiaodong Li,

More information

Photoswitchable micelles for the control of singlet-oxygen generation in. photodynamic therapies

Photoswitchable micelles for the control of singlet-oxygen generation in. photodynamic therapies Supporting Information for Photoswitchable micelles for the control of singlet-oxygen generation in photodynamic therapies Yan Zhai, Henk J. Busscher,,* Yong Liu, Zhenkun Zhang, Theo G. van Kooten, Linzhu

More information

Insight into aggregation-induced emission characteristics of red-emissive quinoline-malononitrile by cell tracking and real-time trypsin detection

Insight into aggregation-induced emission characteristics of red-emissive quinoline-malononitrile by cell tracking and real-time trypsin detection Electronic Supplementary Information (ESI) Insight into aggregation-induced emission characteristics of red-emissive quinoline-malononitrile by cell tracking and real-time trypsin detection Andong Shao,

More information

A Photostable AIE Luminogen for Specific Mitochondrial

A Photostable AIE Luminogen for Specific Mitochondrial SUPPORTING INFORMATION A Photostable AIE Luminogen for Specific Mitochondrial Imaging and Tracking Chris Wai Tung Leung,,# Yuning Hong,,# Sijie Chen, Engui Zhao, Jacky Wing Yip Lam, and Ben Zhong Tang

More information

Supplementary Materials: An NMR Guided Screening Method for Selective Fragment Docking and Synthesis of a Warhead Inhibitor

Supplementary Materials: An NMR Guided Screening Method for Selective Fragment Docking and Synthesis of a Warhead Inhibitor Molecules 216, 21, 846; doi:1.339/molecules217846 S1 of S14 Supplementary Materials: An NMR Guided Screening Method for Selective Fragment Docking and Synthesis of a Warhead Inhibitor Ram B. Khattri, Daniel

More information

Cellometer Image Cytometry for Cell Cycle Analysis

Cellometer Image Cytometry for Cell Cycle Analysis Cellometer Cytometry for Cell Cycle Analysis Importance of Cell Cycle Research Oncology: Since cancer cells often undergo abnormal cell division and proliferation, it is important to understand the cell

More information

Rapid parallel measurements of macroautophagy and mitophagy in

Rapid parallel measurements of macroautophagy and mitophagy in Supplemental Figures Rapid parallel measurements of macroautophagy and mitophagy in mammalian cells using a single fluorescent biosensor Sargsyan A, Cai J, Fandino LB, Labasky ME, Forostyan T, Colosimo

More information

http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology A431 . Western aza-dC FUT4-siRNA

http / /cjbmb. bjmu. edu. cn Chinese Journal of Biochemistry and Molecular Biology A431 . Western aza-dC FUT4-siRNA ISSN 1007-7626 CN 11-3870 / Q http / /cjbmb bjmu edu cn Chinese Journal of Biochemistry and Molecular Biology 2015 8 31 8 836 ~ 842 DOI 10 13865 /j cnki cjbmb 2015 08 09 FUT4-siRNA 5-aza-dC 1 3 * 1 1 3

More information

In situ drug-receptor binding kinetics in single cells: a quantitative label-free study of anti-tumor drug resistance

In situ drug-receptor binding kinetics in single cells: a quantitative label-free study of anti-tumor drug resistance Supplementary Information for In situ drug-receptor binding kinetics in single cells: a quantitative label-free study of anti-tumor drug resistance Wei Wang 1, Linliang Yin 2,3, Laura Gonzalez-Malerva

More information

Gade Hyldgaard, Mette; Purup, Stig; Bond, Andrew David; Frete, Xavier; Qu, Haiyan; Teglgaard Jensen, Katrine; Christensen, Lars Porskjær

Gade Hyldgaard, Mette; Purup, Stig; Bond, Andrew David; Frete, Xavier; Qu, Haiyan; Teglgaard Jensen, Katrine; Christensen, Lars Porskjær Syddansk Universitet Guaianolides and a seco-eudesmane from the resinous exudates of cushion bush (Leucophyta brownii) and evaluation of their cytostatic and anti-inflammatory activity Gade Hyldgaard,

More information

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death

Part-4. Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death Part-4 Cell cycle regulatory protein 5 (Cdk5) A novel target of ERK in Carb induced cell death 95 1. Introduction The process of replicating DNA and dividing cells can be described as a series of coordinated

More information

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery

Biodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing

More information

Supplementary materials. Multivalent mannose displaying nanoparticles constructed from

Supplementary materials. Multivalent mannose displaying nanoparticles constructed from Supplementary materials Multivalent mannose displaying nanoparticles constructed from poly{styrene-co-[(maleic anhydride)-alt-styrene]} Rongming Su a, Lei Li b, Xiaoping Chen a, Jiahuai Han c, Shoufa Han*,a

More information

Chemical composition, antioxidant and antibacterial activities of Tamarix balansae J. Gay aerial parts

Chemical composition, antioxidant and antibacterial activities of Tamarix balansae J. Gay aerial parts SUPPLEMENTARY MATERIAL Chemical composition, antioxidant and antibacterial activities of Tamarix balansae J. Gay aerial parts Abbes Benmerache a, Mounira Benteldjoune a, Abdulmagid Alabdul Magid b, Amin

More information

First Detection of Unprotected 1,2-Anhydro Aldopyranoses

First Detection of Unprotected 1,2-Anhydro Aldopyranoses First Detection of Unprotected 1,2-Anhydro Aldopyranoses Kazunari Serizawa, Masato Noguchi, Gefei Li, and Shin-ichiro Shoda* Department of Biomolecular Engineering, Graduate School of Engineering, Tohoku

More information

SUPPORTING INFORMATION

SUPPORTING INFORMATION SUPPORTING INFORMATION Phosphine-Mediated Disulfide Metathesis in Aqueous Media Rémi Caraballo, Morakot Sakulsombat, and Olof Ramström* KTH - Royal Institute of Technology, Department of Chemistry Teknikringen

More information

Synthesis and preliminary evaluation of biological activity of glycoconjugates, analogues of acyclic uridine derivatives

Synthesis and preliminary evaluation of biological activity of glycoconjugates, analogues of acyclic uridine derivatives Supporting information Synthesis and preliminary evaluation of biological activity of glycoconjugates, analogues of acyclic uridine derivatives Roman Komor 1*, Gabriela Pastuch-Gawołek 1,2 *,Ewelina Krol

More information

Supporting information

Supporting information Supporting information Rhabdopeptide/Xenortide-like Peptides from Xenorhabdus innexi with Terminal Amines Showing Potent Anti-protozoal Activity Lei Zhao,, Marcel Kaiser,, Helge B. Bode *,, Molekulare

More information

Metal swap between Zn 7 metallothionein 3 and amyloid β Cu protects against amyloid β toxicity

Metal swap between Zn 7 metallothionein 3 and amyloid β Cu protects against amyloid β toxicity Metal swap between Zn 7 metallothionein 3 and amyloid β Cu protects against amyloid β toxicity Supplementary Information Gabriele Meloni 1, Vanessa Sonois 2,3, Tamara Delaine 2, Luc Guilloreau 2, Audrey

More information

Student Handout. This experiment allows you to explore the properties of chiral molecules. You have

Student Handout. This experiment allows you to explore the properties of chiral molecules. You have Student Handout This experiment allows you to explore the properties of chiral molecules. You have learned that some compounds exist as enantiomers non-identical mirror images, such as your left and right

More information

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)

More information

Cytochalasins from an Australian marine sediment-derived Phomopsis sp. (CMB-M0042F): Acid-mediated intra-molecular cycloadditions enhance

Cytochalasins from an Australian marine sediment-derived Phomopsis sp. (CMB-M0042F): Acid-mediated intra-molecular cycloadditions enhance SUPPORTING INFORMATION Cytochalasins from an Australian marine sediment-derived Phomopsis sp. (CMB-M42F): Acid-mediated intra-molecular cycloadditions enhance chemical diversity Zhuo Shang, Ritesh Raju,

More information

Synthesis of an Alleged Byproduct Precursor in Iodixanol Preparation

Synthesis of an Alleged Byproduct Precursor in Iodixanol Preparation SUPPORTING INFORMATION Synthesis of an Alleged Byproduct Precursor in Iodixanol Preparation Marianne Bore Haarr, Emil Lindbäck, Torfinn Håland, * and Magne O. Sydnes * Department of Mathematics and Natural

More information

Six novel steroids from culture of basidiomycete Polyporus ellisii

Six novel steroids from culture of basidiomycete Polyporus ellisii Regular Article Nat. Prod. Bioprospect. 2012, 2, 240 244 DOI 10.1007/s13659-012-0058-4 Six novel steroids from culture of basidiomycete Polyporus ellisii Shuang WANG, a,b Ling ZHANG, a Liang-Yan LIU, a,b

More information

Supporting Information. Metabolic plasticity in CLL: Adaptation to the hypoxic niche

Supporting Information. Metabolic plasticity in CLL: Adaptation to the hypoxic niche Supporting Information Metabolic plasticity in CLL: Adaptation to the hypoxic niche Katarzyna M. Koczula a, Christian Ludwig a, Rachel Hayden b, Laura Cronin b, Guy Pratt a,d, Helen Parry a, Daniel Tennant

More information

Protein tyrosine phosphatase 1B targets PITX1/p120RasGAP. thus showing therapeutic potential in colorectal carcinoma

Protein tyrosine phosphatase 1B targets PITX1/p120RasGAP. thus showing therapeutic potential in colorectal carcinoma Protein tyrosine phosphatase 1B targets PITX1/p120RasGAP thus showing therapeutic potential in colorectal carcinoma Hao-Wei Teng, Man-Hsin Hung, Li-Ju Chen, Mao-Ju Chang, Feng-Shu Hsieh, Ming-Hsien Tsai,

More information

bio-mof-1 DMASM Wavenumber (cm -1 ) Supplementary Figure S1 FTIR spectra of bio-mof-1, DMASMI, and bio-mof-1 DMASM.

bio-mof-1 DMASM Wavenumber (cm -1 ) Supplementary Figure S1 FTIR spectra of bio-mof-1, DMASMI, and bio-mof-1 DMASM. bio-mof-1 Transmittance bio-mof-1 DMASM DMASMI 2000 1500 1000 500 Wavenumber (cm -1 ) Supplementary Figure S1 FTIR spectra of bio-mof-1, DMASMI, and bio-mof-1 DMASM. Intensity (a.u.) bio-mof-1 DMASM as

More information

Supporting Information

Supporting Information Supporting Information Developing Activity Localization Fluorescence Peptide Probe Using Thiol-Ene Click Reaction for Spatially Resolved Imaging of Caspase-8 in Live Cells Wei Liu,, Si-Jia Liu,, Yong-Qing

More information

Identification of novel endophenaside antibiotics produced by Kitasatospora sp. MBT66

Identification of novel endophenaside antibiotics produced by Kitasatospora sp. MBT66 SUPPORTING INFORMATION belonging to the manuscript: Identification of novel endophenaside antibiotics produced by Kitasatospora sp. MBT66 by Changsheng Wu 1, 2, Gilles P. van Wezel 1, *, and Young Hae

More information

Supplementary Information and Figure legends

Supplementary Information and Figure legends Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC

More information

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S),

Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), Supplementary Figure 1. Characterization of human carotid plaques. (a) Flash-frozen human plaques were separated into vulnerable (V) and stable (S), regions which were then quantified for mean fluorescence

More information

Lysine analogue of Polymyxin B as a significant opportunity for photodynamic antimicrobial chemotherapy

Lysine analogue of Polymyxin B as a significant opportunity for photodynamic antimicrobial chemotherapy SUPPORTING INFORMATION Lysine analogue of Polymyxin B as a significant opportunity for photodynamic antimicrobial chemotherapy Florent Le Guern, Tan-Sothea Ouk *, Catherine Ouk, Regis Vanderesse +, Yves

More information

Nature Protocols: doi: /nprot Supplementary Figure 1

Nature Protocols: doi: /nprot Supplementary Figure 1 Supplementary Figure 1 Traditional electronic gating strategy for analysing cell death based on A5-FITC and 7-AAD. a, Flow cytometry analysis showing the traditional two-stage electronic gating strategy

More information

Supplementary Material (ESI) for Chemical Communications This journal is (c) The Royal Society of Chemistry 2008

Supplementary Material (ESI) for Chemical Communications This journal is (c) The Royal Society of Chemistry 2008 Experimental Details Unless otherwise noted, all chemicals were purchased from Sigma-Aldrich Chemical Company and were used as received. 2-DOS and neamine were kindly provided by Dr. F. Huang. Paromamine

More information

A pillar[2]arene[3]hydroquinone which can self-assemble to a molecular zipper in the solid state

A pillar[2]arene[3]hydroquinone which can self-assemble to a molecular zipper in the solid state A pillar[2]arene[3]hydroquinone which can self-assemble to a molecular zipper in the solid state Mingguang Pan, Min Xue* Department of Chemistry, Zhejiang University, Hangzhou 310027, P. R. China Fax:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Figure S1. Cleavage of uniquitin AAA -CPP TAT in vitro and in cells. a, b. In vitro two-dimensional 1 H- 15 N correlation spectrum of ubiquitin AAA -CPP TAT before (a) and after (b) Yeast Ubiquitin Hydrolase

More information

SUPPORTING INFORMATION

SUPPORTING INFORMATION SUPPORTING INFORMATION Simpterpenoid A, a Meroterpenoid with a Highly Functionalized Cyclohexadiene Moiety Featuring gem-propane-1,2-dione and Methylformate Groups, from the Mangrove-Derived Penicillium

More information

Sulfate Radical-Mediated Degradation of Sulfadiazine by CuFeO 2 Rhombohedral Crystal-Catalyzed Peroxymonosulfate: Synergistic Effects and Mechanisms

Sulfate Radical-Mediated Degradation of Sulfadiazine by CuFeO 2 Rhombohedral Crystal-Catalyzed Peroxymonosulfate: Synergistic Effects and Mechanisms Supporting Information for Sulfate Radical-Mediated Degradation of Sulfadiazine by CuFeO 2 Rhombohedral Crystal-Catalyzed Peroxymonosulfate: Synergistic Effects and Mechanisms Submitted by Yong Feng, Deli

More information

Supporting information. Thermosensitive Lipid Bilayer-Coated Mesoporous Carbon. Nanoparticles for Synergistic Thermochemotherapy of Tumor

Supporting information. Thermosensitive Lipid Bilayer-Coated Mesoporous Carbon. Nanoparticles for Synergistic Thermochemotherapy of Tumor Supporting information Thermosensitive Lipid Bilayer-Coated Mesoporous Carbon Nanoparticles for Synergistic Thermochemotherapy of Tumor Xian Li, Xiudan Wang, Luping Sha, Da Wang, Wei Shi, Qinfu Zhao*,,

More information