Microarray and QPCR applications for mirnas

Transcription

1 Microarray and QPCR appications for mirnas Cathy Cuter Fied Appication Scientist Stratagene Products Division

2 Introduction to mirna What are micrornas Non-coding sma RNAs (19-30 nt) 3 different forms: Pri- and pre-mirna: hairpin shaped mature mirna: bound to RISC compex Act in repression of transation or direct mrna degradation Impicated heaviy in disease (eg. cancer), deveopment, apoptosis, proiferation and differentiation Invoved in vira infections More than 700 human mirnas identified (Sanger mirbase 10.0) Impicated in reguation of up to 30% of a human genes Projected $100M to be awarded by the NIH for mirna-reated research in 2008* Cancer Genomics: Sma RNAs with big impacts *Source: NIH CRISP database at from Nature 435: (9 June 2005) 2

3 Introduction to mirna Why Are mirnas Important? Predicted to reguate expression of 30% of human genes Act as key reguators of many ceuar processes, such as: Eary deveopment Ce proiferation and apoptosis Fat metaboism Ce differentiation Invoved in vira infection processes Differentiay expressed mirnas are reported in many human cancers > 50% of mirna genes are ocated within regions associated with ampification, deetion, and transocation in cancer (Cain, G.A. et a PNAS : ) 3

4 Introduction to mirna Biogenesis in mammas Expression may be reguated by transcription factors monocistronic and poycistronic (40%) mirna genes expressed by po II promoter Intronic mirna genes (~50%) reguated with mrna that fanks mirna mirna transcripts can contain more than one mirna 4

5 Introduction to mirna Mode of Action Repression of Transation mirna mirna bound by RISC compex RISC bound mirna binds target mrna Bound mirna-risc bocks transation of mrna by ribosome 5

6 Introduction to mirna Mode of Action RNA Degradation P-body contains RNA that can no onger be transated and enzymes that are required for RNA decay and degradation mrna degradation aows for detecting effects of mirna using microarrays Rossi, J J 2005 Nature Ce Bio 7(7):

7 Interaction of mirna with mrna Famiy Grouping by Seed Region 5 Target mrna mirna 3 5 AAAAAAA 3 mirna hsa-et-7a hsa-et-7b hsa-et-7c hsa-et-7d hsa-et-7e hsa-et-7f hsa-mir-98 hsa-et-7g hsa-et-7i nuceotide sequence (5-3 ) seed UGAGGUAGUAGGUUGUAUAGUU UGAGGUAGUAGGUUGUGUGGUU UGAGGUAGUAGGUUGUAUGGUU AGAGGUAGUAGGUUGCAUAGU UGAGGUAGGAGGUUGUAUAGU UGAGGUAGUAGAUUGUAUAGUU UGAGGUAGUAAGUUGUAUUGUU UGAGGUAGUAGUUUGUACAGU UGAGGUAGUAGUUUGUGCUGU Perfect homoogy, 5 6-8nt of mirna (seed) one mirna may reguate hundreds of genes a gene may be reguated by more than one mirna 7

8 Introduction to mirna mirna Registry Searchabe database of a pubished mirna sequences and annotation Mouse and human are highy conserved Human is not conserved with pants Data can be downoaded from ftp site: ftp://ftpsanger.ac.uk/pub/mirbase 8

9 mirna qrt-pcr Methods and Microarray Methods QRT-PCR mirna detection methods are more specific than microarray methods. Microarray methods tend to show higher cross-hybridization which can ead to fase positives. Data shoud be confirmed by QRT-PCR Microarray methods are idea for profiing a sma number of sampes for many mirnas QRT-PCR methods are idea for: Profiing a arge number of sampes against a sma number of mirnas Profiing a moderate number of sampes against a moderate number of mirnas 9

10 Choose from a comprehensive set of microarray appications From one-dimensiona to muti-dimensiona with mutipe appications DNA RNA acgh CH 3 ChIP GX Spice Variants mirna Copy number Conduct highresoution, genome-wide profiing of DNA copy number changes Methyation Discover and monitor epigenetic modifications Transcription Factors Eucidate the roe that protein-dna interactions pay in transcription, repication, modification and repair mrna Expore gene transcription on a genome-wide basis mrna isoforms Perform goba interrogations of the transcriptome and identify aternative spice forms mirna Profiing Study micrornas and the roe they pay in gene reguation 10

11 Microarray work fow 11

12 Data Workfow Grid Tempate Grid Fie FE Protoco Grid and Measure Spots Reject Outier Pixes Subtract Background Correct Dye Biases 16-bit Tiff Image (uncompressed) Agient and non-agient microarrays scanned on Agient Scanner Agient microarrays scanned on GenePix Scanner Feature Extraction Software CGH anaytics GeneSpring Chip anaytics Import FTP Export QC Report Grid Shape Text JPEG MAGE-ML GEML Feature Extraction Resut Fies 12

13 Feature Extraction QC metrics QC Metrics DNA Anaytics QC metrics 13

14 Data quaity: feature sizes and density Features shoud be far enough apart to prevent ight eakage. Features shoud be big enough for perfect registration of each ayer (no burry edges), for individua feature statistics and higher confidence An abiity to increase density whie maintaining arge enough features without compromising statistica significance 14

15 Image Vaue in Data quaity Agient scanner at 5 micron resoution Other array image Agient 224K image 15

16 Agient s Microarray Patform Reiabe inkjet printing of phosphoamidite bases Sensitivity: The chemistry reiabiity aows synthesis of ong oigos that are highy sensitive and specific Fexibiity of microarrays, array is defined by eectronic fie. Ease of impementation Probe Design: Narrow TM, Unique Probes, Sef Structure, and GC content, A probes are empiricay tested. Probe Fideity can synthesize up to 200mer 16

17 Santa Cara Manufacturing Faciity Manufacturing Process Deveopment Bioinformatics Industria manufacturing Cass 10,000 cean room Wired directy into earray, aowing direct customer access to fuy customizabe products High performance inkjet printing enabes ong oigo manufacturing 17

18 Chaenges in mirna Profiing Sma size difficut to abe with high efficiency High sequence homoogy difficut to design probes with high specificity Presence of arger RNAs with highy homoogous sequences Expressed with arge dynamic range difficut to avoid compression Growing & changing database mirna Sequence #NT hsa-et-7a ugagguaguagguuguauaguu 22 hsa-et-7b ugagguaguagguugugugguu 22 hsa-et-7c ugagguaguagguuguaugguu 22 hsa-et-7d agagguaguagguugcauaguu 22 hsa-et-7e ugagguaggagguuguauaguu 22 hsa-et-7f ugagguaguagauuguauaguu 22 hsa-et-7g ugagguaguaguuuguacaguu 22 hsa-et-7i ugagguaguaguuugugcuguu 22 Sanger mirbase

19 mirna Arrays: Human mirna Microarray, v2.0: 799 distinct probe sets (723 human and 76 human vira) Human mirna Microarray, v1.0: 450 human distinct probe sets 19

20 Direct and Sensitive mirna Profiing Hui Wang, PhD Senior Scientist Agient Technoogies Back to Appications Patform 20

21 mirna Probe Design Strategy 1. Start design with fu-ength mirnaprobe sequence, attached to a stit sequence. 2. Utiize the C incorporated during abeing for additiona G-C base pair on 3 end of mirna to increase stabiity 3. Sequentiay shorten target-probe base pairing from 5 end of mirna during preiminary Tm baancing by cacuation. 4. Incorporate hairpin structure on probes to increase size specificity and probe:target stabiity. FINAL STEP: Seect Tm-baanced probes for each mirna empiricay using microarray data. 21

22 Work Fow Tota RNA (100 ng) Direct Labe with Cy-dye 100ng sampe input Direct probe abeing High specificity & sensitivity Labeed RNA Hybridize mirna Profie 8-pack 22

23 Specificity to Distinguish Homoogous mirnas % 70-84% 55-69% 40-54% 25-39% 10-24% 5-9% 0-4% Grey Number hsa-et-7 famiy mirna Sequence Length (nts) hsa-et-7a hsa-et-7b hsa-et-7c hsa-et-7d hsa-et-7e hsa-et-7f hsa-et-7g hsa-et-7i UGAGGUAGUAGGUUGUAUAGUU UGAGGUAGUAGGUUGUGUGGUU UGAGGUAGUAGGUUGUAUGGUU AGAGGUAGUAGGUUGCAUAGU UGAGGUAGGAGGUUGUAUAGU UGAGGUAGUAGAUUGUAUAGUU UGAGGUAGUAGUUUGUACAGU UGAGGUAGUAGUUUGUGCUGU

24 Direct mirna Measurement From Tota RNA Data shown are background-subtracted signas with no fitering or normaization. Tota RNA (Cy3) Each mirna has signas from mutipe probes Purified Sma RNA (Cy3) 24

25 mirna Profies Using 100ng Tota RNA Reproducibiity Differentia Expression Pacenta Brain Pacenta Pacenta 25

26 mirna Profies Independent of Sampe Input ng Tota RNA ng Tota RNA ng Tota RNA ng Tota RNA Consistent mirna profie for ow (25ng) vs high (1000ng) tota RNA input 26

27 mir-24 mir-34a Correation between microarray and quantitative RT-PCR resuts mir-96 mir-141 mir-139 mir-150 Quantitative RT-PCR (qpcr) reactions (orange bars) and microarray hybridizations (bue bars) were run in quadrupicate for each mirna species. mir-206 mir-218 mir-335 mir-424 qpcr Data Microarray Data 27

28 10 4 Linear Dynamic Range dme-mir-6 hsa-mir-296 hsa-mir-384 Synthetic mirnas were seected for typica and atypica sequence representations. Lowest and highest cacuated Tms are represented. Most mirnas are detectabe at the 0.2αmo-2fmo range. 10 hsa-mir-126* RNA Amount (fmos) 28

29 Patform Features, Benefits & Advantages Feature 8 x 15K format Optimized probe design and direct abeing Sma sampe input Use of tota RNA Benefit Process mutipe sampes on the same side Greater sensitivity and specificity Abiity to work with precious sampes Does not require size separation Advantage to Investigator Reduce costs Run parae experiments Detect ow abundance mirnas Detect highy homoogous mirnas Anayze new sampe types Conserve precious sampes Does not introduce any mirna isoation bias Easy to use Reduce hands-on time Broad dynamic range Compatibe with standard microarray patform Detect a possibe mirnas in sampe Correate mirna profies with GE and CGH data Comprehensive mirna profiing Requires ony singe capita investment Enabes integrated genomics 29

30 Response from Eary Access Customer We have shown for the first time that et-7 expression is frequenty reduced in ung cancers and that aterations in the mirna expression may have a prognostic impact on the surviva of surgicay treated ung cancer patients. Agient mirna arrays give us the comprehensive mirna expression profie with exceent performance on sensitivity and accuracy. I expect that the studies of Agient mirna array may utimatey provide a foundation for a new paradigm of the invovement of mirna in human oncogenesis. Dr. Takashi Takahashi Professor of Oncoogy Moecuar Carcinogenesis Nagoya University 30

31 Stratagene QPCR MicroRNA Studies Featuring: High-Specificity mirna QRT-PCR Detection Kit 31

32 Purification of mirna Chaenges in sma RNA Purification Spin coums Retention of sma RNAs on standard coumns not sufficient: Low yied of sma RNAs Speciaized soutions avaiabe: miracle mirna Isoation kit Enrichment of mirna species for increased sensitivity using speciaized soutions ike miracle Usuay Pheno-Choroform based cean up to avoid oss of sma RNAs Aternative methods ike SideStep (Ces-to-PCR) avaiabe 32

33 Purification of mirna Sampe Verification Bioanayzer Sma RNA kit RNA 6000Nano kit RNA 6000 Nano Kit Size range: nt Resuts: Integrity, Tota RNA amount, gdna contamination Sma RNA Kit NEW! Sma RNA Kit Size range: 6-150nt Resuts: mirna amount, Ratio and amount of other Sma RNA 33

34 Purification of mirna Sampe Verification Bioanayzer Sma RNA kit Sma RNA Pre-purified sma RNA (0-150 nt) mirna Peak enriched mirna fraction 34

35 mirna Detection Chaenges in QPCR Design chaenges: Sequence ength of mirnas is very short Lack of common nuceotide sequence to be used as priming site High sequence homoogy between different mirnas Presence of different forms of mirna in a ce 35

36 QRT-PCR Detection High-Specificity mirna QRT-PCR Detection Kit High-Specificity mirna QRT-PCR Detection Kit mirna 1st Strand cdna Synthesis Kit High-Specificity mirna QPCR Core Kit 36

37 Specificity of High-Specificity mirna QRT-PCR Detection Kit Discrimination between a et-7 famiy members using mirnaspecific PCRprimers. The same number of et-7 mirna (10 10 mirna synthetic tempates) were converted to cdna and detected with each of the et-7 mirna-specific primers (mirna-specific assay). Detection with each of the et-7 mirnaspecific primers (mirna-specific assay) Copy number of the matching primer and tempate was 100%. Copy number of a non-matching primer and tempate determined as a percentage of the matching primer and tempate (% reative detection) The number of mismatched nuceotides is indicated in coor as shown in the key (number of mismatches). 37

38 High-Specificity mirna QRT-PCR Detection Kit Features Detects mature mirna in 3 hours As itte as 15 ng of tota RNA input Variety of sampe types Lysed ces Tota RNA isoated from tissues Ce cutures FFPE tissues Sensitive detection down to 10 copies Singe-nuceotide discrimination Detection of up to 6,000 different mirna in a singe sampe preparation 38

39 High-Specificity mirna QRT-PCR Detection Kit Features Feature Sensitivity High-Specificity mirna QRT-PCR Detection Kit 33 copies in 3.3ng tota RNA (10 copies/ng) Tempate (owest) Tempate (recommended) Linearity # human assays 30pg tota RNA/600-6,000 mirna ng/600-6,000 mirna 7 ogs 50 human 39

40 High-Specificity mirna Detection Kit 50 mirna-specific primers based on human mirna seection was based on differentia expression in cancer and during deveopment most wi aso detect mouse and rat mirna human 50 mouse 41 (mir-106a) rat 40 (mir-15a, mir-106a) wi be adding another 8 mirna-specific primers to the ist human and mouse U6 primers for normaization primer design rues wi be avaiabe to customers on our website ot number from RT adapter primer has to be input to access primer design rues 40

41 Kit Performance: Assay Linearity cdnaprepared from 1ug HeLa tota RNA and using varying amounts as tempate in QPCR. Five different mirna of varying abundance, et-7a, et-7c, et-7i, mir-21 and mir-23a, were detected. Ct (drn) et-7c mir-23a et-7i mir-21 et-7a Amount of cdna (ng) tempate in QPCR 25 pg 3.3 ng cdna input. Detection of mirnas of varying abundance Linearity over 7 ogs (after Poy A taiing and cdna synthesis) 41

42 Introduction Detection of mirna Expression Breast Cancer Biomarker study Preserved breast tumor tissue sampes were obtained from ER positive and PR positive pre-menopausa women Women were treated post-surgery with tamoxifin. Cinica data indicated a wide range of mortaities (fu responder, partia responder, non responder). A sampes were from Caucasian women diagnosed with infitrating duct carcinoma and had been preserved 8 years prior to RNA extraction (FFPE tissues) Purpose Retrospective study to demonstrate our High-Specificity mirna QRT-PCR Detection kit successfuy detects mirna isoated from FFPE sampes. 42

43 Detection of mirna Expression in Breast Cancer Scott Basehore Nataia Novoradovskaya Sampe Preparation Deparaffinize and digest FFPE tissues Puverize frozen tissues in iquid nitrogen homogenize in Absoutey RNA ysis buffer: Lysate can be stored at -80 C separate RNA and gdna with acidified pheno Nuceic Acid Isoation and QC Isoate tota RNA using Absoutey RNA kit Isoate gdna from acidified pheno phase Isoate mirna from aqueous phase Resuts: Ct (drn) FFPE RNA sampe, 50 ng B2M GAPDH HER2 PGR Ki67 BIRC5 Frozen breast, norma FFPE breast cancer No Ct FFPE breast cancer FFPE breast cancer No Ct UHRR copies of et-7d per 10 ng sma RNA 1.00E E E E S RNA 1.00E+04 trna mouse brain mouse kidney mouse iver mouse testes rat ung sma RNA source HeLa S3 human pacenta 43

44 Detection of mirna Expression in Breast Cancer FFPE 1 Age 47 Differentiation Grade grade 2 TNM T2N0M0 Stage IIA No. Pos. ymph nodes 0 No of anayz ed ymph nodes 6 Tumor size 5 cm 2 42 grade 2 T1N0M0 IIA cm 3 51 grade 2-3 T2N1M0 IIB cm FFPE Location of distant metastasis Reapse (Y/N) w/in observati on time Disease-free surviva (mos) Death? Death from main disease 1 no no 84 mos no no 2 no no 65 mos no no 3 ung, bone yes 54 mos yes yes 44

45 Detection of mirna Expression in Breast Cancer 1.00E+03 Higher Simiarity between FFPE 1 and FFPE 2 than FFPE E+02 mir E+01 FFPE E+00 FFPE 2 FFPE E E E et-7a et-7b et-7c et-7e mir-21 mir-145 mir-23b mir-92-1 mir-29a mir-23a mir-29c mir-20a et-7d mir-15b et-7g et-7f mir-30c mir-25 et-7i mir-200b mir-16 mir-143 mir-107 mir-29b mir-199a mir-17-5p mir-15a mir-146a mir-331 mir-126 mir-19a mir-140 mir-17-3p mir-98 mir-146b mir-32 mir-155 mir-106a

46 1.00E E E E E+00 Detection of mirna Expression in Breast Cancer mirna Profiing in Breast Cancer FFPE Tissue RNA 46 et-7a et-7b et-7c et-7d et-7e et-7f et-7g et-7i mir-15b mir-16 mir-19a mir-20a mir-21 mir-23a mir-23b mir-25 mir-29a mir-29c mir-30c mir-92-1 mir-145 mir-146a mir-200b Aien mirna Predicted Copies

47 Detection of mirna Expression in Breast Cancer Concusion: mrna and mirna RNA isoated using the Absoutey RNA FFPE kit from FFPE tissues that had been preserved 8 years were of high quaity and suitabe for QPCR anaysis Fod differences of mirna eves during cancer progression from stage I to IIA and to IIB show significant up-reguation of mir-21. This is in agreement with various pubished resuts on soid tumors.* *Voinia, S., et a (2006) Proc Nat Acad Sci 103:

48 mirna Forward Primers Reative to Disease Types of Cancer Brain Badder Breast Coon Lung Pancreas Prostate Stomach mir-21 mir-21, mir-126, mir-143, mir-145, mir-188, mir-200b, mir-219, mir-331 mir-17-5p, mir-21, mir-29b-2, mir-126, mir-143, mir-145, mir-146, mir-155, mir-181b-1, mir-188, mir-200b, mir-210, mir-213, mir-219 mir-331 mir-17-3p, mir-17-5p, mir-20a, mir-21, mir-24-1, mir-24-2, mir-29b-2, mir-30c, mir-32, mir-106a, mir-107, mir- 126, mir-128b, mir-130a, mir-143, mir-145, mir-155, mir-188mir-191, mir-195, mir-200b, mir-218-2, mir- 219, mir-221, mir-331, mir-223 mir-17-5p, mir-21, mir-30a, mir-126, mir-128b, mir-143, mir-145, mir-155, mir-188, mir-189, mir-191, mir-199a-1, mir-200b, mir-210,mir-213, mir-219, mir-223, mir-331 mir-17-5p, mir-20a, mir-21, mir-24-1, mir-24-2, mir-25, mir-29b-2, mir-30c, mir-32, mir-92-2, mir-106a, mir-107, mir-126, mir-128b, mir-143, mir-145, mir-146, mir-181b-1, mir-188, mir-191, mir-199a-1, mir-200b, mir-214, mir-218-2, mir-219, mir-221, mir-331 mir-17-5p, mir-20a, mir-21, mir-25, mir-29b-2, mir-30c, mir-32, mir-92-2, mir-106a, mir-126, mir-143, mir-145, mir-146, mir-181b-1, mir-188, mir-191, mir-200b, mir-214, mir-218-2, mir-219, mir-223, mir-331 mir-21, mir-24-1, mir-24-2, mir-25, mir-92-2, mir-107, mir-191, mir-199a-1, mir-214, mir-218-2, mir-221, mir-223 Thymus mir-21, mir-126, mir-143, mir-145, mir-188, mir-200b, mir-219, mir

49 Stratagene s mirna Workfow Overview Sampe QC Sampe Preparation RNA miracle mirna Purification Kit Absoutey RNA SideStep mirna 1 st Strand cdna Synthesis MVP Tota Human RNA Labeing High-Specificity mirna QPCR Core Kit Detection QRT-PCR Specific mirna primers MX3000/3005P Vaidation QRT-PCR Microarray 49

50 mirna products from Agient Technoogies Microarray Patform: -Human mirna microarray kit (version 1.0) -mirna abeing reagent and hybridization kit -March 1: Mouse, Rat and Human (version 2.0) microarray kits 2100 Bioanayzer: Tota RNA Assays (for RNA integrity) -RNA 6000 Nano Kit -RNA 6000 Pico Kit -Sma RNA Kit (for anaysis of sma RNAs) Stratagene s qpcr: -High-Specificity mirna QRT-PCR Detection Kit -mirna Specific Forward Primers 50