Clonal Evolution of saml. Johnnie J. Orozco Hematology Fellows Conference May 11, 2012

Size: px
Start display at page:

Download "Clonal Evolution of saml. Johnnie J. Orozco Hematology Fellows Conference May 11, 2012"

Transcription

1 Clonal Evolution of saml Johnnie J. Orozco Hematology Fellows Conference May 11, 2012

2 CML: *bcr-abl and imatinib Melanoma: *braf and vemurafenib CRC: *k-ras and cetuximab Esophageal/Gastric: *Her-2/neu and trastuzumab GIST: *c-kit and imatinib NSCLC / Adeno: *EGFR and erlotinib

3 AML Heterogeneous disease Variable response to 7+3, and even HCT Age variability? (disease severity/genetics?) Cytogenetics: risk stratification Predictive prognostic

4 Three Traditional Cytogenetics Risk Groups Slovak et al., Blood 2000

5 Prognostics of Cytogenetics Medeiros et al., Blood 2010

6 Molecular markers can further risk stratify Dohner et al., Blood 2010

7

8 Mardis et al., NEJM 2009

9 Isocitrate DeHydrogenase: -mostly in NK -context dependent *w/ FLT3-ITD: dec relapse *w/o: incr relapse rates Mardis et al., NEJM 2009

10 Candidate Gene Approach Pathogenesis largely undefined AML Genome snapshot in time Prognostic vs therapeutic implications

11

12 Study Overview N=seven patients Whole Genome Sequencing of skin, bone marrow with saml to id saml specific somatic mutations Bone marrow sample for each patient from antecedent MDS genotyped Mutations tracked to define clonal architecture

13 Illumina Technology: Generate Fragments Mardis, Annu Rev Genomics Hum. Genet. 2008

14 Bind DNA Fragments Mardis, Annu Rev Genomics Hum. Genet. 2008

15 Bridge Amplification Mardis, Annu Rev Genomics Hum. Genet. 2008

16 DS Intermediate

17 DS Separated Mardis, Annu Rev Genomics Hum. Genet. 2008

18 Colonies of clusters

19 Determine first base Mardis, Annu Rev Genomics Hum. Genet. 2008

20 Capture first cycle Mardis, Annu Rev Genomics Hum. Genet. 2008

21 Prepare for next cycle Mardis, Annu Rev Genomics Hum. Genet. 2008

22 Sequence read over multiple cycles Mardis, Annu Rev Genomics Hum. Genet. 2008

23 Data alignment

24

25 Supp Fig 1c: Cell Sorting blasts minimal impact on mutant allele burden

26 Supp Fig 1a,b: BM Asp

27 I. Whole Genome Sequencing >95% coverage for samples

28 II. Recurrent Gene Mutations validated point mutations/ indels per saml genome in 168 genes among 7 samples Most were NOT recurrent mutations many randomly acquired, role in pathogenesis? Two recurrent mutations detected in two samples: loss of Function in myeloid tumor suppressors RUNX1 UMODL1

29 UMODL1 Mutated in patients w/ Multiple Myeloma, ovarian Cancer Expressed in normal CD34+ cells, and saml cells from all 7 patients Two mutations in conserved domains:

30 Compared to 200 de novo AML Identified 10 genes that were mutated in one saml and in at least 3 of 200 AML samples Seven of which are known to have recurrent mutations in AML Four not previously implicated in MDS/AML

31 Recurrent in 2 samples Not previously implicated in AML

32 New Associations CDH23- cadherin 23 Neurosensory epithelium, tip-link filaments at stereocilia SMC3- structural maintenance of chrom3 Hold sister chromatids UMODL1 ZSWIM4

33 U2AF1 Specific codon in multiple samples, may be gain of function Supported by enhanced alternative splicing in vitro

34 STAG2 Predicted protein truncation Reported to be often be deleted in AML and other cancers

35 IIb. Nonrecurrent mutations Nonrecurrent tier 1 mutations implicated at least 11 pathways All pathways altered in seven patients

36 Supp Fig 2

37 Supp Fig 2

38 Supp Fig 2

39 Clonality of MDS and saml Calculated mutant allele frequency for all validated somatic single nucleotide variants (SNVs) Each MDS/sAML contained founding clone of cells (mutation cluster) Mutation cluster with somatic SNVs

40 Supp Fig 1d: Tier 1 validated SNVs

41 Fig 1a: Identification of mutation clusters

42 Fig 1b: ~85% of BM cells were clonal Irrespective of blast count

43 Fig 1c: CNAs recapitulates SNV clusters

44 Fig 1d: Most samples oligoclonal

45 Fig 2a: Clonal Evolution MDS saml Clone 1 (74%): 323 SNVs

46 Fig 2a: Clonal Evolution MDS saml Clone 1 (74%): 323 SNVs Clone 2: becomes dominant saml, with 3 subclones

47 Supp Fig 5 Slow progressor

48 Supp Fig 5 Slow progressor

49 Supp Fig 5

50 Supp Fig 5

51 Supp Fig 5 Slow progressor

52 Supp Fig 5 Slow progressor

53 Supp Fig 5

54 Supp Fig 5

55 Supp Fig 5

56 Supp Fig 5

57 Supp Fig 5

58 Supp Fig 5

59 Fig 2b: MDS saml dynamic changes in size of mutation clusters

60 Fig 2b: MDS saml dynamic changes in size of mutation clusters

61 saml genomes Contained somatic SNVs Likely not necessary for pathogenesis Slower progression (>20mo) with larger proportion of saml specific mutations 6.7% of mutations specific to saml in rapid progressors vs. 37.8% in slow progression

62 Supp Fig 3b

63 Supp Fig 4: similar spectrum of transition/transversion mutation

64 Supp Fig 4: Treatment effect

65 Conclusions Most bone marrow cells clonally derived Evolution of saml dynamic, variable acquisitions Recurrent mutations in both founding clones and subclones MDS clone persisted, although sometimes outcompeted by daughter subclones

66 Implications MDS and AML distinction currently based on highly interobserver variable manual count; mutation profiling for improved diagnostic accuracy? saml dominant subclone derived from MDS founding close suggests therapies aimed at early mutations maybe worthwhile strategy Dz progression also driven by clone specifics

67 Considerations Causality still not determined Functional data to strengthen hits Discerning random vs. pathogenic mutations

68 Expectations? Godley, NEJM 2012

69 Molecular markers can further risk stratify Patel et al., NEJM 2012

70 Godley, NEJM 2012

71 Other Challenges: Access to technology Turnaround time Most cancers have few candidate molecular targets Most targeted interventions are not permanent, resistance Intratumor and metastasis variation

72

Corporate Medical Policy. Policy Effective February 23, 2018

Corporate Medical Policy. Policy Effective February 23, 2018 Corporate Medical Policy Genetic Testing for FLT3, NPM1 and CEBPA Mutations in Acute File Name: Origination: Last CAP Review: Next CAP Review: Last Review: genetic_testing_for_flt3_npm1_and_cebpa_mutations_in_acute_myeloid_leukemia

More information

Implementation of nation-wide molecular testing in oncology in the French Health care system : quality assurance issues & challenges

Implementation of nation-wide molecular testing in oncology in the French Health care system : quality assurance issues & challenges Implementation of nation-wide molecular testing in oncology in the French Health care system : quality assurance issues & challenges Frédérique Nowak - 21 october 2015 "Putting Science into Standards event:

More information

Please Silence Your Cell Phones. Thank You

Please Silence Your Cell Phones. Thank You Please Silence Your Cell Phones Thank You Utility of NGS and Comprehensive Genomic Profiling in Hematopathology Practice Maria E. Arcila M.D. Memorial Sloan Kettering Cancer Center New York, NY Disclosure

More information

Nature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC.

Nature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC. Supplementary Figure 1 Rates of different mutation types in CRC. (a) Stratification by mutation type indicates that C>T mutations occur at a significantly greater rate than other types. (b) As for the

More information

Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making

Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making November 20, 2014 Capturing Value in Next Generation Sequencing Symposium Douglas Johnson MD, MSCI Vanderbilt-Ingram

More information

1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance. 13/10/2017 Sara Redaelli

1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance. 13/10/2017 Sara Redaelli Dott.ssa Sara Redaelli 13/10/2017 1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance Tumor Heterogeneity: Oncogenic Drivers in NSCLC The Promise of Genotype-Directed Therapy

More information

Circulating Tumor DNA in GIST and its Implications on Treatment

Circulating Tumor DNA in GIST and its Implications on Treatment Circulating Tumor DNA in GIST and its Implications on Treatment October 2 nd 2017 Dr. Ciara Kelly Assistant Attending Physician Sarcoma Medical Oncology Service Objectives Background Liquid biopsy & ctdna

More information

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC

Molecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing

More information

Mutational Impact on Diagnostic and Prognostic Evaluation of MDS

Mutational Impact on Diagnostic and Prognostic Evaluation of MDS Mutational Impact on Diagnostic and Prognostic Evaluation of MDS Elsa Bernard, PhD Papaemmanuil Lab, Computational Oncology, MSKCC MDS Foundation ASH 2018 Symposium Disclosure Research funds provided by

More information

Laboratory Service Report

Laboratory Service Report Client C7028846-DLP Rochester Rochester, N 55901 Specimen Type Peripheral blood CR PDF Report available at: https://test.mmlaccess.com/reports/c7028846-zwselwql7p.ashx Indication for Test DS CR Pathogenic

More information

Variant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18

Variant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18 Variant interpretation exercise ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18 Format of exercise Compile a list of tricky variants across solid cancer and haematological malignancy.

More information

The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients

The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM

More information

Acute leukemia and myelodysplastic syndromes

Acute leukemia and myelodysplastic syndromes 11/01/2012 Post-ASH meeting 1 Acute leukemia and myelodysplastic syndromes Peter Vandenberghe Centrum Menselijke Erfelijkheid & Afdeling Hematologie, UZ Leuven 11/01/2012 Post-ASH meeting 2 1. Acute myeloid

More information

Objectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013

Objectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013 Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie

More information

Acute Myeloid Leukemia Progress at last

Acute Myeloid Leukemia Progress at last Acute Myeloid Leukemia Progress at last Bruno C. Medeiros, MD September 9, 217 Introduction Mechanisms of leukemogenesis Emerging therapies in AML Previously untreated AML Relapsed and refractory patients

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

TP53 mutational profile in CLL : A retrospective study of the FILO group.

TP53 mutational profile in CLL : A retrospective study of the FILO group. TP53 mutational profile in CLL : A retrospective study of the FILO group. Fanny Baran-Marszak Hopital Avicenne Bobigny France 2nd ERIC workshop on TP53 analysis in CLL, Stresa 2017 TP53 abnormalities :

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

AML Genomics 11/27/17. Normal neutrophil maturation. Acute Myeloid Leukemia (AML) = block in differentiation. Myelomonocy9c FAB M5

AML Genomics 11/27/17. Normal neutrophil maturation. Acute Myeloid Leukemia (AML) = block in differentiation. Myelomonocy9c FAB M5 AML Genomics 1 Normal neutrophil maturation Acute Myeloid Leukemia (AML) = block in differentiation AML with minimal differen9a9on FAB M1 Promyelocy9c leukemia FAB M3 Myelomonocy9c FAB M5 2 1 Principle

More information

Acute Myeloid Leukemia with RUNX1 and Several Co-mutations

Acute Myeloid Leukemia with RUNX1 and Several Co-mutations Case SH2017-0281 Acute Myeloid Leukemia with RUNX1 and Several Co-mutations James Bauer, MD, PhD David Yang, MD Erik Ranheim, MD, PhD Catherine Leith, MB, Bchir Clinical History Chief Complaint: 72 year

More information

NeoTYPE Cancer Profiles

NeoTYPE Cancer Profiles NeoTYPE Cancer Profiles Multimethod Analysis of 25+ Hematologic Diseases and Solid Tumors Anatomic Pathology FISH Molecular The next generation of diagnostic, prognostic, and therapeutic assessment NeoTYPE

More information

The Role of Next Generation Sequencing in Solid Tumor Mutation Testing

The Role of Next Generation Sequencing in Solid Tumor Mutation Testing The Role of Next Generation Sequencing in Solid Tumor Mutation Testing Allie H. Grossmann MD PhD Department of Pathology, University of Utah Division of Anatomic Pathology & Oncology, ARUP Laboratories

More information

Research Strategy: 1. Background and Significance

Research Strategy: 1. Background and Significance Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity

More information

Introduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015

Introduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Introduction to Cancer Bioinformatics and cancer biology Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Why cancer bioinformatics? Devastating disease, no cure on the horizon Major

More information

Addressing the challenges of genomic characterization of hematologic malignancies using microarrays

Addressing the challenges of genomic characterization of hematologic malignancies using microarrays Addressing the challenges of genomic characterization of hematologic malignancies using microarrays Sarah South, PhD, FACMG Medical Director, ARUP Laboratories Department of Pediatrics and Pathology University

More information

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath

Disclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant

More information

School of Pathology and Laboratory Medicine: Current and New Research Interests

School of Pathology and Laboratory Medicine: Current and New Research Interests School of Pathology and Laboratory Medicine: Current and New Research Interests W/Professor Wendy Erber Current Research Interests Viral immunology and immunogenetics Bone pathology and cell signalling

More information

Importance of minor TP53 mutated clones in the clinic

Importance of minor TP53 mutated clones in the clinic Importance of minor TP53 mutated clones in the clinic Davide Rossi, M.D., Ph.D. Hematology IOSI - Oncology Institute of Southern Switzerland IOR - Institute of Oncology Reserach Bellinzona - Switzerland

More information

Concomitant WT1 mutations predicted poor prognosis in CEBPA double-mutated acute myeloid leukemia

Concomitant WT1 mutations predicted poor prognosis in CEBPA double-mutated acute myeloid leukemia Concomitant WT1 mutations predicted poor prognosis in CEBPA double-mutated acute myeloid leukemia Feng-Ming Tien, Hsin-An Hou, Jih-Luh Tang, Yuan-Yeh Kuo, Chien-Yuan Chen, Cheng-Hong Tsai, Ming Yao, Chi-Cheng

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

HEMATOLOGIC MALIGNANCIES BIOLOGY

HEMATOLOGIC MALIGNANCIES BIOLOGY HEMATOLOGIC MALIGNANCIES BIOLOGY Failure of terminal differentiation Failure of differentiated cells to undergo apoptosis Failure to control growth Neoplastic stem cell FAILURE OF TERMINAL DIFFERENTIATION

More information

NeoTYPE Cancer Profiles

NeoTYPE Cancer Profiles NeoTYPE Cancer Profiles 30+ Multimethod Assays for Hematologic Diseases and Solid Tumors Molecular FISH Anatomic Pathology The next generation of diagnostic, prognostic, and therapeutic assessment What

More information

Test Name Results Units Bio. Ref. Interval. Positive

Test Name Results Units Bio. Ref. Interval. Positive LL - LL-ROHINI (NATIONAL REFERENCE 135091534 Age 36 Years Gender Female 1/9/2017 120000AM 1/9/2017 105316AM 2/9/2017 104147AM Ref By Final LEUKEMIA GENETIC ROFILE ANY SIX MARKERS, CR QUALITATIVE AML ETO

More information

Changing AML Outcomes via Personalized Medicine: Transforming Cancer Management with Genetic Insight

Changing AML Outcomes via Personalized Medicine: Transforming Cancer Management with Genetic Insight Changing AML Outcomes via Personalized Medicine: Transforming Cancer Management with Genetic Insight Co-Moderators: Rick Winneker, PhD, Senior Vice President, Research, Leukemia & Lymphoma Society Mike

More information

Template for Reporting Results of Monitoring Tests for Patients With Chronic Myelogenous Leukemia (BCR-ABL1+)

Template for Reporting Results of Monitoring Tests for Patients With Chronic Myelogenous Leukemia (BCR-ABL1+) Template for Reporting Results of Monitoring Tests for Patients With Chronic Myelogenous Leukemia (BCR-ABL1+) Version: CMLBiomarkers 1.0.0.2 Protocol Posting Date: June 2017 This biomarker template is

More information

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:

More information

MP BCR-ABL1 Testing in Chronic Myelogenous Leukemia and Acute Lymphoblastic Leukemia

MP BCR-ABL1 Testing in Chronic Myelogenous Leukemia and Acute Lymphoblastic Leukemia Medical Policy BCBSA Ref. Policy: 2.04.85 Last Review: 10/18/2018 Effective Date: 10/18/2018 Section: Medicine Related Policies 8.01.30 Hematopoietic Cell Transplantation for Chronic Myelogenous Leukemia

More information

Should novel molecular therapies replace old knowledge of clinical tumor biology?

Should novel molecular therapies replace old knowledge of clinical tumor biology? Should novel molecular therapies replace old knowledge of clinical tumor biology? Danai Daliani, M.D. Director, 1 st Oncology Clinic Euroclinic of Athens Cancer Treatments Localized disease Surgery XRT

More information

New treatment strategies in myelodysplastic syndromes and acute myeloid leukemia van der Helm, Lidia Henrieke

New treatment strategies in myelodysplastic syndromes and acute myeloid leukemia van der Helm, Lidia Henrieke University of Groningen New treatment strategies in myelodysplastic syndromes and acute myeloid leukemia van der Helm, Lidia Henrieke IMPORTANT NOTE: You are advised to consult the publisher's version

More information

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011

Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Massive Genomic Rearrangement Acquired in a Single Catastrophic Event during Cancer Development Cell 144,

More information

The Past, Present, and Future of Acute Myeloid Leukemia

The Past, Present, and Future of Acute Myeloid Leukemia The Past, Present, and Future of Acute Myeloid Leukemia Carter T. Davis, MD Hematology-Oncology Fellow Duke University Health System September 10, 2016 Overview Overview of Acute Myeloid Leukemia Review

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

609G: Concepts of Cancer Genetics and Treatments (3 credits)

609G: Concepts of Cancer Genetics and Treatments (3 credits) Master of Chemical and Life Sciences Program College of Computer, Mathematical, and Natural Sciences 609G: Concepts of Cancer Genetics and Treatments (3 credits) Text books: Principles of Cancer Genetics,

More information

Discovering Rare Hematopoietic Clones Harboring Leukemia-Associated Mutations Using Error-Corrected Sequencing

Discovering Rare Hematopoietic Clones Harboring Leukemia-Associated Mutations Using Error-Corrected Sequencing Washington University in St. Louis Washington University Open Scholarship Arts & Sciences Electronic Theses and Dissertations Arts & Sciences Spring 5-15-2018 Discovering Rare Hematopoietic Clones Harboring

More information

Laboratory Service Report

Laboratory Service Report Specimen Type Peripheral blood CR PDF Report available at: https://test.mmlaccess.com/reports/c7028846-ih2xuglwpq.ashx Indication for Test DS CR Pathogenic utations Detected CR 1. JAK2: c.1849g>t;p.val617phe

More information

Commissioning policies agreed by PCTs in Yorkshire and the Humber at Board meeting of YH SCG on December

Commissioning policies agreed by PCTs in Yorkshire and the Humber at Board meeting of YH SCG on December Commissioning policies agreed by PCTs in Yorkshire and the Humber at Board meeting of YH SCG on December 17 2010. 32/10 Imatinib for gastrointestinal stromal tumours (unresectable/metastatic) (update on

More information

Overview. Methods 9/11/2017. Next Generation Sequencing and Precision Medicine in Hematological Malignancies. Genotyping in hematology

Overview. Methods 9/11/2017. Next Generation Sequencing and Precision Medicine in Hematological Malignancies. Genotyping in hematology Overview Next Generation Sequencing and Precision Medicine in Hematological Malignancies Sharathkumar Bhagavathi, MD University of Iowa Carver College of Medicine NGS as a genotyping platform in hematopathology

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

N Engl J Med Volume 373(12): September 17, 2015

N Engl J Med Volume 373(12): September 17, 2015 Review Article Acute Myeloid Leukemia Hartmut Döhner, M.D., Daniel J. Weisdorf, M.D., and Clara D. Bloomfield, M.D. N Engl J Med Volume 373(12):1136-1152 September 17, 2015 Acute Myeloid Leukemia Most

More information

New drugs in Acute Leukemia. Cristina Papayannidis, MD, PhD University of Bologna

New drugs in Acute Leukemia. Cristina Papayannidis, MD, PhD University of Bologna New drugs in Acute Leukemia Cristina Papayannidis, MD, PhD University of Bologna Challenges to targeted therapy in AML Multiple subtypes based upon mutations/cytogenetic aberrations No known uniform genomic

More information

Molecular and genetic alterations associated with therapy resistance and relapse of acute myeloid leukemia

Molecular and genetic alterations associated with therapy resistance and relapse of acute myeloid leukemia Hackl et al. Journal of Hematology & Oncology (2017) 10:51 DOI 10.1186/s13045-017-0416-0 REVIEW Open Access Molecular and genetic alterations associated with therapy resistance and relapse of acute myeloid

More information

Appendix 6: Indications for adult allogeneic bone marrow transplant in New Zealand

Appendix 6: Indications for adult allogeneic bone marrow transplant in New Zealand Appendix 6: Indications for adult allogeneic bone marrow transplant in New Zealand This list provides indications for the majority of adult BMTs that are performed in New Zealand. A small number of BMTs

More information

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels Clinical Genomics The CLIA Lab Perspective Disclosures Raju K. Pillai, M.D. Hematopathologist / Molecular Pathologist Director, Pathology Bioinformatics City of Hope National Medical Center, Duarte, CA

More information

Genomic complexity and arrays in CLL. Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy

Genomic complexity and arrays in CLL. Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy Genomic complexity and arrays in CLL Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy Clinical relevance of genomic complexity (GC) in CLL GC has been identified as a critical negative

More information

All patients with FLT3 mutant AML should receive midostaurin-based induction therapy. Not so fast!

All patients with FLT3 mutant AML should receive midostaurin-based induction therapy. Not so fast! All patients with FLT3 mutant AML should receive midostaurin-based induction therapy Not so fast! Harry P. Erba, M.D., Ph.D. Professor, Internal Medicine Director, Hematologic Malignancy Program University

More information

Personalised cancer care Information for Medical Specialists. A new way to unlock treatment options for your patients

Personalised cancer care Information for Medical Specialists. A new way to unlock treatment options for your patients Personalised cancer care Information for Medical Specialists A new way to unlock treatment options for your patients Contents Optimised for clinical benefit 4 Development history 4 Full FIND IT panel vs

More information

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)

More information

Acute Myeloid Leukemia: A Patient s Perspective

Acute Myeloid Leukemia: A Patient s Perspective Acute Myeloid Leukemia: A Patient s Perspective Patrick A Hagen, MD, MPH Cardinal Bernardin Cancer Center Loyola University Medical Center Maywood, IL Overview 1. What is AML? 2. Who gets AML? Epidemiology

More information

Summary of Key AML Abstracts Presented at the American Society of Hematology (ASH) December 2-6, San Diego CA

Summary of Key AML Abstracts Presented at the American Society of Hematology (ASH) December 2-6, San Diego CA Summary of Key AML Abstracts Presented at the American Society of Hematology (ASH) December 2-6, 2016 - San Diego CA ASH 2016 ANNUAL MEETING: ABSTRACT SEARCH PAGE: https://ash.confex.com/ash/2016/webprogram/start.html

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Introduction of an NGS gene panel into the Haemato-Oncology MPN service

Introduction of an NGS gene panel into the Haemato-Oncology MPN service Introduction of an NGS gene panel into the Haemato-Oncology MPN service Dr. Anna Skowronska, Dr Jane Bryon, Dr Samuel Clokie, Dr Yvonne Wallis and Professor Mike Griffiths West Midlands Regional Genetics

More information

Examining Genetics and Genomics of Acute Myeloid Leukemia in 2017

Examining Genetics and Genomics of Acute Myeloid Leukemia in 2017 Examining Genetics and Genomics of Acute Myeloid Leukemia in 2017 Elli Papaemmanuil, PhD Memorial Sloan Kettering Cancer Center New York, New York, United States Today s Talk Cancer genome introduction

More information

Personalized Therapy for Acute Myeloid Leukemia. Patrick Stiff MD Loyola University Medical Center

Personalized Therapy for Acute Myeloid Leukemia. Patrick Stiff MD Loyola University Medical Center Personalized Therapy for Acute Myeloid Leukemia Patrick Stiff MD Loyola University Medical Center 708-327-3216 Major groups of Mutations in AML Targets for AML: Is this Achievable? Chronic Myeloid Leukemia:

More information

Next Generation Sequencing in Haematological Malignancy: A European Perspective. Wolfgang Kern, Munich Leukemia Laboratory

Next Generation Sequencing in Haematological Malignancy: A European Perspective. Wolfgang Kern, Munich Leukemia Laboratory Next Generation Sequencing in Haematological Malignancy: A European Perspective Wolfgang Kern, Munich Leukemia Laboratory Diagnostic Methods Cytomorphology Cytogenetics Immunophenotype Histology FISH Molecular

More information

Targeted NGS in oncology and hemato-oncology using in-house designed gene panels. Joni Van der Meulen Molecular Diagnostics UZ Ghent (MDG) 24/03/2017

Targeted NGS in oncology and hemato-oncology using in-house designed gene panels. Joni Van der Meulen Molecular Diagnostics UZ Ghent (MDG) 24/03/2017 Targeted NGS in oncology and hemato-oncology using in-house designed gene panels Joni Van der Meulen Molecular Diagnostics UZ Ghent (MDG) 24/03/2017 MDG = Molecular Diagnostics UZ Ghent Center for Medical

More information

NUMERATOR: Patients who had baseline cytogenetic testing performed on bone marrow

NUMERATOR: Patients who had baseline cytogenetic testing performed on bone marrow Quality ID #67 (NQF 0377): Hematology: Myelodysplastic Syndrome (MDS) and Acute Leukemias: Baseline Cytogenetic Testing Performed on Bone Marrow National Quality Strategy Domain: Effective Clinical Care

More information

Test Name Results Units Bio. Ref. Interval. Positive

Test Name Results Units Bio. Ref. Interval. Positive LL - LL-ROHINI (NATIONAL REFERENCE 135091533 Age 28 Years Gender Male 1/9/2017 120000AM 1/9/2017 105415AM 4/9/2017 23858M Ref By Final LEUKEMIA DIAGNOSTIC COMREHENSIVE ROFILE, ANY 6 MARKERS t (1;19) (q23

More information

Recommended Timing for Transplant Consultation

Recommended Timing for Transplant Consultation REFERRAL GUIDELINES Recommended Timing for Transplant Consultation Published jointly by the National Marrow Donor Program /Be The Match and the American Society for Blood and Marrow Transplantation BeTheMatchClinical.org

More information

Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ

Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol

More information

Neue zielgerichtete Behandlungsoptionen der neu diagnostizierten FLT3-positiven Akuten Myeloischen Leukämie (AML)

Neue zielgerichtete Behandlungsoptionen der neu diagnostizierten FLT3-positiven Akuten Myeloischen Leukämie (AML) Neue zielgerichtete Behandlungsoptionen der neu diagnostizierten FLT3-positiven Akuten Myeloischen Leukämie (AML) Prof. Hartmut Döhner Klinik für Innere Medizin III, Universitätsklinikum Ulm Midostaurin

More information

Genomic Medicine: What every pathologist needs to know

Genomic Medicine: What every pathologist needs to know Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and

More information

Evolving Targeted Management of Acute Myeloid Leukemia

Evolving Targeted Management of Acute Myeloid Leukemia Evolving Targeted Management of Acute Myeloid Leukemia Jessica Altman, MD Robert H. Lurie Comprehensive Cancer Center of Northwestern University Learning Objectives Identify which mutations should be assessed

More information

AML: WHO classification, biology and prognosis. Dimitri Breems, MD, PhD Internist-Hematoloog Ziekenhuis Netwerk Antwerpen

AML: WHO classification, biology and prognosis. Dimitri Breems, MD, PhD Internist-Hematoloog Ziekenhuis Netwerk Antwerpen AML: WHO classification, biology and prognosis Dimitri Breems, MD, PhD Internist-Hematoloog Ziekenhuis Netwerk Antwerpen Acute myeloid leukemia Clonal expansion of undifferentiated myeloid precursors Impaired

More information

Dr C K Kwan. Associate Consultant, Queen Elizabeth Hospital, HKSAR Honorary member, Targeted Therapy Team, ICR, UK

Dr C K Kwan. Associate Consultant, Queen Elizabeth Hospital, HKSAR Honorary member, Targeted Therapy Team, ICR, UK HA Convention 2013 Dr C K Kwan MBChB, FRCR, FHKCR, FHKAM, MPM, CPI, MAppMgt(Hlth) Associate Consultant, Queen Elizabeth Hospital, HKSAR Honorary member, Targeted Therapy Team, ICR, UK To personalize cancer

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

Patient Leader Education Summit. Precision Medicine: Today and Tomorrow March 31, 2017

Patient Leader Education Summit. Precision Medicine: Today and Tomorrow March 31, 2017 Patient Leader Education Summit Precision Medicine: Today and Tomorrow March 31, 2017 Precision Medicine: Presentation Outline Agenda What is a Precision Medicine What is its clinical value Overview of

More information

Deep Learning Analytics for Predicting Prognosis of Acute Myeloid Leukemia with Cytogenetics, Age, and Mutations

Deep Learning Analytics for Predicting Prognosis of Acute Myeloid Leukemia with Cytogenetics, Age, and Mutations Deep Learning Analytics for Predicting Prognosis of Acute Myeloid Leukemia with Cytogenetics, Age, and Mutations Andy Nguyen, M.D., M.S. Medical Director, Hematopathology, Hematology and Coagulation Laboratory,

More information

Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory

Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Personalised Therapy/Precision Medicine Selection of a therapeutic drug based on the presence or absence of a specific

More information

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca

NEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA

More information

Application of Whole Genome Microarrays in Cancer: You should be doing this test!!

Application of Whole Genome Microarrays in Cancer: You should be doing this test!! Application of Whole Genome Microarrays in Cancer: You should be doing this test!! Daynna Wolff, Ph.D. Director, Cytogenetics and Genomics Disclosures Clinical Laboratory Director and Employee, Medical

More information

underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The

underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The Supplementary Figures Figure S1. Patient cohorts and study design. To define and interrogate the genetic alterations underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The

More information

Current and future applications of Molecular Pathology. Kathy Walsh Clinical Scientist NHS Lothian

Current and future applications of Molecular Pathology. Kathy Walsh Clinical Scientist NHS Lothian Current and future applications of Molecular Pathology Kathy Walsh Clinical Scientist NHS Lothian Molecular Pathology in Solid tumours Cancer type Genes tested Purpose Associated treatments Non small cell

More information

Case 089: Therapy Related t(8;21)(q22;q22) AML and

Case 089: Therapy Related t(8;21)(q22;q22) AML and Case 089: Therapy Related t(8;21)(q22;q22) AML and SM-AHNMD ST Pullarkat 1, V Pullarkat 2, SH Kroft 3, CS Wilson 4, M Thein 5, WW Grody 1, and RK Brynes 5 1 UCLA, 2 City of Hope National Med Ctr, 3 Med

More information

Harmesh Naik, MD. Hope Cancer Clinic PERSONALIZED CANCER TREATMENT USING LATEST IN MOLECULAR BIOLOGY

Harmesh Naik, MD. Hope Cancer Clinic PERSONALIZED CANCER TREATMENT USING LATEST IN MOLECULAR BIOLOGY Harmesh Naik, MD. Hope Cancer Clinic PERSONALIZED CANCER TREATMENT USING LATEST IN MOLECULAR BIOLOGY A NEW GENE A DAY.WHILE YOU ARE ENJOYING MORNING COFFEE From cancer.gov GOALS FOR THE CME TODAY A brief

More information

Cell-free tumor DNA for cancer monitoring

Cell-free tumor DNA for cancer monitoring Learning objectives Cell-free tumor DNA for cancer monitoring Christina Lockwood, PhD, DABCC, DABMGG Department of Laboratory Medicine 1. Define circulating, cell-free tumor DNA (ctdna) 2. Understand the

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Information S1 Frequency of DNMT3A mutations in hematologic disorders and their associated clinical phenotypes. Disease Patient population Frequency (%) Associated Clinical Characteristics

More information

Transform genomic data into real-life results

Transform genomic data into real-life results CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for

More information

Management of Myelodysplastic Syndromes

Management of Myelodysplastic Syndromes Management of Myelodysplastic Syndromes Peter L. Greenberg, MD Stanford Cancer Institute Myelodysplastic Syndromes: Clinical & Molecular Advances for Disease Classification and Prognostication MDSs: A

More information

Supplementary Tables. Supplementary Figures

Supplementary Tables. Supplementary Figures Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample

More information

Identifying Mutations Responsible for Rare Disorders Using New Technologies

Identifying Mutations Responsible for Rare Disorders Using New Technologies Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance

More information

Smouldering Myeloma: to treat or not to treat?

Smouldering Myeloma: to treat or not to treat? Smouldering Myeloma: to treat or not to treat? Massimo Offidani Clinica di Ematologia Azienda Ospedaliero-Universitaria Ospedali Riuniti di Ancona Definitions and epidemiology 3000-5000 new SMM/year in

More information

Precision Medicine and Molecular Testing.

Precision Medicine and Molecular Testing. Precision Medicine and Molecular Testing. David A. Sallman, MD Assistant Member Department of Malignant Hematology Moffitt Cancer Center david.sallman@moffitt.org Disclosures Research funding for Celgene

More information

Out-Patient Billing CPT Codes

Out-Patient Billing CPT Codes Out-Patient Billing CPT Codes Updated Date: August 3, 08 Client Billed Molecular Tests HPV DNA Tissue Testing 8764 No Medicare Billed - Molecular Tests NeoARRAY NeoARRAY SNP/Cytogenetic No 89 NeoLAB NeoLAB

More information

Subclones dominate at MDS progression following allogeneic hematopoietic cell transplant

Subclones dominate at MDS progression following allogeneic hematopoietic cell transplant Subclones dominate at MDS progression following allogeneic hematopoietic cell transplant Meagan A. Jacoby,, Timothy A. Graubert, Matthew J. Walter JCI Insight. 2018;3(5):e98962.. Research Article Genetics

More information

ADVANCES IN CHILDHOOD ACUTE LEUKEMIAS : GENERAL OVERVIEW

ADVANCES IN CHILDHOOD ACUTE LEUKEMIAS : GENERAL OVERVIEW ADVANCES IN CHILDHOOD ACUTE LEUKEMIAS : GENERAL OVERVIEW Danièle SOMMELET European Scientific Seminar Luxemburg, 3.11.2009 1 Definition of acute leukemias Malignant process coming from lymphoid (85 %)

More information

Pros and cons of liquid biopsy: Ready to replace tissue?

Pros and cons of liquid biopsy: Ready to replace tissue? Pros and cons of liquid biopsy: Ready to replace tissue? 2-Day Molecular Biologists Symposium: Liquid biopsies Federico Rojo Enterprise Interest No disclosures. Biological limitations for molecular testing:

More information

The BCR-ABL1 fusion. Epidemiology. At the center of advances in hematology and molecular medicine

The BCR-ABL1 fusion. Epidemiology. At the center of advances in hematology and molecular medicine At the center of advances in hematology and molecular medicine Philadelphia chromosome-positive chronic myeloid leukemia Robert E. Richard MD PhD rrichard@uw.edu robert.richard@va.gov Philadelphia chromosome

More information

New Developments in Cancer Treatment. Ian Rabinowitz MD

New Developments in Cancer Treatment. Ian Rabinowitz MD New Developments in Cancer Treatment Ian Rabinowitz MD Treatment Outline Angiogenesis inhibition Targeted therapy Immunotherapy Personalization of therapy Genomics and cancer Stem cells and cancer Angiogenesis

More information

Published Ahead of Print on April 14, 2016, as doi: /haematol Copyright 2016 Ferrata Storti Foundation.

Published Ahead of Print on April 14, 2016, as doi: /haematol Copyright 2016 Ferrata Storti Foundation. Published Ahead of Print on April 14, 2016, as doi:10.3324/haematol.2016.143214. Copyright 2016 Ferrata Storti Foundation. Immunohistochemical pattern of p53 is a measure of TP53 mutation burden and adverse

More information

Next generation sequencing analysis - A UK perspective. Nicholas Lea

Next generation sequencing analysis - A UK perspective. Nicholas Lea Next generation sequencing analysis - A UK perspective Nicholas Lea King s HMDC LMH is part of an integrated pathology service at King s Haematological Malignancy Diagnostic Centre (HMDC) HMDC serves population

More information