Clonal Evolution of saml. Johnnie J. Orozco Hematology Fellows Conference May 11, 2012
|
|
- Myles Black
- 5 years ago
- Views:
Transcription
1 Clonal Evolution of saml Johnnie J. Orozco Hematology Fellows Conference May 11, 2012
2 CML: *bcr-abl and imatinib Melanoma: *braf and vemurafenib CRC: *k-ras and cetuximab Esophageal/Gastric: *Her-2/neu and trastuzumab GIST: *c-kit and imatinib NSCLC / Adeno: *EGFR and erlotinib
3 AML Heterogeneous disease Variable response to 7+3, and even HCT Age variability? (disease severity/genetics?) Cytogenetics: risk stratification Predictive prognostic
4 Three Traditional Cytogenetics Risk Groups Slovak et al., Blood 2000
5 Prognostics of Cytogenetics Medeiros et al., Blood 2010
6 Molecular markers can further risk stratify Dohner et al., Blood 2010
7
8 Mardis et al., NEJM 2009
9 Isocitrate DeHydrogenase: -mostly in NK -context dependent *w/ FLT3-ITD: dec relapse *w/o: incr relapse rates Mardis et al., NEJM 2009
10 Candidate Gene Approach Pathogenesis largely undefined AML Genome snapshot in time Prognostic vs therapeutic implications
11
12 Study Overview N=seven patients Whole Genome Sequencing of skin, bone marrow with saml to id saml specific somatic mutations Bone marrow sample for each patient from antecedent MDS genotyped Mutations tracked to define clonal architecture
13 Illumina Technology: Generate Fragments Mardis, Annu Rev Genomics Hum. Genet. 2008
14 Bind DNA Fragments Mardis, Annu Rev Genomics Hum. Genet. 2008
15 Bridge Amplification Mardis, Annu Rev Genomics Hum. Genet. 2008
16 DS Intermediate
17 DS Separated Mardis, Annu Rev Genomics Hum. Genet. 2008
18 Colonies of clusters
19 Determine first base Mardis, Annu Rev Genomics Hum. Genet. 2008
20 Capture first cycle Mardis, Annu Rev Genomics Hum. Genet. 2008
21 Prepare for next cycle Mardis, Annu Rev Genomics Hum. Genet. 2008
22 Sequence read over multiple cycles Mardis, Annu Rev Genomics Hum. Genet. 2008
23 Data alignment
24
25 Supp Fig 1c: Cell Sorting blasts minimal impact on mutant allele burden
26 Supp Fig 1a,b: BM Asp
27 I. Whole Genome Sequencing >95% coverage for samples
28 II. Recurrent Gene Mutations validated point mutations/ indels per saml genome in 168 genes among 7 samples Most were NOT recurrent mutations many randomly acquired, role in pathogenesis? Two recurrent mutations detected in two samples: loss of Function in myeloid tumor suppressors RUNX1 UMODL1
29 UMODL1 Mutated in patients w/ Multiple Myeloma, ovarian Cancer Expressed in normal CD34+ cells, and saml cells from all 7 patients Two mutations in conserved domains:
30 Compared to 200 de novo AML Identified 10 genes that were mutated in one saml and in at least 3 of 200 AML samples Seven of which are known to have recurrent mutations in AML Four not previously implicated in MDS/AML
31 Recurrent in 2 samples Not previously implicated in AML
32 New Associations CDH23- cadherin 23 Neurosensory epithelium, tip-link filaments at stereocilia SMC3- structural maintenance of chrom3 Hold sister chromatids UMODL1 ZSWIM4
33 U2AF1 Specific codon in multiple samples, may be gain of function Supported by enhanced alternative splicing in vitro
34 STAG2 Predicted protein truncation Reported to be often be deleted in AML and other cancers
35 IIb. Nonrecurrent mutations Nonrecurrent tier 1 mutations implicated at least 11 pathways All pathways altered in seven patients
36 Supp Fig 2
37 Supp Fig 2
38 Supp Fig 2
39 Clonality of MDS and saml Calculated mutant allele frequency for all validated somatic single nucleotide variants (SNVs) Each MDS/sAML contained founding clone of cells (mutation cluster) Mutation cluster with somatic SNVs
40 Supp Fig 1d: Tier 1 validated SNVs
41 Fig 1a: Identification of mutation clusters
42 Fig 1b: ~85% of BM cells were clonal Irrespective of blast count
43 Fig 1c: CNAs recapitulates SNV clusters
44 Fig 1d: Most samples oligoclonal
45 Fig 2a: Clonal Evolution MDS saml Clone 1 (74%): 323 SNVs
46 Fig 2a: Clonal Evolution MDS saml Clone 1 (74%): 323 SNVs Clone 2: becomes dominant saml, with 3 subclones
47 Supp Fig 5 Slow progressor
48 Supp Fig 5 Slow progressor
49 Supp Fig 5
50 Supp Fig 5
51 Supp Fig 5 Slow progressor
52 Supp Fig 5 Slow progressor
53 Supp Fig 5
54 Supp Fig 5
55 Supp Fig 5
56 Supp Fig 5
57 Supp Fig 5
58 Supp Fig 5
59 Fig 2b: MDS saml dynamic changes in size of mutation clusters
60 Fig 2b: MDS saml dynamic changes in size of mutation clusters
61 saml genomes Contained somatic SNVs Likely not necessary for pathogenesis Slower progression (>20mo) with larger proportion of saml specific mutations 6.7% of mutations specific to saml in rapid progressors vs. 37.8% in slow progression
62 Supp Fig 3b
63 Supp Fig 4: similar spectrum of transition/transversion mutation
64 Supp Fig 4: Treatment effect
65 Conclusions Most bone marrow cells clonally derived Evolution of saml dynamic, variable acquisitions Recurrent mutations in both founding clones and subclones MDS clone persisted, although sometimes outcompeted by daughter subclones
66 Implications MDS and AML distinction currently based on highly interobserver variable manual count; mutation profiling for improved diagnostic accuracy? saml dominant subclone derived from MDS founding close suggests therapies aimed at early mutations maybe worthwhile strategy Dz progression also driven by clone specifics
67 Considerations Causality still not determined Functional data to strengthen hits Discerning random vs. pathogenic mutations
68 Expectations? Godley, NEJM 2012
69 Molecular markers can further risk stratify Patel et al., NEJM 2012
70 Godley, NEJM 2012
71 Other Challenges: Access to technology Turnaround time Most cancers have few candidate molecular targets Most targeted interventions are not permanent, resistance Intratumor and metastasis variation
72
Corporate Medical Policy. Policy Effective February 23, 2018
Corporate Medical Policy Genetic Testing for FLT3, NPM1 and CEBPA Mutations in Acute File Name: Origination: Last CAP Review: Next CAP Review: Last Review: genetic_testing_for_flt3_npm1_and_cebpa_mutations_in_acute_myeloid_leukemia
More informationImplementation of nation-wide molecular testing in oncology in the French Health care system : quality assurance issues & challenges
Implementation of nation-wide molecular testing in oncology in the French Health care system : quality assurance issues & challenges Frédérique Nowak - 21 october 2015 "Putting Science into Standards event:
More informationPlease Silence Your Cell Phones. Thank You
Please Silence Your Cell Phones Thank You Utility of NGS and Comprehensive Genomic Profiling in Hematopathology Practice Maria E. Arcila M.D. Memorial Sloan Kettering Cancer Center New York, NY Disclosure
More informationNature Genetics: doi: /ng Supplementary Figure 1. Rates of different mutation types in CRC.
Supplementary Figure 1 Rates of different mutation types in CRC. (a) Stratification by mutation type indicates that C>T mutations occur at a significantly greater rate than other types. (b) As for the
More informationNext Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making
Next Generation Sequencing in Clinical Practice: Impact on Therapeutic Decision Making November 20, 2014 Capturing Value in Next Generation Sequencing Symposium Douglas Johnson MD, MSCI Vanderbilt-Ingram
More information1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance. 13/10/2017 Sara Redaelli
Dott.ssa Sara Redaelli 13/10/2017 1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance Tumor Heterogeneity: Oncogenic Drivers in NSCLC The Promise of Genotype-Directed Therapy
More informationCirculating Tumor DNA in GIST and its Implications on Treatment
Circulating Tumor DNA in GIST and its Implications on Treatment October 2 nd 2017 Dr. Ciara Kelly Assistant Attending Physician Sarcoma Medical Oncology Service Objectives Background Liquid biopsy & ctdna
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationMutational Impact on Diagnostic and Prognostic Evaluation of MDS
Mutational Impact on Diagnostic and Prognostic Evaluation of MDS Elsa Bernard, PhD Papaemmanuil Lab, Computational Oncology, MSKCC MDS Foundation ASH 2018 Symposium Disclosure Research funds provided by
More informationLaboratory Service Report
Client C7028846-DLP Rochester Rochester, N 55901 Specimen Type Peripheral blood CR PDF Report available at: https://test.mmlaccess.com/reports/c7028846-zwselwql7p.ashx Indication for Test DS CR Pathogenic
More informationVariant interpretation exercise. ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18
Variant interpretation exercise ACGS Somatic Variant Interpretation Workshop Joanne Mason 21/09/18 Format of exercise Compile a list of tricky variants across solid cancer and haematological malignancy.
More informationThe feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients
The feasibility of circulating tumour DNA as an alternative to biopsy for mutational characterization in Stage III melanoma patients ASSC Scientific Meeting 13 th October 2016 Prof Andrew Barbour UQ SOM
More informationAcute leukemia and myelodysplastic syndromes
11/01/2012 Post-ASH meeting 1 Acute leukemia and myelodysplastic syndromes Peter Vandenberghe Centrum Menselijke Erfelijkheid & Afdeling Hematologie, UZ Leuven 11/01/2012 Post-ASH meeting 2 1. Acute myeloid
More informationObjectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013
Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie
More informationAcute Myeloid Leukemia Progress at last
Acute Myeloid Leukemia Progress at last Bruno C. Medeiros, MD September 9, 217 Introduction Mechanisms of leukemogenesis Emerging therapies in AML Previously untreated AML Relapsed and refractory patients
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationTP53 mutational profile in CLL : A retrospective study of the FILO group.
TP53 mutational profile in CLL : A retrospective study of the FILO group. Fanny Baran-Marszak Hopital Avicenne Bobigny France 2nd ERIC workshop on TP53 analysis in CLL, Stresa 2017 TP53 abnormalities :
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationAML Genomics 11/27/17. Normal neutrophil maturation. Acute Myeloid Leukemia (AML) = block in differentiation. Myelomonocy9c FAB M5
AML Genomics 1 Normal neutrophil maturation Acute Myeloid Leukemia (AML) = block in differentiation AML with minimal differen9a9on FAB M1 Promyelocy9c leukemia FAB M3 Myelomonocy9c FAB M5 2 1 Principle
More informationAcute Myeloid Leukemia with RUNX1 and Several Co-mutations
Case SH2017-0281 Acute Myeloid Leukemia with RUNX1 and Several Co-mutations James Bauer, MD, PhD David Yang, MD Erik Ranheim, MD, PhD Catherine Leith, MB, Bchir Clinical History Chief Complaint: 72 year
More informationNeoTYPE Cancer Profiles
NeoTYPE Cancer Profiles Multimethod Analysis of 25+ Hematologic Diseases and Solid Tumors Anatomic Pathology FISH Molecular The next generation of diagnostic, prognostic, and therapeutic assessment NeoTYPE
More informationThe Role of Next Generation Sequencing in Solid Tumor Mutation Testing
The Role of Next Generation Sequencing in Solid Tumor Mutation Testing Allie H. Grossmann MD PhD Department of Pathology, University of Utah Division of Anatomic Pathology & Oncology, ARUP Laboratories
More informationResearch Strategy: 1. Background and Significance
Research Strategy: 1. Background and Significance 1.1. Heterogeneity is a common feature of cancer. A better understanding of this heterogeneity may present therapeutic opportunities: Intratumor heterogeneity
More informationIntroduction to Cancer Bioinformatics and cancer biology. Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015
Introduction to Cancer Bioinformatics and cancer biology Anthony Gitter Cancer Bioinformatics (BMI 826/CS 838) January 20, 2015 Why cancer bioinformatics? Devastating disease, no cure on the horizon Major
More informationAddressing the challenges of genomic characterization of hematologic malignancies using microarrays
Addressing the challenges of genomic characterization of hematologic malignancies using microarrays Sarah South, PhD, FACMG Medical Director, ARUP Laboratories Department of Pediatrics and Pathology University
More informationDisclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath
Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant
More informationSchool of Pathology and Laboratory Medicine: Current and New Research Interests
School of Pathology and Laboratory Medicine: Current and New Research Interests W/Professor Wendy Erber Current Research Interests Viral immunology and immunogenetics Bone pathology and cell signalling
More informationImportance of minor TP53 mutated clones in the clinic
Importance of minor TP53 mutated clones in the clinic Davide Rossi, M.D., Ph.D. Hematology IOSI - Oncology Institute of Southern Switzerland IOR - Institute of Oncology Reserach Bellinzona - Switzerland
More informationConcomitant WT1 mutations predicted poor prognosis in CEBPA double-mutated acute myeloid leukemia
Concomitant WT1 mutations predicted poor prognosis in CEBPA double-mutated acute myeloid leukemia Feng-Ming Tien, Hsin-An Hou, Jih-Luh Tang, Yuan-Yeh Kuo, Chien-Yuan Chen, Cheng-Hong Tsai, Ming Yao, Chi-Cheng
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationHEMATOLOGIC MALIGNANCIES BIOLOGY
HEMATOLOGIC MALIGNANCIES BIOLOGY Failure of terminal differentiation Failure of differentiated cells to undergo apoptosis Failure to control growth Neoplastic stem cell FAILURE OF TERMINAL DIFFERENTIATION
More informationNeoTYPE Cancer Profiles
NeoTYPE Cancer Profiles 30+ Multimethod Assays for Hematologic Diseases and Solid Tumors Molecular FISH Anatomic Pathology The next generation of diagnostic, prognostic, and therapeutic assessment What
More informationTest Name Results Units Bio. Ref. Interval. Positive
LL - LL-ROHINI (NATIONAL REFERENCE 135091534 Age 36 Years Gender Female 1/9/2017 120000AM 1/9/2017 105316AM 2/9/2017 104147AM Ref By Final LEUKEMIA GENETIC ROFILE ANY SIX MARKERS, CR QUALITATIVE AML ETO
More informationChanging AML Outcomes via Personalized Medicine: Transforming Cancer Management with Genetic Insight
Changing AML Outcomes via Personalized Medicine: Transforming Cancer Management with Genetic Insight Co-Moderators: Rick Winneker, PhD, Senior Vice President, Research, Leukemia & Lymphoma Society Mike
More informationTemplate for Reporting Results of Monitoring Tests for Patients With Chronic Myelogenous Leukemia (BCR-ABL1+)
Template for Reporting Results of Monitoring Tests for Patients With Chronic Myelogenous Leukemia (BCR-ABL1+) Version: CMLBiomarkers 1.0.0.2 Protocol Posting Date: June 2017 This biomarker template is
More informationAD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients
AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:
More informationMP BCR-ABL1 Testing in Chronic Myelogenous Leukemia and Acute Lymphoblastic Leukemia
Medical Policy BCBSA Ref. Policy: 2.04.85 Last Review: 10/18/2018 Effective Date: 10/18/2018 Section: Medicine Related Policies 8.01.30 Hematopoietic Cell Transplantation for Chronic Myelogenous Leukemia
More informationShould novel molecular therapies replace old knowledge of clinical tumor biology?
Should novel molecular therapies replace old knowledge of clinical tumor biology? Danai Daliani, M.D. Director, 1 st Oncology Clinic Euroclinic of Athens Cancer Treatments Localized disease Surgery XRT
More informationNew treatment strategies in myelodysplastic syndromes and acute myeloid leukemia van der Helm, Lidia Henrieke
University of Groningen New treatment strategies in myelodysplastic syndromes and acute myeloid leukemia van der Helm, Lidia Henrieke IMPORTANT NOTE: You are advised to consult the publisher's version
More informationChromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011
Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Massive Genomic Rearrangement Acquired in a Single Catastrophic Event during Cancer Development Cell 144,
More informationThe Past, Present, and Future of Acute Myeloid Leukemia
The Past, Present, and Future of Acute Myeloid Leukemia Carter T. Davis, MD Hematology-Oncology Fellow Duke University Health System September 10, 2016 Overview Overview of Acute Myeloid Leukemia Review
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More information609G: Concepts of Cancer Genetics and Treatments (3 credits)
Master of Chemical and Life Sciences Program College of Computer, Mathematical, and Natural Sciences 609G: Concepts of Cancer Genetics and Treatments (3 credits) Text books: Principles of Cancer Genetics,
More informationDiscovering Rare Hematopoietic Clones Harboring Leukemia-Associated Mutations Using Error-Corrected Sequencing
Washington University in St. Louis Washington University Open Scholarship Arts & Sciences Electronic Theses and Dissertations Arts & Sciences Spring 5-15-2018 Discovering Rare Hematopoietic Clones Harboring
More informationLaboratory Service Report
Specimen Type Peripheral blood CR PDF Report available at: https://test.mmlaccess.com/reports/c7028846-ih2xuglwpq.ashx Indication for Test DS CR Pathogenic utations Detected CR 1. JAK2: c.1849g>t;p.val617phe
More informationCommissioning policies agreed by PCTs in Yorkshire and the Humber at Board meeting of YH SCG on December
Commissioning policies agreed by PCTs in Yorkshire and the Humber at Board meeting of YH SCG on December 17 2010. 32/10 Imatinib for gastrointestinal stromal tumours (unresectable/metastatic) (update on
More informationOverview. Methods 9/11/2017. Next Generation Sequencing and Precision Medicine in Hematological Malignancies. Genotyping in hematology
Overview Next Generation Sequencing and Precision Medicine in Hematological Malignancies Sharathkumar Bhagavathi, MD University of Iowa Carver College of Medicine NGS as a genotyping platform in hematopathology
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationN Engl J Med Volume 373(12): September 17, 2015
Review Article Acute Myeloid Leukemia Hartmut Döhner, M.D., Daniel J. Weisdorf, M.D., and Clara D. Bloomfield, M.D. N Engl J Med Volume 373(12):1136-1152 September 17, 2015 Acute Myeloid Leukemia Most
More informationNew drugs in Acute Leukemia. Cristina Papayannidis, MD, PhD University of Bologna
New drugs in Acute Leukemia Cristina Papayannidis, MD, PhD University of Bologna Challenges to targeted therapy in AML Multiple subtypes based upon mutations/cytogenetic aberrations No known uniform genomic
More informationMolecular and genetic alterations associated with therapy resistance and relapse of acute myeloid leukemia
Hackl et al. Journal of Hematology & Oncology (2017) 10:51 DOI 10.1186/s13045-017-0416-0 REVIEW Open Access Molecular and genetic alterations associated with therapy resistance and relapse of acute myeloid
More informationAppendix 6: Indications for adult allogeneic bone marrow transplant in New Zealand
Appendix 6: Indications for adult allogeneic bone marrow transplant in New Zealand This list provides indications for the majority of adult BMTs that are performed in New Zealand. A small number of BMTs
More information6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels
Clinical Genomics The CLIA Lab Perspective Disclosures Raju K. Pillai, M.D. Hematopathologist / Molecular Pathologist Director, Pathology Bioinformatics City of Hope National Medical Center, Duarte, CA
More informationGenomic complexity and arrays in CLL. Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy
Genomic complexity and arrays in CLL Gian Matteo Rigolin, MD, PhD St. Anna University Hospital Ferrara, Italy Clinical relevance of genomic complexity (GC) in CLL GC has been identified as a critical negative
More informationAll patients with FLT3 mutant AML should receive midostaurin-based induction therapy. Not so fast!
All patients with FLT3 mutant AML should receive midostaurin-based induction therapy Not so fast! Harry P. Erba, M.D., Ph.D. Professor, Internal Medicine Director, Hematologic Malignancy Program University
More informationPersonalised cancer care Information for Medical Specialists. A new way to unlock treatment options for your patients
Personalised cancer care Information for Medical Specialists A new way to unlock treatment options for your patients Contents Optimised for clinical benefit 4 Development history 4 Full FIND IT panel vs
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationAcute Myeloid Leukemia: A Patient s Perspective
Acute Myeloid Leukemia: A Patient s Perspective Patrick A Hagen, MD, MPH Cardinal Bernardin Cancer Center Loyola University Medical Center Maywood, IL Overview 1. What is AML? 2. Who gets AML? Epidemiology
More informationSummary of Key AML Abstracts Presented at the American Society of Hematology (ASH) December 2-6, San Diego CA
Summary of Key AML Abstracts Presented at the American Society of Hematology (ASH) December 2-6, 2016 - San Diego CA ASH 2016 ANNUAL MEETING: ABSTRACT SEARCH PAGE: https://ash.confex.com/ash/2016/webprogram/start.html
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationIntroduction of an NGS gene panel into the Haemato-Oncology MPN service
Introduction of an NGS gene panel into the Haemato-Oncology MPN service Dr. Anna Skowronska, Dr Jane Bryon, Dr Samuel Clokie, Dr Yvonne Wallis and Professor Mike Griffiths West Midlands Regional Genetics
More informationExamining Genetics and Genomics of Acute Myeloid Leukemia in 2017
Examining Genetics and Genomics of Acute Myeloid Leukemia in 2017 Elli Papaemmanuil, PhD Memorial Sloan Kettering Cancer Center New York, New York, United States Today s Talk Cancer genome introduction
More informationPersonalized Therapy for Acute Myeloid Leukemia. Patrick Stiff MD Loyola University Medical Center
Personalized Therapy for Acute Myeloid Leukemia Patrick Stiff MD Loyola University Medical Center 708-327-3216 Major groups of Mutations in AML Targets for AML: Is this Achievable? Chronic Myeloid Leukemia:
More informationNext Generation Sequencing in Haematological Malignancy: A European Perspective. Wolfgang Kern, Munich Leukemia Laboratory
Next Generation Sequencing in Haematological Malignancy: A European Perspective Wolfgang Kern, Munich Leukemia Laboratory Diagnostic Methods Cytomorphology Cytogenetics Immunophenotype Histology FISH Molecular
More informationTargeted NGS in oncology and hemato-oncology using in-house designed gene panels. Joni Van der Meulen Molecular Diagnostics UZ Ghent (MDG) 24/03/2017
Targeted NGS in oncology and hemato-oncology using in-house designed gene panels Joni Van der Meulen Molecular Diagnostics UZ Ghent (MDG) 24/03/2017 MDG = Molecular Diagnostics UZ Ghent Center for Medical
More informationNUMERATOR: Patients who had baseline cytogenetic testing performed on bone marrow
Quality ID #67 (NQF 0377): Hematology: Myelodysplastic Syndrome (MDS) and Acute Leukemias: Baseline Cytogenetic Testing Performed on Bone Marrow National Quality Strategy Domain: Effective Clinical Care
More informationTest Name Results Units Bio. Ref. Interval. Positive
LL - LL-ROHINI (NATIONAL REFERENCE 135091533 Age 28 Years Gender Male 1/9/2017 120000AM 1/9/2017 105415AM 4/9/2017 23858M Ref By Final LEUKEMIA DIAGNOSTIC COMREHENSIVE ROFILE, ANY 6 MARKERS t (1;19) (q23
More informationRecommended Timing for Transplant Consultation
REFERRAL GUIDELINES Recommended Timing for Transplant Consultation Published jointly by the National Marrow Donor Program /Be The Match and the American Society for Blood and Marrow Transplantation BeTheMatchClinical.org
More informationIllumina Trusight Myeloid Panel validation A R FHAN R A FIQ
Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol
More informationNeue zielgerichtete Behandlungsoptionen der neu diagnostizierten FLT3-positiven Akuten Myeloischen Leukämie (AML)
Neue zielgerichtete Behandlungsoptionen der neu diagnostizierten FLT3-positiven Akuten Myeloischen Leukämie (AML) Prof. Hartmut Döhner Klinik für Innere Medizin III, Universitätsklinikum Ulm Midostaurin
More informationGenomic Medicine: What every pathologist needs to know
Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and
More informationEvolving Targeted Management of Acute Myeloid Leukemia
Evolving Targeted Management of Acute Myeloid Leukemia Jessica Altman, MD Robert H. Lurie Comprehensive Cancer Center of Northwestern University Learning Objectives Identify which mutations should be assessed
More informationAML: WHO classification, biology and prognosis. Dimitri Breems, MD, PhD Internist-Hematoloog Ziekenhuis Netwerk Antwerpen
AML: WHO classification, biology and prognosis Dimitri Breems, MD, PhD Internist-Hematoloog Ziekenhuis Netwerk Antwerpen Acute myeloid leukemia Clonal expansion of undifferentiated myeloid precursors Impaired
More informationDr C K Kwan. Associate Consultant, Queen Elizabeth Hospital, HKSAR Honorary member, Targeted Therapy Team, ICR, UK
HA Convention 2013 Dr C K Kwan MBChB, FRCR, FHKCR, FHKAM, MPM, CPI, MAppMgt(Hlth) Associate Consultant, Queen Elizabeth Hospital, HKSAR Honorary member, Targeted Therapy Team, ICR, UK To personalize cancer
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationPatient Leader Education Summit. Precision Medicine: Today and Tomorrow March 31, 2017
Patient Leader Education Summit Precision Medicine: Today and Tomorrow March 31, 2017 Precision Medicine: Presentation Outline Agenda What is a Precision Medicine What is its clinical value Overview of
More informationDeep Learning Analytics for Predicting Prognosis of Acute Myeloid Leukemia with Cytogenetics, Age, and Mutations
Deep Learning Analytics for Predicting Prognosis of Acute Myeloid Leukemia with Cytogenetics, Age, and Mutations Andy Nguyen, M.D., M.S. Medical Director, Hematopathology, Hematology and Coagulation Laboratory,
More informationDr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory
Dr Yvonne Wallis Consultant Clinical Scientist West Midlands Regional Genetics Laboratory Personalised Therapy/Precision Medicine Selection of a therapeutic drug based on the presence or absence of a specific
More informationNEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca
NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA
More informationApplication of Whole Genome Microarrays in Cancer: You should be doing this test!!
Application of Whole Genome Microarrays in Cancer: You should be doing this test!! Daynna Wolff, Ph.D. Director, Cytogenetics and Genomics Disclosures Clinical Laboratory Director and Employee, Medical
More informationunderlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
Supplementary Figures Figure S1. Patient cohorts and study design. To define and interrogate the genetic alterations underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
More informationCurrent and future applications of Molecular Pathology. Kathy Walsh Clinical Scientist NHS Lothian
Current and future applications of Molecular Pathology Kathy Walsh Clinical Scientist NHS Lothian Molecular Pathology in Solid tumours Cancer type Genes tested Purpose Associated treatments Non small cell
More informationCase 089: Therapy Related t(8;21)(q22;q22) AML and
Case 089: Therapy Related t(8;21)(q22;q22) AML and SM-AHNMD ST Pullarkat 1, V Pullarkat 2, SH Kroft 3, CS Wilson 4, M Thein 5, WW Grody 1, and RK Brynes 5 1 UCLA, 2 City of Hope National Med Ctr, 3 Med
More informationHarmesh Naik, MD. Hope Cancer Clinic PERSONALIZED CANCER TREATMENT USING LATEST IN MOLECULAR BIOLOGY
Harmesh Naik, MD. Hope Cancer Clinic PERSONALIZED CANCER TREATMENT USING LATEST IN MOLECULAR BIOLOGY A NEW GENE A DAY.WHILE YOU ARE ENJOYING MORNING COFFEE From cancer.gov GOALS FOR THE CME TODAY A brief
More informationCell-free tumor DNA for cancer monitoring
Learning objectives Cell-free tumor DNA for cancer monitoring Christina Lockwood, PhD, DABCC, DABMGG Department of Laboratory Medicine 1. Define circulating, cell-free tumor DNA (ctdna) 2. Understand the
More informationSUPPLEMENTARY INFORMATION
Supplementary Information S1 Frequency of DNMT3A mutations in hematologic disorders and their associated clinical phenotypes. Disease Patient population Frequency (%) Associated Clinical Characteristics
More informationTransform genomic data into real-life results
CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for
More informationManagement of Myelodysplastic Syndromes
Management of Myelodysplastic Syndromes Peter L. Greenberg, MD Stanford Cancer Institute Myelodysplastic Syndromes: Clinical & Molecular Advances for Disease Classification and Prognostication MDSs: A
More informationSupplementary Tables. Supplementary Figures
Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample
More informationIdentifying Mutations Responsible for Rare Disorders Using New Technologies
Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance
More informationSmouldering Myeloma: to treat or not to treat?
Smouldering Myeloma: to treat or not to treat? Massimo Offidani Clinica di Ematologia Azienda Ospedaliero-Universitaria Ospedali Riuniti di Ancona Definitions and epidemiology 3000-5000 new SMM/year in
More informationPrecision Medicine and Molecular Testing.
Precision Medicine and Molecular Testing. David A. Sallman, MD Assistant Member Department of Malignant Hematology Moffitt Cancer Center david.sallman@moffitt.org Disclosures Research funding for Celgene
More informationOut-Patient Billing CPT Codes
Out-Patient Billing CPT Codes Updated Date: August 3, 08 Client Billed Molecular Tests HPV DNA Tissue Testing 8764 No Medicare Billed - Molecular Tests NeoARRAY NeoARRAY SNP/Cytogenetic No 89 NeoLAB NeoLAB
More informationSubclones dominate at MDS progression following allogeneic hematopoietic cell transplant
Subclones dominate at MDS progression following allogeneic hematopoietic cell transplant Meagan A. Jacoby,, Timothy A. Graubert, Matthew J. Walter JCI Insight. 2018;3(5):e98962.. Research Article Genetics
More informationADVANCES IN CHILDHOOD ACUTE LEUKEMIAS : GENERAL OVERVIEW
ADVANCES IN CHILDHOOD ACUTE LEUKEMIAS : GENERAL OVERVIEW Danièle SOMMELET European Scientific Seminar Luxemburg, 3.11.2009 1 Definition of acute leukemias Malignant process coming from lymphoid (85 %)
More informationPros and cons of liquid biopsy: Ready to replace tissue?
Pros and cons of liquid biopsy: Ready to replace tissue? 2-Day Molecular Biologists Symposium: Liquid biopsies Federico Rojo Enterprise Interest No disclosures. Biological limitations for molecular testing:
More informationThe BCR-ABL1 fusion. Epidemiology. At the center of advances in hematology and molecular medicine
At the center of advances in hematology and molecular medicine Philadelphia chromosome-positive chronic myeloid leukemia Robert E. Richard MD PhD rrichard@uw.edu robert.richard@va.gov Philadelphia chromosome
More informationNew Developments in Cancer Treatment. Ian Rabinowitz MD
New Developments in Cancer Treatment Ian Rabinowitz MD Treatment Outline Angiogenesis inhibition Targeted therapy Immunotherapy Personalization of therapy Genomics and cancer Stem cells and cancer Angiogenesis
More informationPublished Ahead of Print on April 14, 2016, as doi: /haematol Copyright 2016 Ferrata Storti Foundation.
Published Ahead of Print on April 14, 2016, as doi:10.3324/haematol.2016.143214. Copyright 2016 Ferrata Storti Foundation. Immunohistochemical pattern of p53 is a measure of TP53 mutation burden and adverse
More informationNext generation sequencing analysis - A UK perspective. Nicholas Lea
Next generation sequencing analysis - A UK perspective Nicholas Lea King s HMDC LMH is part of an integrated pathology service at King s Haematological Malignancy Diagnostic Centre (HMDC) HMDC serves population
More information