Please Silence Your Cell Phones. Thank You
|
|
- Beverly Norris
- 5 years ago
- Views:
Transcription
1
2 Please Silence Your Cell Phones Thank You
3 Utility of NGS and Comprehensive Genomic Profiling in Hematopathology Practice Maria E. Arcila M.D. Memorial Sloan Kettering Cancer Center New York, NY
4 Disclosure of Relevant Financial Relationships The USCAP requires that anyone in a position to influence or control the content of all CME activities disclose any relevant relationship(s) which they or their spouse/partner have, or have had within the past 12 months with a commercial interest(s) [or the products or services of a commercial interest] that relate to the content of this educational activity and create a conflict of interest. Complete disclosure information is maintained in the USCAP office and has been reviewed by the CME Advisory Committee. Dr. Maria E. Arcila declares affiliation with Raindance Technologies and InVivoScribe
5 Overview Mutation profiling in hematologic malignancies Basic concepts of NGS as a genotyping platform Practical applications in the clinical lab (case based) Sequencing in AML / MDS / MPN Sequencing in lymphomas Clonality testing NGS as a discovery tool in clinical care Future directions
6 Molecular testing in Hematologic Malignancies Integral part of diagnostic work-up for myeloid neoplasms AML, MDS, MPN, MDS/MPN Continuously growing list of mutated genes with clinical utility (diagnostic, prognostic and predictive value) NPM1, FLT3, RAS (KRAS, NRAS), KIT, CEBPA, WT1, IDH1, IDH2, DNMT3A, EZH2, JAK2, MPL, TET2, PHF6. Several altered genes with new associations in lymphoid malignancies BRAF, MYD88, MLL2, NOTCH1, SF3B1
7 AML (NEJM 366;12, 2012) Mutation Profiling of AML/MDS MDS (NEJM364;26, 2011)
8
9 Most frequent somatic genetic mutations Blood Cancer Journal (2013) 3, e127; doi: /bcj
10 Testing based on single gene and low throughput multiplex assays is a challenge for clinical labs High volume Multiple platforms Complex workflows High DNA requirement Results not available simultaneously for clinical decision making
11 Molecular Methods SNVs Small duplications, insertions, deletions, indels PCR and Sanger dideoxy seq Variant Types Exon duplications, deletions or gene copy number changes SVs PCR and pyrosequencing +/ 1 PCR and mass Spectrometry +/ 1 Fragment analysis, CE Allele specific PCR Real Time PCR FISH +/ 1 NGS custompanels (amplicon capture) NGS custom panels (hybridization capture) +/ 1 NGS wholeexome +/ 1 NGS whole genome
12 NGS Applications in clinical practice Susceptibility genes Risk assessment Risk management Patient stratification Prediction of therapeutic response Therapeutic monitoring Molecular profiling Tumor sub typing Somatic/driver mutations Clonality testing Methylation Epigenetic changes Alterations in gene expression Micro RNAs
13 NGS IN CLINICAL PRACTICE Options Whole genome, whole exome or targeted sequencing Targeted sequencing panels are preferred Disease targeted sequencing aids in therapeutic decision making at adequate time frame Yield much higher coverage of genomic regions of interest Reduces sequencing cost and time. More affordable
14 Hybridization Capture ~50 20,000 genes Library fragments Custom capture probes B B B B B B B B B B Bind hybrids to streptavidin magnetic beads Wash, elute and amplify Sequence to X (HiSeq 2500)
15 Amplicon Capture ~1 50 genes
16 Platform chosen based on needs and capabilities of the lab Illumina MiSeq Illumina HiSeq Ion Torrent PGM Ion Torrent Proton All commercially available sequencers have shared attributes: Random fragmentation of starting DNA Ligation with custom linkers = a library Amplification on a solid surface (either bead or glass) Direct step by step detection of incorporated bases during the sequencing reaction
17 shared attributes (continued) Hundreds of thousands to hundreds of millions of reactions imaged per instrument run = massively parallel sequencing A digital read type that enables direct quantitative comparisons A sequencing mechanism that samples both ends of every fragment sequenced ( paired end reads)
18 Practical applications through a case based approach AML/MDS/MPN panel amplicon capture (enrichment using pico droplet PCR) Broad based hybridization capture panel Clonality testing and MRD
19 Patient # 1 74 yo female with newly diagnosed AML Most basic workup CEBPA, NPM1, and FLT3 ITD More extensive profiling can better discriminate patients with AML into various prognostic groups
20 MSKCC Rapid Myeloid Panel ASXL1 ETV6 IDH2 KIT NRAS SF3B1 TET2 CBL EZH2 JAK1 KRAS PHF6 SH2B3 TP53 CEBPA FLT3 JAK2 MPL PTEN SUZ12 TYK2 DNMT3A IDH1 JAK3 NPM1 RUNX1 TET1 WT1 - MSKCC Thunderstorm myeloid assay - Amplicon capture - 28 genes target regions, 856 amplicons - 12 samples per run + controls sequenced on Illumina MiSeq
21 Targeted sequencing using Microdroplet PCR Deep Sequencing Technology Millions of unique single molecule pico droplet PCR reactions Highly uniform single plex PCR products Maximum coverage for the target region of interest and regions not easily targeted by hybridization methods High on target sequence reads PCR primers are synthesized and individually reformatted into droplets with each droplet containing only a single primer pair. Primer library Partitioned DNA sample + master mix
22 IDH2 mutation Bone marrow Neg control
23 Patient #1 monitoring IDH2 R140Q FLT3 D835Y WT1 K141fs RUNX1 Q262X SUZ12 G11R blast count Day 28 Screening Date Pretrial Day 3 Cycle 2 Day 1 Cycle 3 Day /13/14 2/24/14 3/28/14 4/24/14 WT1 p.k141fs 0.32 WT1 p.k141fs 0.04 WT1 p.k141fs 0.23 WT1 p.k141fs 0.43 IDH2 p.r140q 0.32 IDH2 p.r140q 0.08 IDH2 p.r140q 0.19 IDH2 p.r140q 0.31 RUNX1 p.q262x 0.24 RUNX1 p.q262x 0.06 RUNX1 p.q262x 0.18 RUNX1 p.q262x 0.12 SUZ12 p.g11r 0.09 SUZ12 p.g11r 0.26 FLT3 p.d835y % blasts 30% blasts 56% blasts 70% blasts
24 Example #2 Monitoring
25 Clinical Utility of Test Results Diagnostic and prognostic work up Monitoring of disease Identification of targetable markers Detection of biomarkers not detected in specific settings if broad panel not used Insights into tumor biology
26 Monitoring and assessment of heterogeneity Digital read out of the allelic fraction of sequencing reads for each mutation in the tumor cell population Prevalence of mutation reflects the history of the tumor evolution Older mutations are present at higher variant allele fraction (VAF) and define founder clones Subclones contain founder plus lower VAF mutations Monitoring of progression and evolutionary forces in response to therapy
27 Patient #3 59 y/o male with CLL Initial diagnosis Disease progression : anemia, weight loss lymphocytosis and lymphadenopathy CD5+ lymphoma colon Started on pentostatin, cyclophosphamide, rituximab Progressive disease with numerous infectious and medical complications, Treated with RCVP bendamustin Infectious complications, Expired at age 77
28 Genetics FISH: Blood 2008: ATM deletion in 6.2% of the interphase cells, no evidence of trisomy 12, 13q deletion or loss of the p53 BM 2008: Normal for CLL FISH panel Subsequent samples, blood and BM: Normal for CLL FISH panel IGVH gene analysis V3 48; Mutation Frequency: 0% 28
29 Genetic profiling DNA and RNA NGS sequencing of an extensive panel of all genes known to be recurrently mutated in lymphoid and myeloid malignancies DNA 374 cancer related genes RNA 272 genes frequently rearranged 29
30 Results of DNA and RNA sequencing: 2005 INITIAL PRESENTATION MUTATIONS (gene name/nucleotide change/aa change/variant allele frequency, read depth) ZMYM3_c1784_1785insA_p.H595fs*9(0.89) FBXW7_c1508_1508delC_p.A503fs*21(0.21), PTPN11_c.1505C>T_p.S502L(0.16) NOTCH1_c7541_7542delCT_p.P2514fs*4(0.07), NSD1_c.6085A>G_p.T2029A(0.20), SPEN_c2591_2592delAA_p.K864fs*28(0.24) SPEN_c.2645_2645delG_p.R882fs*2(0.24) NOTCH1_c.7318C>T_p.Q2440*(0.10) BIRC3_c1282_1283insG_p.E429fs*9(0.07) NOTCH2_c.7021C>T_p.Q2341*(0.06), 2011 MUTATIONS IN PROGRESSION SAMPLE (gene name/nucleotide change/aa change/variant allele frequency, read depth) ZMYM3_c.1784_1785insA_p.H595fs*9(0.87) FBXW7_c.1508_1508delC_p.A503fs*21(0.45) PTPN11_c.1505C>T_p.S502L(0.41) NOTCH1_c.7541_7542delCT_p.P2514fs*4(0.30) BCOR_c.4720_4720delC_p.P1574fs*10(0.09) BRAF_c.1781A>G_p.D594G(0.06) NRAS_c.182A>G_p.Q61R(0.05) NRAS_c.38G>A_p.G13D(0.02) TP53_c.747G>T_p.R249S(0.04) TP53_c.641A>G_p.H214R(0.02) TP53_c.637C>T_p.R213*(0.06) The mutation pattern and allelic frequency is significantly different in two time points suggesting marked subclonal diversity marked biological heterogeneity despite homogeneous morphology.
31 Interesting features of the case At diagnosis CLL with classic morphology and immunophenotype Unique mutation pattern NOTCH1 Subclonal NOTCH2 mutations At progression Emergence of high risk mutations NRAS and TP53 Likely accounting for the adverse clinical outcome NOTCH1 mutations are seen 10% of newly diagnosed CLL Distinct clinicopathologic subgroup characterized by deregulated cell cycle and short survival Associated with unmutated IGHV and trisomy 12 NOTCH2 regulator of CD23 expression in CLL mutations described in SMZL but not in CLL
32 Clinical utility Comprehensive, targeted next generation sequencing based genetic analysis Provides unprecedented biological information in CLL Likely to change our approach to diagnosis, monitoring, risk assessment and predicting therapy response. 32
33 Clonality testing by NGS methods Patient #4 68 yo male Increasing lymphocytosis since 2011 Adult T cell lymphoma / leukemia TCRG
34 Patient underwent bone marrow transplantation TCRG Diagnostic clone TCRG post transplant
35 TCRG Diagnostic clone AGAATCAGTAGAGGAAAGTATTTTACTTATGCAAGCATGAGGAGGAGCTGGAAATTGATATTGCAAAATCTAATTGAAAATGATTCTGGATCTATTACTGT
36 TCRG post transplant
37 Clinical utility Next generation sequencing based clonality assays Efficiently detect IGH and TCRG gene rearrangements Concurrently identify sequence information required to track clones in subsequent samples Concurrent assessment of somatic hypermutation simple and highly concordant with CE/Sanger assays
38
39 NGS in the clinical lab Advantages High throughput Better sensitivity Efficient use of limited tissue Consolidation of platforms Wider range of mutation detection Ability to monitor frequency of a specific mutations at determined time frames Challenges for Clinical Implementation Selection of test platform Establishing bioinformatics infrastructure Evaluation of multi gene panels Establishment of assay characteristics Validation on different sample types Results interpretation and reporting Legal and ethical issues Billing and compliance
40 Standardized nomenclature Standardized web based signouts Tracking of mutations in multiple samples
41 Practical Challenges (of medical and legal implications) Reporting of larger scale genomic information Reporting of all versus selected genes Mutations in unordered genes Germline variants Variants of potential significance originating from donors Integration in clinical management Logistics Re engineering of workflow Billing and compliance
42 Conclusions Next generation sequencing methods are Driving discovery in the research setting Supplanting older technology in clinical laboratories Vastly simplify workflows Consolidates several assays reduction of work load and significant cost savings All testing can be reported at once providing full and more comprehensive molecular diagnosis to be used in a clinically actionable time
43 Clinical Molecular Diagnostics Laboratory MSKCC
44 Important Information Regarding CME/SAMs The Online CME/Evaluations/SAM claim process will only be available on the USCAP website until October 2, No claims can be processed after that date! After October 2, 2015 you will NOT be able to obtain any CME or SAMs credits for attending this meeting.
45 Thank You! Please go to the USCAP website to complete your Evaluation of the course and claim CME and/or SAMs Credits.
ADRL Advanced Diagnostics Research Laboratory
ADRL Advanced Diagnostics Research Laboratory John DeCoteau, MD FRCP Department of Pathology, Division of Hematopathology University of Saskatchewan Saskatchewan Cancer Agency ADRL Project Objectives New
More informationIllumina Trusight Myeloid Panel validation A R FHAN R A FIQ
Illumina Trusight Myeloid Panel validation A R FHAN R A FIQ G E NETIC T E CHNOLOGIST MEDICAL G E NETICS, CARDIFF To Cover Background to the project Choice of panel Validation process Genes on panel, Protocol
More informationIntroduction of an NGS gene panel into the Haemato-Oncology MPN service
Introduction of an NGS gene panel into the Haemato-Oncology MPN service Dr. Anna Skowronska, Dr Jane Bryon, Dr Samuel Clokie, Dr Yvonne Wallis and Professor Mike Griffiths West Midlands Regional Genetics
More informationNext Generation Sequencing in Haematological Malignancy: A European Perspective. Wolfgang Kern, Munich Leukemia Laboratory
Next Generation Sequencing in Haematological Malignancy: A European Perspective Wolfgang Kern, Munich Leukemia Laboratory Diagnostic Methods Cytomorphology Cytogenetics Immunophenotype Histology FISH Molecular
More informationOut-Patient Billing CPT Codes
Out-Patient Billing CPT Codes Updated Date: August 3, 08 Client Billed Molecular Tests HPV DNA Tissue Testing 8764 No Medicare Billed - Molecular Tests NeoARRAY NeoARRAY SNP/Cytogenetic No 89 NeoLAB NeoLAB
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationAugust 17, Dear Valued Client:
August 7, 08 Re: CMS Announces 6-Month Period of Enforcement Discretion for Laboratory Date of Service Exception Policy Under the Medicare Clinical Laboratory Fee Schedule (the 4 Day Rule ) Dear Valued
More informationOverview. Methods 9/11/2017. Next Generation Sequencing and Precision Medicine in Hematological Malignancies. Genotyping in hematology
Overview Next Generation Sequencing and Precision Medicine in Hematological Malignancies Sharathkumar Bhagavathi, MD University of Iowa Carver College of Medicine NGS as a genotyping platform in hematopathology
More informationLaboratory Service Report
Client C7028846-DLP Rochester Rochester, N 55901 Specimen Type Peripheral blood CR PDF Report available at: https://test.mmlaccess.com/reports/c7028846-zwselwql7p.ashx Indication for Test DS CR Pathogenic
More informationMolecular Markers. Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC
Molecular Markers Marcie Riches, MD, MS Associate Professor University of North Carolina Scientific Director, Infection and Immune Reconstitution WC Overview Testing methods Rationale for molecular testing
More informationNeoTYPE Cancer Profiles
NeoTYPE Cancer Profiles Multimethod Analysis of 25+ Hematologic Diseases and Solid Tumors Anatomic Pathology FISH Molecular The next generation of diagnostic, prognostic, and therapeutic assessment NeoTYPE
More informationObjectives. Morphology and IHC. Flow and Cyto FISH. Testing for Heme Malignancies 3/20/2013
Molecular Markers in Hematologic Malignancy: Ways to locate the needle in the haystack. Objectives Review the types of testing for hematologic malignancies Understand rationale for molecular testing Marcie
More informationNext generation sequencing analysis - A UK perspective. Nicholas Lea
Next generation sequencing analysis - A UK perspective Nicholas Lea King s HMDC LMH is part of an integrated pathology service at King s Haematological Malignancy Diagnostic Centre (HMDC) HMDC serves population
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationThe Challenges of Precision Medicine: New Advances in Molecular Diagnostic Testing- Impact for Healthcare
The Challenges of Precision Medicine: New Advances in Molecular Diagnostic Testing- Impact for Healthcare Jessica Wang-Rodriguez, MD Chief, VISN22 Consolidated Pathology and Laboratory Medicine Services
More informationMolecular. Oncology & Pathology. Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine. Liquid Biopsy.
Molecular Oncology & Pathology Hereditary Cancer Somatic Cancer Liquid Biopsy Next-Gen Sequencing qpcr Sanger Sequencing Diagnostic, Prognostic, Therapeutic, and Predisposition Tests in Precision Medicine
More informationMolecular Genetic Testing for the Diagnosis of Haematological Malignancies
Molecular Genetic Testing for the Diagnosis of Haematological Malignancies Dr Anthony Bench Haemto-Oncology Diagnostic Service Cambrıdge Unıversıty Hospitals NHS Foundatıon Trust Cambridge UK Molecular
More informationMutational Impact on Diagnostic and Prognostic Evaluation of MDS
Mutational Impact on Diagnostic and Prognostic Evaluation of MDS Elsa Bernard, PhD Papaemmanuil Lab, Computational Oncology, MSKCC MDS Foundation ASH 2018 Symposium Disclosure Research funds provided by
More informationFluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
More informationMolecular Advances in Hematopathology
Molecular Advances in Hematopathology HOW MOLECULAR METHODS HAVE CHANGED MY PRACTICE Objectives Understand the importance of cytogenetic/molecular studies in hematolymphoid diseases Know some of the important
More informationNeoTYPE Cancer Profiles
NeoTYPE Cancer Profiles 30+ Multimethod Assays for Hematologic Diseases and Solid Tumors Molecular FISH Anatomic Pathology The next generation of diagnostic, prognostic, and therapeutic assessment What
More informationGenomic Medicine: What every pathologist needs to know
Genomic Medicine: What every pathologist needs to know Stephen P. Ethier, Ph.D. Professor, Department of Pathology and Laboratory Medicine, MUSC Director, MUSC Center for Genomic Medicine Genomics and
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Patel JP, Gönen M, Figueroa ME, et al. Prognostic relevance
More informationSESSION 1 Reactive cytopenia and dysplasia
SESSION 1 Reactive cytopenia and dysplasia Falko Fend, Tübingen & Alexandar Tzankov, Basel 1 Disclosure of speaker s interests (Potential) conflict of interest none Potentially relevant company relationships
More informationLaboratory Service Report
Specimen Type Peripheral blood CR PDF Report available at: https://test.mmlaccess.com/reports/c7028846-ih2xuglwpq.ashx Indication for Test DS CR Pathogenic utations Detected CR 1. JAK2: c.1849g>t;p.val617phe
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationThe Center for PERSONALIZED DIAGNOSTICS
The Center for PERSONALIZED DIAGNOSTICS Precision Diagnostics for Personalized Medicine A joint initiative between The Department of Pathology and Laboratory Medicine & The Abramson Cancer Center The (CPD)
More informationWest Midlands Regional Genetics Laboratory
West Midlands Regional Genetics Laboratory Haemato-oncology service update letter October 2017 Dear colleagues, We are writing to outline the latest developments to our service, aiming to support the management
More informationTEST MENU TEST CPT CODES TAT. Chromosome Analysis Bone Marrow x 2, 88264, x 3, Days
TEST MENU CANCER/LEUKEMIA CHROMOSOME ANALYSIS Chromosome Analysis Bone Marrow 88237 x 2, 88264, 88280 x 3, 88291 4 Days Chromosome Analysis Bone Marrow Core 88237 x 2, 88264, 88280 x 3, 88291 4 Days Chromosome
More informationBlastic Plasmacytoid Dendritic Cell Neoplasm with DNMT3A and TET2 mutations (SH )
Blastic Plasmacytoid Dendritic Cell Neoplasm with DNMT3A and TET2 mutations (SH2017-0314) Habibe Kurt, Joseph D. Khoury, Carlos E. Bueso-Ramos, Jeffrey L. Jorgensen, Guilin Tang, L. Jeffrey Medeiros, and
More informationAccel-Amplicon Panels
Accel-Amplicon Panels Amplicon sequencing has emerged as a reliable, cost-effective method for ultra-deep targeted sequencing. This highly adaptable approach is especially applicable for in-depth interrogation
More informationFollicular Lymphoma: the WHO
Follicular Lymphoma: the WHO and the WHERE? Yuri Fedoriw, MD Associate Professor of Pathology and Laboratory Medicine Director of Hematopathology University of North Carolina Chapel Hill, NC Disclosure
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationJuan Ma 1, Jennifer Dunlap 2, Lisong Shen 1, Guang Fan 2 1
Juan Ma 1, Jennifer Dunlap 2, Lisong Shen 1, Guang Fan 2 1 Xin Hua Hospital, Shanghai, China 2 Oregon Health & Science University, Portland, OR, United States AML is a hematopoietic neoplasms characterized
More informationAcute leukemia and myelodysplastic syndromes
11/01/2012 Post-ASH meeting 1 Acute leukemia and myelodysplastic syndromes Peter Vandenberghe Centrum Menselijke Erfelijkheid & Afdeling Hematologie, UZ Leuven 11/01/2012 Post-ASH meeting 2 1. Acute myeloid
More informationChanging AML Outcomes via Personalized Medicine: Transforming Cancer Management with Genetic Insight
Changing AML Outcomes via Personalized Medicine: Transforming Cancer Management with Genetic Insight Co-Moderators: Rick Winneker, PhD, Senior Vice President, Research, Leukemia & Lymphoma Society Mike
More informationCase 1. Sa A.Wang, MD UT MD Anderson Cancer Center Houston, TX
Case 1 Sa A.Wang, MD UT MD Anderson Cancer Center Houston, TX Disclosure of Relevant Financial Relationships The USCAP requires that anyone in a position to influence or control the content of all CME
More informationExamining Genetics and Genomics of Acute Myeloid Leukemia in 2017
Examining Genetics and Genomics of Acute Myeloid Leukemia in 2017 Elli Papaemmanuil, PhD Memorial Sloan Kettering Cancer Center New York, New York, United States Today s Talk Cancer genome introduction
More informationIV Simposio International Sao Paulo Nov Hematologic malignant diseases molecular information, present and future
IV Simposio International Sao Paulo Nov 7 2012 Hematologic malignant diseases molecular information, present and future Dr. rer. nat. Alexander Kohlmann, MLL Munich Leukemia Laboratory Spectrum of Methods
More informationBHS Annual Meeting
BHS Annual Meeting 2014 01.02.2014 Implementing next-generation deepsequencing assays in diagnostic algorithms in hematological malignancies Dr. Alexander Kohlmann Medical Need for Molecular Characterization
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationSureSelect Cancer All-In-One Custom and Catalog NGS Assays
SureSelect Cancer All-In-One Custom and Catalog NGS Assays Detect all cancer-relevant variants in a single SureSelect assay SNV Indel TL SNV Indel TL Single DNA input Single AIO assay Single data analysis
More informationClonal Evolution of saml. Johnnie J. Orozco Hematology Fellows Conference May 11, 2012
Clonal Evolution of saml Johnnie J. Orozco Hematology Fellows Conference May 11, 2012 CML: *bcr-abl and imatinib Melanoma: *braf and vemurafenib CRC: *k-ras and cetuximab Esophageal/Gastric: *Her-2/neu
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More informationConcomitant WT1 mutations predicted poor prognosis in CEBPA double-mutated acute myeloid leukemia
Concomitant WT1 mutations predicted poor prognosis in CEBPA double-mutated acute myeloid leukemia Feng-Ming Tien, Hsin-An Hou, Jih-Luh Tang, Yuan-Yeh Kuo, Chien-Yuan Chen, Cheng-Hong Tsai, Ming Yao, Chi-Cheng
More informationMEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)
Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)
More informationNew drugs in Acute Leukemia. Cristina Papayannidis, MD, PhD University of Bologna
New drugs in Acute Leukemia Cristina Papayannidis, MD, PhD University of Bologna Challenges to targeted therapy in AML Multiple subtypes based upon mutations/cytogenetic aberrations No known uniform genomic
More informationMolecular Diagnostics of Myeloid and Lymphoid Neoplasms
Molecular Diagnostics of Myeloid and Lymphoid Neoplasms Molecular Pathology: Principles in Clinical Practice - 2012 John Greg Howe Ph.D. Department of Laboratory Medicine Yale University School of Medicine
More informationGenetic analysis and preclinical modeling of leukemic transformation of myeloproliferative neoplasms: Implications for therapeutic strategies
Genetic analysis and preclinical modeling of leukemic transformation of myeloproliferative neoplasms: Implications for therapeutic strategies Raajit Rampal, MD, PhD Assistant Attending Physician Leukemia
More informationTP53 mutational profile in CLL : A retrospective study of the FILO group.
TP53 mutational profile in CLL : A retrospective study of the FILO group. Fanny Baran-Marszak Hopital Avicenne Bobigny France 2nd ERIC workshop on TP53 analysis in CLL, Stresa 2017 TP53 abnormalities :
More informationNGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
More informationNEXT GENERATION SEQUENCING. R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca
NEXT GENERATION SEQUENCING R. Piazza (MD, PhD) Dept. of Medicine and Surgery, University of Milano-Bicocca SANGER SEQUENCING 5 3 3 5 + Capillary Electrophoresis DNA NEXT GENERATION SEQUENCING SOLEXA-ILLUMINA
More informationDisclosure. Summary. Circulating DNA and NGS technology 3/27/2017. Disclosure of Relevant Financial Relationships. JS Reis-Filho, MD, PhD, FRCPath
Circulating DNA and NGS technology JS Reis-Filho, MD, PhD, FRCPath Director of Experimental Pathology, Department of Pathology Affiliate Member, Human Oncology and Pathogenesis Program Disclosure of Relevant
More informationPublished Ahead of Print on April 14, 2016, as doi: /haematol Copyright 2016 Ferrata Storti Foundation.
Published Ahead of Print on April 14, 2016, as doi:10.3324/haematol.2016.143214. Copyright 2016 Ferrata Storti Foundation. Immunohistochemical pattern of p53 is a measure of TP53 mutation burden and adverse
More informationEnabling Personalized
Molecular Enabling Personalized Diagnostics Medicine- Targeted Sequencing: NGS-based solutions Silvia Dorn Roel Reinders- Andreas Diplas Friday, 19.06.2015 Company Overview Founded in April 2011 Development
More informationSupplemental Material. The new provisional WHO entity RUNX1 mutated AML shows specific genetics without prognostic influence of dysplasia
Supplemental Material The new provisional WHO entity RUNX1 mutated AML shows specific genetics without prognostic influence of dysplasia Torsten Haferlach, 1 Anna Stengel, 1 Sandra Eckstein, 1 Karolína
More informationMEDICAL POLICY. SUBJECT: MOLECULAR PANEL TESTING OF CANCERS TO IDENTIFY TARGETED THERAPIES (Excluding NSCLC and CRC) EFFECTIVE DATE: 12/21/17
MEDICAL POLICY SUBJECT: MOLECULAR PANEL TESTING OF PAGE: 1 OF: 5 If a product excludes coverage for a service, it is not covered, and medical policy criteria do not apply. If a commercial product, including
More informationMyeloma Genetics what do we know and where are we going?
in partnership with Myeloma Genetics what do we know and where are we going? Dr Brian Walker Thames Valley Cancer Network 14 th September 2015 Making the discoveries that defeat cancer Myeloma Genome:
More informationSupplementary Figure 1
Count Count Supplementary Figure 1 Coverage per amplicon for error-corrected sequencing experiments. Errorcorrected consensus sequence (ECCS) coverage was calculated for each of the 568 amplicons in the
More informationDISCLOSURE Luca Malcovati, MD. No financial relationships to disclose
ICUS, CCUS and CHIP Luca Malcovati, MD Department of Molecular Medicine, University of Pavia Medical School, & Department of Hematology Oncology, IRCCS Policlinico S. Matteo Foundation, Pavia, Italy DISCLOSURE
More informationNext generation histopathological diagnosis for precision medicine in solid cancers
Next generation histopathological diagnosis for precision medicine in solid cancers from genomics to clinical application Aldo Scarpa ARC-NET Applied Research on Cancer Department of Pathology and Diagnostics
More informationMEDICAL POLICY Genetic Testing for Breast and Ovarian Cancers
POLICY: PG0067 ORIGINAL EFFECTIVE: 07/30/02 LAST REVIEW: 01/25/18 MEDICAL POLICY Genetic Testing for Breast and Ovarian Cancers GUIDELINES This policy does not certify benefits or authorization of benefits,
More informationDetecting Oncogenic Mutations in Whole Blood
WHITE PAPER Detecting Oncogenic Mutations in Whole Blood Analytical validation of Cynvenio Biosystems LiquidBiopsy circulating tumor cell (CTC) capture and next-generation sequencing (NGS) September 2013
More informationNGS ONCOPANELS: FDA S PERSPECTIVE
NGS ONCOPANELS: FDA S PERSPECTIVE CBA Workshop: Biomarker and Application in Drug Development August 11, 2018 Rockville, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration
More informationPerformance Characteristics BRCA MASTR Plus Dx
Performance Characteristics BRCA MASTR Plus Dx with drmid Dx for Illumina NGS systems Manufacturer Multiplicom N.V. Galileïlaan 18 2845 Niel Belgium Table of Contents 1. Workflow... 4 2. Performance Characteristics
More informationA complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis
APPLICATION NOTE Cell-Free DNA Isolation Kit A complete next-generation sequencing workfl ow for circulating cell-free DNA isolation and analysis Abstract Circulating cell-free DNA (cfdna) has been shown
More informationNGS IN ONCOLOGY: FDA S PERSPECTIVE
NGS IN ONCOLOGY: FDA S PERSPECTIVE ASQ Biomed/Biotech SIG Event April 26, 2018 Gaithersburg, MD You Li, Ph.D. Division of Molecular Genetics and Pathology Food and Drug Administration (FDA) Center for
More informationDr David Guttery Senior PDRA Dept. of Cancer Studies and CRUK Leicester Centre University of Leicester
Dr David Guttery Senior PDRA Dept. of Cancer Studies and CRUK Leicester Centre University of Leicester dsg6@le.ac.uk CFDNA/CTDNA Circulating-free AS A LIQUID DNA BIOPSY (cfdna) Tumour Biopsy Liquid Biopsy
More informationCGC myeloid malignancy working group updates. Xinjie Xu & Rashmi Kanagal-Shamanna
CGC myeloid malignancy working group updates Xinjie Xu & Rashmi Kanagal-Shamanna 8-9-2016 Group members Gordana Raca Children's Hospital Los Angeles Xinjie Xu University of Utah ARUP Laboratories Rashmi
More informationTargeted NGS in oncology and hemato-oncology using in-house designed gene panels. Joni Van der Meulen Molecular Diagnostics UZ Ghent (MDG) 24/03/2017
Targeted NGS in oncology and hemato-oncology using in-house designed gene panels Joni Van der Meulen Molecular Diagnostics UZ Ghent (MDG) 24/03/2017 MDG = Molecular Diagnostics UZ Ghent Center for Medical
More informationAPPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST PROSPECTIVE
AMP COMPANION MEETING SYMPOSIUM AT USCAP 2015 NEXT-GENERATION OF PATHOLOGY: ROLE OF PATHOLOGIST IN NGS-BASED PERSONALIZED MEDICINE APPLICATIONS OF NEXT GENERATION SEQUENCING IN SOLID TUMORS - PATHOLOGIST
More informationLiquid biopsy in lung cancer: The EGFR paradigm
Liquid biopsy in lung cancer: The EGFR paradigm Lynette M. Sholl, M.D. Brigham and Women s Hospital Dana Farber Cancer Institute Department of Pathology Boston, MA Disclosure of Relevant Financial Relationships
More informationIntelliGENSM. Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community.
IntelliGENSM Integrated Oncology is making next generation sequencing faster and more accessible to the oncology community. NGS TRANSFORMS GENOMIC TESTING Background Cancers may emerge as a result of somatically
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationSchool of Pathology and Laboratory Medicine: Current and New Research Interests
School of Pathology and Laboratory Medicine: Current and New Research Interests W/Professor Wendy Erber Current Research Interests Viral immunology and immunogenetics Bone pathology and cell signalling
More informationClinical Grade Biomarkers in the Genomic Era Observations & Challenges
Clinical Grade Biomarkers in the Genomic Era Observations & Challenges IOM Committee on Policy Issues in the Clinical Development & Use of Biomarkers for Molecularly Targeted Therapies March 31-April 1,
More informationReporting cytogenetics Can it make sense? Daniel Weisdorf MD University of Minnesota
Reporting cytogenetics Can it make sense? Daniel Weisdorf MD University of Minnesota Reporting cytogenetics What is it? Terminology Clinical value What details are important Diagnostic Tools for Leukemia
More informationComprehensive Analyses of Circulating Cell- Free Tumor DNA
Comprehensive Analyses of Circulating Cell- Free Tumor DNA Boston, MA June 28th, 2016 Derek Murphy, Ph.D. Scientist, Research and Development Personal Genome Diagnostics Acquisition of Somatic Alterations
More informationMolecular Markers in Acute Leukemia. Dr Muhd Zanapiah Zakaria Hospital Ampang
Molecular Markers in Acute Leukemia Dr Muhd Zanapiah Zakaria Hospital Ampang Molecular Markers Useful at diagnosis Classify groups and prognosis Development of more specific therapies Application of risk-adjusted
More informationTransform genomic data into real-life results
CLINICAL SUMMARY Transform genomic data into real-life results Biomarker testing and targeted therapies can drive improved outcomes in clinical practice New FDA-Approved Broad Companion Diagnostic for
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More informationIdentification and clinical detection of genetic alterations of pre-neoplastic lesions Time for the PML ome? David Sidransky MD Johns Hopkins
Identification and clinical detection of genetic alterations of pre-neoplastic lesions Time for the PML ome? David Sidransky MD Johns Hopkins February 3-5, 2016 Lansdowne Resort, Leesburg, VA Molecular
More informationPrecision Medicine and Molecular Testing.
Precision Medicine and Molecular Testing. David A. Sallman, MD Assistant Member Department of Malignant Hematology Moffitt Cancer Center david.sallman@moffitt.org Disclosures Research funding for Celgene
More informationACCME/Disclosures. History. Hematopathology Specialty Conference Case #4 4/13/2016
Hematopathology Specialty Conference Case #4 Sherrie L. Perkins MD, PhD University of Utah ACCME/Disclosures The USCAP requires that anyone in a position to influence or control the content of CME disclose
More informationPatricia Aoun MD, MPH Professor and Vice-Chair for Clinical Affairs Medical Director, Clinical Laboratories Department of Pathology City of Hope
Patricia Aoun MD, MPH Professor and Vice-Chair for Clinical Affairs Medical Director, Clinical Laboratories Department of Pathology City of Hope National Medical Center Disclosures I have no disclosures
More informationWelcome and Introductions
Information for Patients With Acute Myeloid Leukemia (AML) Welcome and Introductions Information for Patients With Acute Myeloid Leukemia (AML) Mark B. Juckett, MD Vice Chair for Clinical Affairs and Quality
More informationPredictive biomarker profiling of > 1,900 sarcomas: Identification of potential novel treatment modalities
Predictive biomarker profiling of > 1,900 sarcomas: Identification of potential novel treatment modalities Sujana Movva 1, Wenhsiang Wen 2, Wangjuh Chen 2, Sherri Z. Millis 2, Margaret von Mehren 1, Zoran
More informationRole of FISH in Hematological Cancers
Role of FISH in Hematological Cancers Thomas S.K. Wan PhD,FRCPath,FFSc(RCPA) Honorary Professor, Department of Pathology & Clinical Biochemistry, Queen Mary Hospital, University of Hong Kong. e-mail: wantsk@hku.hk
More informationBCR ABL1 like ALL: molekuliniai mechanizmai ir klinikinė reikšmė. IKAROS delecija: molekulinė biologija, prognostinė reikšmė. ASH 2015 naujienos
BCR ABL1 like ALL: molekuliniai mechanizmai ir klinikinė reikšmė. IKAROS delecija: molekulinė biologija, prognostinė reikšmė. ASH 2015 naujienos Ph like ALL BCR ABL1 like acute lymphoblastic leukemia (ALL)
More informationInitial Diagnostic Workup of Acute Leukemia
Initial Diagnostic Workup of Acute Leukemia Guideline from the College of American Pathologists (CAP) and the American Society of Hematology (ASH) Publication: Archives of Pathology and Laboratory Medicine
More informationCost-Effective Strategies in the Workup of Hematologic Neoplasm. Karl S. Theil, Claudiu V. Cotta Cleveland Clinic
Cost-Effective Strategies in the Workup of Hematologic Neoplasm Karl S. Theil, Claudiu V. Cotta Cleveland Clinic In the past 12 months, we have not had a significant financial interest or other relationship
More informationFONS Nové sekvenační technologie vklinickédiagnostice?
FONS 2010 Nové sekvenační technologie vklinickédiagnostice? Sekvenování amplikonů Sequence capture Celogenomové sekvenování FONS 2010 Sekvenování amplikonů Amplicon sequencing - amplicon sequencing enables
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationOxford BRC Haemato-Molecular Diagnostic Service
Short User Guide Oxford BRC Haemato-Molecular Diagnostic Service The Oxford University Hospitals NHS trust s department of Haematology provides a comprehensive molecular diagnostic service for a range
More informationApplication of Whole Genome Microarrays in Cancer: You should be doing this test!!
Application of Whole Genome Microarrays in Cancer: You should be doing this test!! Daynna Wolff, Ph.D. Director, Cytogenetics and Genomics Disclosures Clinical Laboratory Director and Employee, Medical
More informationCorrigenda. WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues (revised 4th edition): corrections made in second print run
Corrigenda WHO Classification of Tumours of Haematopoietic and Lymphoid Tissues (revised 4th edition): corrections made in second print run In addition to corrections of minor typographical errors, corrections
More informationDisclosure: Objectives/Outline. Leukemia: Genealogy of Pathology Practice: Old Diseases New Expectations. Nothing to disclose.
RC1 Leukemia: Genealogy of Pathology Practice: Old Diseases New Expectations RC2 Disclosure: Nothing to disclose Henry Moon Lecture: UCSF Annual Conference Kathryn Foucar, MD kfoucar@salud.unm.edu May
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationAcute Myeloid Leukemia with RUNX1 and Several Co-mutations
Case SH2017-0281 Acute Myeloid Leukemia with RUNX1 and Several Co-mutations James Bauer, MD, PhD David Yang, MD Erik Ranheim, MD, PhD Catherine Leith, MB, Bchir Clinical History Chief Complaint: 72 year
More information