Hidenobu Kanda, Rebecca Newton, Russell Klein, Yuka Morita, Michael D. Gunn & Steven D. Rosen
|
|
- Charles Wilson
- 5 years ago
- Views:
Transcription
1 Autotaxin, a lysophosphatidic acid-producing ectoenzyme, promotes lymphocyte entry into secondary lymphoid organs Hidenou Kanda, Reecca Newton, Russell Klein, Yuka Morita, Michael D. Gunn & Steven D. Rosen a peptide 1.5 Rait IgG IgG (µg/ml) + Peptide +Peptide Rait IgG IgG Rait Supplementary figure 1. Characterization of peptide antiody against ATX. (a) Reactivity of the affinity-purified peptide antiody to ratx protein was determined y ELISA. ratx protein (1 ng/well) was coated on an Immulon 2HB plate and the wells were incuated with the indicated concentrations of normal rait IgG, anti-atx pa or anti-atx pa preincuated with the immunogen peptide (2 µg/ml). Color was developed after incuating with iotin-conjugated goat anti-rait IgG and streptavidin-alkaline phosphatase. () Adjacent cryostat sections of mouse MLN were reacted with anti-atx pa (left), anti-atx pa preincuated with the immunogen peptide (1 µg/ml) (middle) or isotype rait IgG control (right). The antiodies were at a concentration of 5 µg/ml. Color was developed with a iotin conjugated goat anti-rait IgG and Cy2-streptavidin. The experiment in a was performed twice. The results in are representative of three independent experiments.
2 ATX MECA-79 Merged BF NOD RIP-BLC Supplementary figure 2. Localization of ATX protein in HEV-like vessels within tertiary lymphoid organs. Two-color immunofluorescence was performed on cryostat sections of pancreata of an NOD mouse (1 weeks, female) and RIP-BLC mouse (4 weeks, female) for ATX (green) and MECA-79 reactivity (red). Bright field images of the same fields (hematoxylin staining) are presented on the right. Pancreata from 4 NOD mice (one diaetic and three non-diaetic) gave equivalent results. A single RIP-BLC mouse was analyzed. The ar denotes 1 µm.
3 a Mn 2+ LDV RGD LDV+RGD α4 αl α4+ αl Adhesion to VCAM-1 (% of total input) LDV RGD LDV+RGD Mn 2+ α4 αl α4+ αl c LDV Adhesion to ATX (% of total input) RGD LDV+RGD EDTA α4 αl α4+ αl Adhesion to ATX (% of total input) Supplementary figure 3. Binding of mouse lymphocytes to ATX and VCAM-1. Thymocytes were preincuated with the indicated function-locking As (1 µg/ml), with the indicated integrin-inding peptides (1 µm) or with no additives ( none ). Adhesion of thymocytes to svcam-1 (murine, 1 ng) and ATX (human, 1 ng) in the presence of Mn +2 is shown in a and, respectively. With no adhesive sustrate coated, the numer of adhesive cells was 5% of the input cells. The α 4 antiody inhiited adhesion of cells to VCAM-1 ut none of the antiodies affected adhesion to ATX. The LDV peptide had a partial affect on adhesion to VCAM-1 ut not to ATX. In c, adhesion of thymocytes to ATX in the presence of 1 mm EDTA is shown. (a c) Data are presented as means ± SD s from quadruplicate wells. Similar results were otained for mouse splenocytes. The amino acid sequences of mature human and murine ATX are 95% identical. Both proteins have RGD and LDV sequences in the same relative positions. The results shown are representative of 4 independent experiments with either splenocytes or thymocytes.
4 a 3 25 Migrated cells (% of input) LPA (nm) Migrated cells (% of input) LPA+PTX LPA c 12 1 Migrated cells (% of input) LPA, upper: CXCL12, lower: ng/ml 1 ng/ml Supplementary figure 4. LPA-induced migration of mouse lymphocytes. (a) LPA was added to the upper chamer of transwell units and tested for its effects on PLN lymphocyte migration to the lower chamer. () The effect of PTX pretreatment (2 ng/ml, 2 h) on the lymphocyte response to LPA (1 µm) was determined. (c) The responses of lymphocytes to the indicated treatments with LPA (1 µm) and CXCL12 (5 or 1 ng/ml) were evaluated in the transwell assay. * denotes that P <.1 for the indicated comparison. The results of a and are representative of 3 and 2 independent experiments, respectively. The experiment in c was performed once.
5 Supplementary figure 5. Model of ATX function in lymphocyte homing. ATX is secreted from the apical surface of HECs (Step 1) and then inds to activated α4β1 (denoted y asterisk) on arrested human T-cells (and to receptors of unknown identity on mouse T- cells) (Step 2). ATX may also e immoilized on the surface of HEVs, which could enhance its interaction with lymphocytes through avidity effects. Through its lysopld activity, the lymphocyte-targeted ATX acts on LPC in the plasma to produce a high concentration of LPA in the vicinity of the lymphocyte (Step 3). The LPA triggers intracellular signaling in the lymphocyte and promotes its migration into the lymph node (Step 4). The locally-produced LPA could also potentially exert effects on the endothelial cells to enhance the recruitment process. We propose that enzymatically inactive ATX (T21A) exerts a dominant negative effect y competing with endogenous ATX for a limited numer of receptor sites on the lymphocyte (and possily on the HEC), thus limiting the activation of LPA signaling.
6 a Protein stain (kda) LysoPLD activity WT T21A Buffer ATX (µg/ml) c WT T21A svcam Sustrate (ng/well) Supplementary figure 6. Production and characterization of recominant ATX proteins. (a) WT ATX and T21A ATX were purified from transfected COS-7 cells and analyzed y SDS-PAGE for purity (protein stain) and for reactivity with the ATX antiody. () The LysoPLD activities of WT ATX and T21A ATX were determined at the indicated protein concentrations. The values shown are means ± SD s ased on triplicate determinations. (c). WT ATX, T21A ATX, and VCAM-1 were tested for their ailities to support adhesion of mouse T cells in the presence of Mn 2+. Error ars were omitted in c as SD s were less than 5 % of the means. Scale ars, 1 µm. The results in a are representative of 4 independent experiments and in of 2 independent experiments.
Supplementary Material
Supplementary Material HLA-DM Captures Partially Empty HLA-DR Molecules for Catalyzed Peptide Removal Anne-Kathrin Anders, Melissa J. Call, Monika-Sarah E. D. Schulze, Kevin D. Fowler, David A. Schuert,
More informationSupplemental information
Carcinoemryonic antigen-related cell adhesion molecule 6 (CEACAM6) promotes EGF receptor signaling of oral squamous cell carcinoma metastasis via the complex N-glycosylation y Chiang et al. Supplemental
More informationSupplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
More informationSupplementary Materials. for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis
Supplementary Materials for Garmy-Susini, et al, Integrin 4 1 signaling is required for lymphangiogenesis and tumor metastasis 1 Supplementary Figure Legends Supplementary Figure 1: Integrin expression
More informationSupplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the
Supplementary Figure 1. Generation of knockin mice expressing L-selectinN138G. (a) Schematics of the Sellg allele (top), the targeting vector, the targeted allele in ES cells, and the mutant allele in
More informationSupplementary Figures
Supplementary Figures Supplementary Fig. 1. Surface thiol groups and reduction of activated T cells. (a) Activated CD8 + T-cells have high expression levels of free thiol groups on cell surface proteins.
More informationNature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
More informationSUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
More informationB6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C
CD3-specific antibody-induced immune tolerance and suppression of autoimmune encephalomyelitis involves TGF-β production through phagocytes digesting apoptotic T cells Sylvain Perruche 1,3, Pin Zhang 1,
More informationSupplemental information
Supplemental information PI(3)K p11δ controls the sucellular compartmentalization of TLR4 signaling and protects from endotoxic shock Ezra Aksoy, Salma Taoui, David Torres, Sandrine Delauve, Aderrahman
More informationTbk1-TKO! DN cells (%)! 15! 10!
a! T Cells! TKO! B Cells! TKO! b! CD4! 8.9 85.2 3.4 2.88 CD8! Tbk1-TKO! 1.1 84.8 2.51 2.54 c! DN cells (%)! 4 3 2 1 DP cells (%)! 9 8 7 6 CD4 + SP cells (%)! 5 4 3 2 1 5 TKO! TKO! TKO! TKO! 15 1 5 CD8
More informationa Anti-Dab2 RGD Merge
a Anti-Da Merge *** ** Percentage of cells adhered 8 6 4 RGE RAD RGE RAD Supplementary Figure Da are localized at clusters. (a) Endogenous Da is localized at clusters. (), ut not RGE nor RAD peptides can
More informationSupplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
More informationInnate immune cells---- one time migration preprogrammed homing properties
Innate immune cells---- one time migration preprogrammed homing properties neutrophils---acute inflammation monocytes---subacute/chronic inflammation eosinophils---parasitic or allergic inflammation natural
More informationSUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
More informationRecombinant Integrins
Recombinant Integrins Ligand INTEGRIN α subunit S S β subunit Recombinant Integrins Integrins are heterodimeric integral membrane proteins that play key roles in regulating cell-cell and cell-extracellular
More informationCell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
More informationChapter 3, Part A (Pages 37-45): Leukocyte Migration into Tissues
Allergy and Immunology Review Corner: Chapter 3, Part A (pages 37-45) of Cellular and Molecular Immunology (Seventh Edition), by Abul K. Abbas, Andrew H. Lichtman and Shiv Pillai. Chapter 3, Part A (Pages
More informationBlocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
More informationSupplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
More informationSupplementary Information and Figure legends
Supplementary Information and Figure legends Table S1. Primers for quantitative RT-PCR Target Sequence (5 -> 3 ) Target Sequence (5 -> 3 ) DAB2IP F:TGGACGATGTGCTCTATGCC R:GGATGGTGATGGTTTGGTAG Snail F:CCTCCCTGTCAGATGAGGAC
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationStewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer
NFκB (fold induction) Stewart et al. ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer a. mrna (fold induction) 5 4 3 2 1 LDL oxldl Gro1a MIP-2 RANTES mrna (fold induction)
More informationSupplementary Information CAND1 controls in vivo dynamics of the Cullin 1-RING ubiquitin ligase repertoire
Supplementary Information CAD1 controls in vivo dynamics of the Cullin 1-RIG uiquitin ligase repertoire Shuangding Wu, Wenhong Zhu, Tina han, Julia I. Toth, Matthew D. Petroski, Dieter A. Wolf 1 c knd1
More informationEvaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers
Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180
More informationHua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder I Nakaya, Kousik
SUPPLEMENTARY FIGURES 1-19 T H 2 response to cysteine-proteases requires dendritic cell-basophil cooperation via ROS mediated signaling Hua Tang, Weiping Cao, Sudhir Pai Kasturi, Rajesh Ravindran, Helder
More informationNC bp. b 1481 bp
Kcna3 NC 11 178 p 1481 p 346 p c *** *** d relative expression..4.3.2.1 CD4 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna Kcna6 Kcna7 Kcnn4 relative expression..4.3.2.1 CD8 T cells Kcna1 Kcna2 Kcna3 Kcna4 Kcna
More informationSpleen. mlns. E Spleen 4.1. mlns. Spleen. mlns. Mock 17. Mock CD8 HIV-1 CD38 HLA-DR. Ki67. Spleen. Spleen. mlns. Cheng et al. Fig.
C D E F Mock 17 Mock 4.1 CD38 57 CD8 23.7 HLA-DR Ki67 G H I Cheng et al. Fig.S1 Supplementary Figure 1. persistent infection leads to human T cell depletion and hyper-immune activation. Humanized mice
More informationSupplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
More informationSupporting Information
Supporting Information Chan et al. 1.173/pnas.9654916 A Patient B Xenograft C * remaining feature of normal lymph node * * * D lymphocytes Infiltrating transitional carcinoma cells E Enlarged axillary
More informationSupplementary Information
Supplementary Information Concerted action of cellular JNK and Pin1 restricts HIV1 genome integration to activated CD4 T lymphocytes Lara Manganaro 1, Marina Lusic 1,#, Maria Ines Gutierrez 1, Anna Cereseto
More informationSharon S. Evans, Ph.D. Dept. Immunology, RPCI Jan. 29 & Feb 3, 2015
Adhesion Molecules And Lymphocyte Homing Sharon S. Evans, Ph.D. Dept. Immunology, RPCI Jan. 29 & Feb 3, 2015 Outline General introduction to lymphocyte trafficking homeostatic recirculation vs active recruitment.
More informationMouse C-peptide EIA. Cat. No. YII-YK013-EX FOR LABORATORY USE ONLY
Mouse C-peptide EIA Cat. No. YII-YK013-EX FOR LABORATORY USE ONLY TOYO 2CHOME, KOTO-KU, TOKYO, 135-0016, JAPAN http://www.cosmobio.co.jp e-mail : export@cosmobio.co.jp Phone : +81-3-5632-9617 FAX : +81-3-5632-9618
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More information- 1 - Cell types Monocytes THP-1 cells Macrophages. LPS Treatment time (Hour) IL-6 level (pg/ml)
Supplementary Table ST1: The dynamic effect of LPS on IL-6 production in monocytes and THP-1 cells after GdA treatment. Monocytes, THP-1 cells and macrophages (5x10 5 ) were incubated with 10 μg/ml of
More informationCrucial role for human Toll-like receptor 4 in the development of contact allergy to nickel
Supplementary Figures 1-8 Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel Marc Schmidt 1,2, Badrinarayanan Raghavan 1,2, Verena Müller 1,2, Thomas Vogl 3, György
More informationSupplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in
Supplementary Data 1. Alanine substitutions and position variants of APNCYGNIPL. Applied in Supplementary Fig. 2 Substitution Sequence Position variant Sequence original APNCYGNIPL original APNCYGNIPL
More informationSupplementary Figure 1. Example of gating strategy
Supplementary Figure 1. Example of gating strategy Legend Supplementary Figure 1: First, gating is performed to include only single cells (singlets) (A) and CD3+ cells (B). After gating on the lymphocyte
More informationMitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit
PROTOCOL Mitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit DESCRIPTION Mitochondrial Trifunctional Protein (TFP) Protein Quantity Microplate Assay Kit Sufficient materials
More informationIntegrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1
Integrin v 3 targeted therapy for Kaposi s sarcoma with an in vitro evolved antibody 1 CHRISTOPH RADER, 2 MIKHAIL POPKOV, JOHN A. NEVES, AND CARLOS F. BARBAS III 2 Department of Molecular Biology and The
More informationNK cell flow cytometric assay In vivo DC viability and migration assay
NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with
More informationSUPPORTING INFORMATIONS
SUPPORTING INFORMATIONS Mice MT/ret RetCD3ε KO α-cd25 treated MT/ret Age 1 month 3 mnths 6 months 1 month 3 months 6 months 1 month 3 months 6 months 2/87 Survival 87/87 incidence of 17/87 1 ary tumor
More informationhexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This
SUPPLEMENTAL FIGURE LEGEND Fig. S1. Generation and characterization of. (A) Coomassie staining of soluble hexahistidine tagged GRP78 devoid of the KDEL motif (GRP78-His) on SDS-PAGE. This protein was expressed
More informationSupplementary Figure 1. MAT IIα is Acetylated at Lysine 81.
IP: Flag a Mascot PTM Modified Mass Error Position Gene Names Score Score Sequence m/z [ppm] 81 MAT2A;AMS2;MATA2 35.6 137.28 _AAVDYQK(ac)VVR_ 595.83-2.28 b Pre-immu After-immu Flag- WT K81R WT K81R / Flag
More informationSUPPLEMENTARY INFORMATION
Supplementary Table 1. Cell sphingolipids and S1P bound to endogenous TRAF2. Sphingolipid Cell pmol/mg TRAF2 immunoprecipitate pmol/mg Sphingomyelin 4200 ± 250 Not detected Monohexosylceramide 311 ± 18
More informationp = formed with HCI-001 p = Relative # of blood vessels that formed with HCI-002 Control Bevacizumab + 17AAG Bevacizumab 17AAG
A.. Relative # of ECs associated with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 ol b p < 0.001 Relative # of blood vessels that formed with HCI-001 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0.0 l b p = 0.002 Control IHC:
More informationIntroduction to Immunopathology
MICR2209 Introduction to Immunopathology Dr Allison Imrie 1 Allergy and Hypersensitivity Adaptive immune responses can sometimes be elicited by antigens not associated with infectious agents, and this
More informationIntegrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b
Integrin CD11b negatively regulates TLR-triggered inflammatory responses by activating Syk and promoting MyD88 and TRIF degradation via cbl-b Chaofeng Han, Jing Jin, Sheng Xu, Haibo Liu, Nan Li, and Xuetao
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More informationRat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN
YK051 Rat Leptin-HS ELISA FOR LABORATORY USE ONLY YANAIHARA INSTITUTE INC. 2480-1 AWAKURA, FUJINOMIYA - SHI SHIZUOKA, JAPAN 418 0011 Contents Introduction 2 Characteristics 3 Composition 4 Method 5-6 Notes
More informationSupplementary Information:
Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!
More informationEosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
More informationSupplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved
1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich
More informationSupplementary Figure S1. TRAIL-induced necroptosis at acidic phe is dependent on
Online supplementary information Supplementary Figure S1. TRAIL-induced necroptos at acidic phe is dependent on RIPK1 and RIPK3. (a) HT29 cells were tranently transfected with RIPK1, RIPK3, RIPK1/ RIPK3
More informationElectron micrograph of phosphotungstanic acid-stained exosomes derived from murine
1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from
More informationSupplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
More informationTCR, MHC and coreceptors
Cooperation In Immune Responses Antigen processing how peptides get into MHC Antigen processing involves the intracellular proteolytic generation of MHC binding proteins Protein antigens may be processed
More informationAdaptive immune responses: T cell-mediated immunity
MICR2209 Adaptive immune responses: T cell-mediated immunity Dr Allison Imrie allison.imrie@uwa.edu.au 1 Synopsis: In this lecture we will discuss the T-cell mediated immune response, how it is activated,
More informationSUPPLEMENTARY INFORMATION
1. Supplementary Figures and Legends Supplementary Fig. 1. S1P-mediated transcriptional regulation of integrins expressed in OP/monocytoid cells. Real-time quantitative PCR analyses of mrna for two integrins,
More informationSupplemental Figures:
Supplemental Figures: Figure 1: Intracellular distribution of VWF by electron microscopy in human endothelial cells. a) Immunogold labeling of LC3 demonstrating an LC3-positive autophagosome (white arrow)
More informationHuman Obestatin ELISA
K-ASSAY Human Obestatin ELISA For the quantitative determination of obestatin in human serum and plasma Cat. No. KT-495 For Research Use Only. 1 Rev. 081309 K-ASSAY PRODUCT INFORMATION Human Obestatin
More informationSUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver
More informationSUPPLEMENTARY INFORMATION
Complete but curtailed T-cell response to very-low-affinity antigen Dietmar Zehn, Sarah Y. Lee & Michael J. Bevan Supp. Fig. 1: TCR chain usage among endogenous K b /Ova reactive T cells. C57BL/6 mice
More informationa surface permeabilized
a surface permeabilized RAW 64.7 P388D1 J774 b CD11b + Ly-6G - Blood Monocytes WT Supplementary Figure 1. Cell surface expression on macrophages and DCs. (a) RAW64.7, P388D1, and J774 cells were subjected
More informationTSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Nair S, Branagan AR, Liu J, Boddupalli CS, Mistry PK, Dhodapkar
More informationSuperior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)
Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor
More informationa 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80
a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2
More informationEffector T Cells and
1 Effector T Cells and Cytokines Andrew Lichtman, MD PhD Brigham and Women's Hospital Harvard Medical School 2 Lecture outline Cytokines Subsets of CD4+ T cells: definitions, functions, development New
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3021 Supplementary figure 1 Characterisation of TIMPless fibroblasts. a) Relative gene expression of TIMPs1-4 by real time quantitative PCR (RT-qPCR) in WT or ΔTimp fibroblasts (mean ±
More informationSupporting Information
Supporting Information lpek et al. 1.173/pnas.1121217 SI Materials and Methods Mice. cell knockout, inos / (Taconic arms), Rag1 /, INγR /, and IL-12p4 / mice (The Jackson Laboratory) were maintained and/or
More informationEndogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation
SUPPLEMENTARY INFORMATION Endogenous TNFα orchestrates the trafficking of neutrophils into and within lymphatic vessels during acute inflammation Samantha Arokiasamy 1,2, Christian Zakian 1, Jessica Dilliway
More informationSupplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β
Supplementary Figures Supplementary Figure 1. Expression of CUGBP1 in non-parenchymal liver cells treated with TGF-β and LPS. Non-parenchymal liver cells were isolated and treated with or without TGF-β
More informationAcid sphingomyelinase is a critical regulator of cytotoxic granule secretion by
Supplementary Data Acid sphingomyelinase is a critical regulator of cytotoxic granule secretion by primary T lymphocytes Jasmin Herz, Julian Pardo, Hamid Kashkar, Michael Schramm, Elza Kuzmenkina, Erik
More informationSuppl Video: Tumor cells (green) and monocytes (white) are seeded on a confluent endothelial
Supplementary Information Häuselmann et al. Monocyte induction of E-selectin-mediated endothelial activation releases VE-cadherin junctions to promote tumor cell extravasation in the metastasis cascade
More informationFigure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or
Figure S1. Western blot analysis of clathrin RNA interference in human DCs Human immature DCs were transfected with 100 nm Clathrin SMARTpool or control nontargeting sirnas. At 90 hr after transfection,
More informationSupplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every
More informationDefensive mechanisms include :
Acquired Immunity Defensive mechanisms include : 1) Innate immunity (Natural or Non specific) 2) Acquired immunity (Adaptive or Specific) Cell-mediated immunity Humoral immunity Two mechanisms 1) Humoral
More information(a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable
Supplementary Figure 1. Frameshift (FS) mutation in UVRAG. (a) Schematic diagram of the FS mutation of UVRAG in exon 8 containing the highly instable A 10 DNA repeat, generating a premature stop codon
More informationMolecular and Cellular Basis of Immune Protection of Mucosal Surfaces
Molecular and Cellular Basis of Immune Protection of Mucosal Surfaces Department of Biologic & Materials Sciences School of Dentistry University of Michigan Ann Arbor, Michigan 48109-1078 1 Image quality
More informationType of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
More informationProduct Datasheet. EMMPRIN/CD147 Antibody (MEM-M6/1) NB Unit Size: 0.1 mg. Store at 4C. Do not freeze. Publications: 2
Product Datasheet EMMPRIN/CD147 Antibody (MEM-M6/1) NB500-430 Unit Size: 0.1 mg Store at 4C. Do not freeze. Publications: 2 Protocols, Publications, Related Products, Reviews, Research Tools and Images
More informationProduct Datasheet. CD133 Antibody NB Unit Size: 0.1 mg
Product Datasheet CD133 Antibody NB120-16518 Unit Size: 0.1 mg Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. Publications: 8 Protocols, Publications, Related Products,
More informationMANUAL IL-1alpha (mouse) ELISA Kit Cat. No. AG-45B-0003-KI01 [Interleukin-1 alpha (mouse) ELISA Kit]
MANUAL IL-1alpha (mouse) ELISA Kit [Interleukin-1 alpha (mouse) ELISA Kit] For research use only. Not for diagnostic use Version 1 (March-5-2013) Cat. No. AG-45B-0003-KI01 www.adipogen.com Table of Contents
More informationC-Peptide I and II (Rat) ELISA
C-Peptide I and II (Rat) ELISA For the quantitative determination of rat C-peptide in plasma, serum, urine, and cell culture supernatant Please read carefully due to Critical Changes, e.g., blot plate
More informationKrishnamoorthy et al.,
Krishnamoorthy et al., c d e ND ND Supplementary Figure 1 RSV-induces inflammation even in the asence of allergen. Tolerized pups were either infected with RSV or not. The mice were sacrificed a week following
More informationSupplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance
Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationcondition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%
FIGURE LEGENDS Supplementary Fig 1 (A) sumoylation pattern detected under denaturing condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1% SDS in the presence and absence
More informationLymphoid architecture & Leukocyte recirculation. Thursday Jan 26th, 2017
Lymphoid architecture & Leukocyte recirculation Thursday Jan 26th, 2017 Topics The life of immune cells Where are they born? Where are they educated? Where do they function? How do they get there? The
More informationSupplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus
Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-
More informationFigure S1: Effects on haptotaxis are independent of effects on cell velocity A)
Supplemental Figures Figure S1: Effects on haptotaxis are independent of effects on cell velocity A) Velocity of MV D7 fibroblasts expressing different GFP-tagged Ena/VASP family proteins in the haptotaxis
More informationECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1
ZH, Li et al, page 1 ECM1 controls T H 2 cell egress from lymph nodes through re-expression of S1P 1 Zhenhu Li 1,4,Yuan Zhang 1,4, Zhiduo Liu 1, Xiaodong Wu 1, Yuhan Zheng 1, Zhiyun Tao 1, Kairui Mao 1,
More information*Corresponding author:
LIPID DROPLETS HYPERTROPHY: A CRUCIAL DETERMINING FACTOR IN INSULIN REGULATION BY ADIPOCYTES 1 Bahram Sanjabi #, 2,3 Monireh Dashty #, 4 Behiye. Özcan, 5 Vishtaseb Akbarkhanzadeh, 3 Mehran Rahimi, 7,8
More informationSupplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood
Antibody-mediated depletion of CD19-CAR T cells Supplemental 1 Supplemental Materials Supplemental Figure 1. Supplemental Figure 1. Cell-bound Cetuximab reduces EGFR staining intensity. Blood cells were
More informationSupporting Information
Supporting Information Kayama et al. 1.173/pnas.11193119 SI Materials and Methods Reagents. 1-methyl-L-tryptophan and nordihydroguaiaretic acid were purchased from Sigma Aldrich. N W -hydroxyl-nor-l-arginine,
More informationEndothelial TWIK-related potassium channel-1 is a critical regulator of immune cell trafficking into the CNS
Endothelial TWIK-related potassium channel- is a critical regulator of immune cell trafficking into the C Stefan Bittner, Toias Ruck, Michael K Schuhmann, Alexander M Herrmann, Hamid Moha ou Maati, Nicole
More information