Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic
|
|
- Scot Jefferson
- 5 years ago
- Views:
Transcription
1 Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Reticulum Stress Lokesh Makhija, BE, Veda Krishnan, MSc, Rakhshinda Rehman, MTech, Samarpana Chakraborty, MSc, Shuvadeep Maity, MSc, Ulaganathan Mabalirajan, MBBS, PhD, Kausik Chakraborty, PhD, Balaram Ghosh, PhD, Anurag Agrawal, MD, PhD ONLINE DATA SUPPLEMENT
2 Nebulization Details All the nebulizer solutions were made in saline and nebulized at 4 µl/sec into a plexiglass exposure chamber (4 liters) with a bias flow rate of 10 5 µl/sec (6 L/min). The estimated amount of OVA and drugs delivered to a mouse were well within accepted ranges (assuming deposition fraction 15%; OVA dose would be ~15 µg per mouse and highest doses of TMAO, glycerol, trehalose and 4-PBA would correspond to not more than 6, 9, 12 and 0.2 mg/kg respectively). Two-fold higher doses than these were found to be safe in naïve mice when administered as aerosols (Figure S1). Enzyme-linked immunosorbent assay (ELISA) Sandwich ELISA kits for mouse IL-4, IL-5, IL-13, IgE and IgG2a were purchased from BD Biosciences, USA and was performed as per manufacturer s protocol using 20 µg lung lysate (for IL-4, IL-5, IL-13), 5 µl sera (for IgE and IgG2a) or 5 µl bronchoalveolar lavage (BAL) fluid (for MUC5AC ELISA & Leishman stain) as per requirement. Western blots Lung lysate were prepared by mechanical crushing at 4 C in RIPA buffer with PI cocktail and DTT. Protein content was estimated using Bicinchoninic acid assay (Sigma) and 50 μg samples were loaded in 10% SDS PAGE with 1X protein loading dye (Fermentas, Canada). After completion of electrophoresis, protein in the gel was transferred to 0.2 μm pore sized PVDF membrane (Millipore, MA). After blocking (with 2% skimmed milk & 3% BSA in TBST), the blots were probed with primary antibody (1:1000) and followed by secondary antibody (1:2000) with intermittent washing in 0.05% TBST. After final washes blots were developed using DAB.
3 All other chemicals were purchased from Sigma, St. Louis. Antibodies and their isotype controls against GRP94, BiP, Caspase-12 and CHOP, β-actin were purchased from Cell Signaling Technologies and Santa Cruz Biotechnology Inc. HRP-labeled secondary antibodies against mouse, rabbit and goat immunoglobulin were purchased from Banglore Genei, India. Quantitative densitometry for the western blots was done by utilizing ImageJ software in grey scaled images and band intensities were plotted after normalizing with loading control (β-actin) intensity from the same sample. Immuno histochemistry (IHC) IHC was performed to assess the localization and differential expression of different ER-stress markers in lung tissue sections as previously described (28). Briefly, deparaffinised and rehydrated slides were subjected to antigen retrieval in citrate buffer, blocked and were incubated with primary antibody/isotype control for overnight at 4 C followed by secondary antibody and developed with 3,3-diaminobenzidine (DAB) system with intermittent washing after each step. Thereafter, slides were mounted with distyrene-plasticizer-xylene (DPX) and visualized under inverted microscope. Apoptosis To assess apoptosis, DeadEnd tm colorimetric Terminal deoxynucleotidyl transferase dutp nick end labeling (TUNEL) assay (Promega, Madison, USA) was performed as per product manual. Absolute differential leukocyte count (DLC) Lungs were sufficiently inflated post AHR assessment and then the same canula was used to
4 collect BAL fluids as described previously (3). This collected BAL fluid (total 1 ml approx. extracted) was washed twice in PBS & the pallet was resuspended in 50ul PBS. Thereafter, 10ul of this cell suspension was mixed with 10ul of trypan blue dye to exclude dead cells and 10ul of this mix was assessed on hemocytometer to calculate total leukocyte count (TLC). Another 10 ul of cell suspension was used to perform DLC on Leishman (Qauligen, FL, USA) stained slides under the light microscope by an expert, blindfolded to samples. Briefly these slides were prepared by 10ul of cell suspension that was smeared, air dried and methanol fixed followed by Leishmann staining as per manufacturer s protocol. Absolute differential leukocyte count for each sample was calculated by multiplying TLC and DLC.
5 Table S1: Mean absolute differential leukocyte count in 1 ml BAL fluids for n=5 in each group as determined by Leishman staining in experiments shown in Figure 3. Lymphocyte Monocyte Neutrophil Eosinophils SHAM ± ± ± ± OVA ± ± ± ± Glycerol ± ± ± ± Trehalose ± ± ± ± TMAO ± ± ± ± Data are expressed as mean ± standard deviation
6 Table S2: Mean absolute differential leukocyte count in 1 ml BAL fluids for n=5 in each group as determined by Leishman staining in experiments shown in Figure 4 & 5. Lymphocyte Monocyte Neutrophil Eosinophils SHAM ± ± ± ± 1134 OVA ± ± ± ± T ± ± ± ± T ± ± ± ± T ± ± ± ± P ± ± ± ± P ± ± ± ± P ± ± ± ± Data are expressed as mean ± standard deviation
7 Figure S1: Different chemical chaperones delivered to naïve mice were inert on asthmatic features at indicated concentrations. (A) Airway hyperresponsiveness and (B) micrographs of representative hematoxylin and eosin staining from naïve mouse delivered with chemical chaperone at highest concentration used in the manuscript. Figure S2. Representative Immuno-histochemistry for different ER stress markers and dead cell assay (TUNEL) in the lung sections from SHAM & OVA mouse. Figure S3. (A) Densitometry score of western blots for ER stress parameters shown in Figure 3B. (B) Elisa for allergic inflammation parameters viz IgE, IgG2a, IL-4 & IL13 normalized to SHAM in the same experiment. (*) indicates statistical significance (P<0.05) for n=5, relative to OVA group. Figure S4. (A) Densitometry score of western blots for ER-stress parameters shown in Figure 4C & 5C. (B) & (C) ELISA for different allergic inflammation parameters viz. IgE, IgG2a, IL-4, IL-5 & IL13 in the same experiments. (*) indicates statistical significance (P<0.05) and NS, statistically non significant, for n=5, compared to OVA group.
8
9
10
11
Role of Tyk-2 in Th9 and Th17 cells in allergic asthma
Supplementary File Role of Tyk-2 in Th9 and Th17 cells in allergic asthma Caroline Übel 1*, Anna Graser 1*, Sonja Koch 1, Ralf J. Rieker 2, Hans A. Lehr 3, Mathias Müller 4 and Susetta Finotto 1** 1 Laboratory
More informationSupplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
More informationProtocol for Western Blo
Protocol for Western Blo ng SDS-PAGE separa on 1. Make appropriate percentage of separa on gel according to the MW of target proteins. Related recommenda ons and rou ne recipes of separa on/stacking gels
More informationProtocol for Gene Transfection & Western Blotting
The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation
More informationThe Schedule and the Manual of Basic Techniques for Cell Culture
The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationSupplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
More informationSupplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice.
Supplementary Figures: Supplementary Figure S I: Effects of D4F on body weight and serum lipids in apoe -/- mice. Male apoe -/- mice were fed a high-fat diet for 8 weeks, and given PBS (model group) or
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationBone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by
Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationCell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-
Supplemental material and methods Reagents. Hydralazine was purchased from Sigma-Aldrich. Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- 133, human thyroid medullary
More informationB220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
More informationEvaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers
Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180
More informationab Membrane Fractionation Kit Instructions for Use For the rapid and simple separation of membrane, cytosolic and nuclear cellular fractions.
ab139409 Membrane Fractionation Kit Instructions for Use For the rapid and simple separation of membrane, cytosolic and nuclear cellular fractions. This product is for research use only and is not intended
More informationAnti-Lamin B1/LMNB1 Picoband Antibody
Anti-Lamin B1/LMNB1 Picoband Antibody Catalog Number:PB9611 About LMNB1 Lamin-B1 is a protein that in humans is encoded by the LMNB1 gene. The nuclear lamina consists of a two-dimensional matrix of proteins
More informationMouse Anti-OVA IgM Antibody Assay Kit
Mouse Anti-OVA IgM Antibody Assay Kit Catalog # 3017 For Research Use Only - Not Human or Therapeutic Use INTRODUCTION Ovalbumin (OVA) is a widely used antigen for inducing allergic reactions in experimental
More informationTSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationFigure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
More informationEssential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in
Supplemental data Methods Cell culture media formulations A-431 and U-87 MG cells were maintained in Dulbecco s Modified Eagle s Medium. FaDu cells were cultured in Eagle's Minimum Essential Medium, containing
More informationMouse Total IgA Antibody Detection Kit
Mouse Total IgA Antibody Detection Kit Catalog # 3019 For Research Use Only - Not Human or Therapeutic Use INTRODUCTION The total IgA levels in specimens are often determined in mouse disease models involving
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationPRODUCT INFORMATION & MANUAL
PRODUCT INFORMATION & MANUAL Mitochondrial Extraction Kit NBP2-29448 Research use only. Not for diagnostic or therapeutic procedures www.novusbio.com P: 303.760.1950 P: 888.506.6887 F: 303.730.1966 technical@novusbio.com
More informationSoluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,
Revised Suppl. Data: Soluble ADAM33 1 Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David
More informationSupplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after
Supplementary Figure 1 Lymphocytes can be tracked for at least 4 weeks after photoconversion by using H2B-Dendra2. 4-5 PPs of H2B-Dendra2 BM chimeras were photoconverted and analyzed 7 days (upper panel)
More informationHCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation
SUPPLEMENTARY INFORMATION Materials and Methods Human cell lines and culture conditions HCC1937 is the HCC1937-pcDNA3 cell line, which was derived from a breast cancer with a mutation in exon 20 of BRCA1
More informationLive cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for
Live cell imaging of trafficking of the chaperone complex vaccine to the ER. BMDCs were incubated with ER-Tracker Red (1 M) in staining solution for 15 min at 37 C and replaced with fresh complete medium.
More informationRayBio KinaseSTAR TM Akt Activity Assay Kit
Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll
More information1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University
1. Materials and Methods 1.1 Animals experiments process The experiments were approved by the Institution Animal Ethics Committee of Jilin University (Reference NO. 2015-003). 96 Kunming (KM) mice (8 weeks;
More informationSupplemental Material:
Supplemental Material: MATERIALS AND METHODS RNA interference Mouse CHOP sirna (ON-TARGETplus SMARTpool Cat# L-062068-00) and control sirna (ON-TARGETplus Control) were purchased from Dharmacon. Transfection
More informationEffec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers
Effec
More informationSUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationSupplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION
Supplementary Information POLO-LIKE KINASE 1 FACILITATES LOSS OF PTEN-INDUCED PROSTATE CANCER FORMATION X. Shawn Liu 1, 3, Bing Song 2, 3, Bennett D. Elzey 3, 4, Timothy L. Ratliff 3, 4, Stephen F. Konieczny
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationImpact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well
More informationSupplemental Information
Electronic Supplementary Material (ESI) for Food & Function. This journal is The Royal Society of Chemistry 2016 Supplemental Information Supplementary Materials and Methods Materials Assay kits of total
More informationComparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3-
Supplemental Data Comparison of primary tumor sections from MMTV-PyMT or MTLn3-ErbB3- GFP tumors in mice either injected with control or clodronate-containing liposomes and stained for macrophages using
More informationBiodegradable Zwitterionic Nanogels with Long. Circulation for Antitumor Drug Delivery
Supporting Information Biodegradable Zwitterionic Nanogels with Long Circulation for Antitumor Drug Delivery Yongzhi Men, Shaojun Peng, Peng Yang, Qin Jiang, Yanhui Zhang, Bin Shen, Pin Dong, *, Zhiqing
More informationSupplementary Information
Supplementary Information Memory-type ST2 + CD + T cells participate in the steroid-resistant pathology of eosinophilic pneumonia Naoko Mato 1, 2, Kiyoshi Hirahara 2, Tomomi Ichikawa 2, Jin Kumagai 2,
More information10.00 PBS OVA OVA+isotype antibody 8.00 OVA+anti-HMGB1. PBS Methatroline (mg/ml)
RESEARCH ARTICLE Penh (100% of PBS) 1 PBS 8.00 +anti-hmgb1 6.00 4.00 p=0.054 Cellular & Molecular Immunology advance online publication, PBS 3.12 6.25 Methatroline (mg/ml) Neutrophil isolation and culture
More informationCD4 + and CD8 + T cells play a central role in a HDM driven model of allergic asthma
Raemdonck et al. Respiratory Research (2016)17:45 DOI 10.1186/s12931-016-0359-y RESEARCH CD4 + and CD8 + T cells play a central role in a HDM driven model of allergic asthma Open Access Kristof Raemdonck
More informationSipper BK Experimental Animal Co. (Shanghai, China) and bred in a specific. pathogen-free environment. The animal study protocol was approved by the
Supplementary information, Data S1 Materials and Methods Mice, Ad vectors and reagents Female C57BL/6 mice, 8-10 weeks of age, were purchased from Joint Ventures Sipper BK Experimental Animal Co. (Shanghai,
More informationSupplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in
Supplemental figure 1. PDGFRα is expressed dominantly by stromal cells surrounding mammary ducts and alveoli. A) IHC staining of PDGFRα in nulliparous (left panel) and InvD6 mouse mammary glands (right
More informationSupporting Information
Supporting Information Identification of Novel ROS Inducers: Quinone Derivatives Tethered to Long Hydrocarbon Chains Yeonsun Hong,, Sandip Sengupta,, Wooyoung Hur, *, Taebo Sim,, * KU-KIST Graduate School
More informationValidation of the Efficacy of a Practical Method for Neutrophils Isolation from Peripheral Blood
Validation of the Efficacy of a Practical Method for Neutrophils Isolation from Peripheral Blood JONATHAN DEGEL, MASIH SHOKRANI OBJECTIVE: The objectives of this study were to validate the Polymorphprep
More informationEffect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis
212 66 4 329334 Effect of Taurine on Acinar Cell Apoptosis and Pancreatic Fibrosis in Dibutyltin Dichloride-induced Chronic Pancreatitis a,c a* b b a a b a a b c 33 66 4 ʼ 6 6 6 28 6 5 5 5 28 45 ʼ ʼ ʼ
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationSTUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS
STUDIES ON MUSTARD-STIMULATED PROTEASES AND INHIBITORS IN HUMAN EPIDERMAL KERATINOCYTES (HEK): DEVELOPMENT OF ANTIVESICANT DRUGS Xiannu Jin 1, Radharaman Ray 2, Guang Xu 1 and Prabhati Ray 1 1 Department
More informationIn vitro bactericidal assay Fig. S8 Gentamicin protection assay Phagocytosis assay
In vitro bactericidal assay Mouse bone marrow was isolated from the femur and the tibia. Cells were suspended in phosphate buffered saline containing.5% BSA and 2 mm EDTA and filtered through a cell strainer.
More information2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked. amino-modification products by acrolein
Supplementary Information 2,6,9-Triazabicyclo[3.3.1]nonanes as overlooked amino-modification products by acrolein Ayumi Tsutsui and Katsunori Tanaka* Biofunctional Synthetic Chemistry Laboratory, RIKEN
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationHIV-1 p24 ELISA Pair Set Cat#: orb54951 (ELISA Manual)
HIV-1 p24 ELISA Pair Set Cat#: orb54951 (ELISA Manual) BACKGROUND Human Immunodeficiency Virus ( HIV ) can be divided into two major types, HIV type 1 (HIV-1) and HIV type 2 (HIV-2). HIV-1 is related to
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More informationBlocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
More informationab65311 Cytochrome c Releasing Apoptosis Assay Kit
ab65311 Cytochrome c Releasing Apoptosis Assay Kit Instructions for Use For the rapid, sensitive and accurate detection of Cytochrome c translocation from Mitochondria into Cytosol during Apoptosis in
More informationSupplementary Materials for
immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef
More informationSupplementary Figure 1
d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP
More informationTECHNICAL BULLETIN. Catalog Number RAB0447 Storage Temperature 20 C
Phospho-Stat3 (ptyr 705 ) and pan-stat3 ELISA Kit for detection of human, mouse, or rat phospho-stat3 (ptyr 705 ) and pan-stat3 in cell and tissue lysates Catalog Number RAB0447 Storage Temperature 20
More informationCell Lysis Buffer. Catalog number: AR0103
Cell Lysis Buffer Catalog number: AR0103 Boster s Cell Lysis Buffer is a ready-to-use Western blot related reagent solution used for efficient extraction of total soluble protein in nondenatured state
More informationEffect of ST2825 on the proliferation and apoptosis of human hepatocellular carcinoma cells
Effect of ST2825 on the proliferation and apoptosis of human hepatocellular carcinoma cells Y. Deng, J. Sun and L.D. Zhang Department of Hepatobiliary Surgery Institute, Southwest Hospital, Third Military
More informationIKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung
IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung Se-Ran Yang, Samantha Valvo, Hongwei Yao, Aruna Kode, Saravanan Rajendrasozhan, Indika Edirisinghe, Samuel
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More informationCOPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic
COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate
More informationTECHNICAL BULLETIN. Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates
Phospho-Akt (pser 473 ) ELISA Kit for detection of human, mouse, or rat phospho-akt (pser 473 ) in cell and tissue lysates Catalog Number RAB0011 Storage Temperature 20 C TECHNICAL BULLETIN Product Description
More informationPage 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
More informationEXOTESTTM. ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids
DATA SHEET EXOTESTTM ELISA assay for exosome capture, quantification and characterization from cell culture supernatants and biological fluids INTRODUCTION Exosomes are small endosome-derived lipid nanoparticles
More informationSUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients
SUPPLEMENTARY INFORMATION CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative breast cancer patients Lefort S. 1,2, Thuleau A. 3, Kieffer Y. 1,2, Sirven P. 1,2, Bieche I. 4, Marangoni E.
More informationMinute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit User Manual (v5)
Minute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit Catalog number: SM-005 Description Minute TM plasma membrane (PM) protein isolation kit is a novel and patented native PM protein
More informationSupplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.
1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic
More informationHuman Apolipoprotein A1 EIA Kit
A helping hand for your research Product Manual Human Apolipoprotein A1 EIA Kit Catalog Number: 83901 96 assays 1 Table of Content Product Description 3 Assay Principle 3 Kit Components 3 Storage 4 Reagent
More informationPrimer sequences Target Sequence F Sequence R TNF-α (Tnfa) TCAGCCGATTTGCTATCTCAT A
Supplementary Table 1. Q- and RT-PR primers used in this study. Primer sequences Target Sequence F Sequence R TNF-α (Tnfa) TGGTTTGTTTT GTTTGGGGTTG T hemokine (- motif) ligand 5 (cl5) GTGTTTGTTT TGGTGGTG
More informationHuman Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set
Human Immunodeficiency Virus type 1 (HIV-1) p24 / Capsid Protein p24 ELISA Pair Set Catalog Number : SEK11695 To achieve the best assay results, this manual must be read carefully before using this product
More informationSTAT3 (py705) (Human/Mouse/Rat) ELISA Kit
STAT3 (py705) (Human/Mouse/Rat) ELISA Kit Catalog Number KA2175 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION STAT3 (py705) (Human/Mouse/Rat) ELISA (Enzyme-Linked
More informationSUPPLEMENT. Materials and methods
SUPPLEMENT Materials and methods Cell culture and reagents Cell media and reagents were from Invitrogen unless otherwise indicated. Antibiotics and Tet-certified serum were from Clontech. In experiments
More informationSTAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit
STAT3 (py705)/ Pan STAT3 (Human/Mouse/Rat) ELISA Kit Catalog Number KA2176 96 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay...
More informationProtein MultiColor Stable, Low Range
Product Name: DynaMarker Protein MultiColor Stable, Low Range Code No: DM670L Lot No: ******* Size: 200 μl x 3 (DM670 x 3) (120 mini-gel lanes) Storage: 4 C Stability: 12 months at 4 C Storage Buffer:
More informationISOLATION OF EXFOLIATED SOMATIC CELLS FROM BUFFALO MILK
Original Article Buffalo Bulletin (March 2013) Vol.32 No.1 ISOLATION OF EXFOLIATED SOMATIC CELLS FROM BUFFALO MILK A.K. Dang*, Joydip Mukherjee, Manu Jamwal, Surender Singh, A.K. Mohanty, Shiv Prasad,
More informationSupplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationSHREE ET AL, SUPPLEMENTAL MATERIALS. (A) Workflow for tumor cell line derivation and orthotopic implantation.
SHREE ET AL, SUPPLEMENTAL MATERIALS SUPPLEMENTAL FIGURE AND TABLE LEGENDS Supplemental Figure 1. Derivation and characterization of TS1-TGL and TS2-TGL PyMT cell lines and development of an orthotopic
More informationcolorimetric sandwich ELISA kit datasheet
colorimetric sandwich ELISA kit datasheet For the quantitative detection of human IL5 in serum, plasma, cell culture supernatants and urine. general information Catalogue Number Product Name Species cross-reactivity
More informationEpithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive
Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser,
More informationInterferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease
Interferon γ regulates idiopathic pneumonia syndrome, a Th17 + CD4 + T-cell-mediated GvH disease Nora Mauermann, Julia Burian, Christophe von Garnier, Stefan Dirnhofer, Davide Germano, Christine Schuett,
More informationImmunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on
Supplemental Methods Immunohistochemical Analyses Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on prostatectomy sections obtained post-study. Briefly,
More informationNF-κB p65 (Phospho-Thr254)
Assay Biotechnology Company www.assaybiotech.com Tel: 1-877-883-7988 Fax: 1-877-610-9758 NF-κB p65 (Phospho-Thr254) Colorimetric Cell-Based ELISA Kit Catalog #: OKAG02015 Please read the provided manual
More informationSupplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
More informationFigure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR-2B cells untreated (-) or stimulated (+) for 45 min
Figure S1. Sorting nexin 9 (SNX9) specifically binds psmad3 and not psmad 1/5/8. Lysates from AKR2B cells untreated () or stimulated () for 45 min with 5 ng/ml TGFβ or 10 ng/ml BMP4 were incubated with
More informationFOCUS SubCell. For the Enrichment of Subcellular Fractions. (Cat. # ) think proteins! think G-Biosciences
169PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name FOCUS SubCell For the Enrichment of Subcellular Fractions (Cat. # 786 260) think
More informationEGFR (py1045)/ Pan EGFR (Human) ELISA Kit
EGFR (py1045)/ Pan EGFR (Human) ELISA Kit Catalog Number KA2156 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION EGFR (py1045)/pan EGFR (Human) ELISA (Enzyme-Linked Immunosorbent
More informationab E3 Ligase Auto- Ubiquitilylation Assay Kit
ab139469 E3 Ligase Auto- Ubiquitilylation Assay Kit Instructions for Use For testing ubiquitin E3 ligase activity through assessment of their ability to undergo auto-ubiquitinylation This product is for
More informationDissected tissues were minced and lysed in lysis buffer (1x Tris buffered saline (TBS), 1% NP-40,
Data Supplement for Dincheva et al., Effect of Early-Life Fluoxetine on Anxiety-Like Behaviors in BDNF Val66Met Mice. Am J Psychiatry (doi: 10.1176/appi.ajp.2017.15121592) Contents Supplemental Methods
More informationProduct Datasheet. EMMPRIN/CD147 Antibody (MEM-M6/1) NB Unit Size: 0.1 mg. Store at 4C. Do not freeze. Publications: 2
Product Datasheet EMMPRIN/CD147 Antibody (MEM-M6/1) NB500-430 Unit Size: 0.1 mg Store at 4C. Do not freeze. Publications: 2 Protocols, Publications, Related Products, Reviews, Research Tools and Images
More informationHuman Urokinase / PLAU / UPA ELISA Pair Set
Human Urokinase / PLAU / UPA ELISA Pair Set Catalog Number : SEK10815 To achieve the best assay results, this manual must be read carefully before using this product and the assay is run as summarized
More informationRayBio Human, Mouse and Rat Phospho-NF-kB P65 (Ser536) and Total NF-kB P65 ELISA Kit
RayBio Human, Mouse and Rat Phospho-NF-kB P65 (Ser536) and Total NF-kB P65 ELISA Kit Catalog #: PEL-NFKBP65-S536-T User Manual Last revised October 10, 2017 Caution: Extraordinarily useful information
More informationSTAT1 (ps727) (Human/Mouse) ELISA Kit
STAT1 (ps727) (Human/Mouse) ELISA Kit Catalog Number KA2171 96 assays Version: 01 Intended for research use only www.abnova.com I. INTRODUCTION STAT1 (ps727) (Human/Mouse) ELISA (Enzyme-Linked Immunosorbent
More information