Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive
|
|
- Rebecca Wood
- 6 years ago
- Views:
Transcription
1 Online Data Supplement: Epithelial interleukin-25 is a key mediator in Th2-high, corticosteroid-responsive asthma Dan Cheng, Zheng Xue, Lingling Yi, Huimin Shi, Kan Zhang, Xiaorong Huo, Luke R. Bonser, Jianping Zhao, Yongjian Xu, David J. Erle, and Guohua Zhen Supplementary Methods Biopsy Technique We brushed 10 sites within the subsegmental bronchi of right middle and lower lobes (10 gentle upward and downward strokes per site). We used forceps to biopsy left lower lobe carinae and fixed samples in polyoxymethylene. Histology and immunohistochemistry We stained 2 μm sections with hematoxylin and eosin (HE) or polyclonal rabbit anti-human IL-25 antibody (Abgent Biotech, China). Observers who were blinded to the clinical status of the subjects counted numbers of eosinophils/mm 2 submucosa and IL-25 positive cells/mm 2 epithelium, and calculated basement membrane thickness (BMT). We used the mean of 50 measurements taken over a distance of at least 1 mm to calculate BMT as previously described (1). Dual Immunofluorescent Staining Sections of bronchial biopsy were deparaffinized with xylene, followed by rehydration by immersing in 90, 70, and 50% ethanol, water, PBS. The sections were
2 permeabilized in PBS with 0.3% Triton X100. The sections were then incubated with mouse monoclonal antibody against MUC5AC at 1:150 dilution (45M1 clone; Sigma, USA) and rabbit polyclonal antibody against MUC5B at 1:150 dilution (H-300 clone; Santa Cruz, USA) at 4 C overnight. These sections were washed with PBST, and then incubated with Alexa Fluor 488 goat anti-mouse IgG for MUC5AC and Alexa Fluor 568 goat anti-rabbit IgG for MUC5B (Life Techonologies, USA) at 1:200 dilution in PBST for 2 h at room temperature. After incubation with secondary antibodies, the sections were washed again, stained with DNA stain 4', 6-diamidino-2-phenylindole (DAPI) (Vector Laboratories, USA) at 1:300 dilution at room temperature and mounted. Dual immunofluorescent staining was examined using an Olympus BX-51 fluorescent microscope with appropriate filters (Olympus, Japan). Gene expression analysis We isolated total RNA from bronchial epithelial brushings and biopsies using TRIzol (Invitrogen, USA) and the RNeasy Micro Kit (Qiagen, USA), respectively and synthesized first-strand cdna using the PrimeScript RT reagent kit (Takara, Japan). We measured human IL-25, IL-33, TSLP, MUC5AC, MUC5B, CLCA1, POSTN, SERPINB10 in bronchial brushings and IL-17RB in biopsies using the Takara Perfect Real Time PCR kit, Takara SYBR Premix ExTaq polymerase, and an ABI Prism 7500 PCR System. The primers used are listed in Table E1. The cycle threshold (Ct) of each gene transcript was normalized to the mean Ct of β-actin and GAPDH. Fold differences were determined by the 2 - ΔΔ Ct method (2). Standardized IL-25 expression value was generated after -ΔΔCt of IL-25 were centered and scaled as previously E2
3 described (3). We measured plasma IL-25 by ELISA (NeoBioscience, China). E3
4 Supplementary References 1. Benayoun L, Druilhe A, Dombret MC, Aubier M, Pretolani M. Airway structural alterations selectively associated with severe asthma. Am J Respir Crit Care Med 2003; 167: Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001; 25: Bhakta NR, Solberg OD, Nguyen CP, Nguyen CN, Arron JR, Fahy JV, Woodruff PG. A qpcr-based metric of Th2 airway inflammation in asthma. Clin Transl Allergy 2013; 3: 24. E4
5 Supplementary Figure Legends Figure E1. Bronchial expression of IL-17RB is increased in subjects with asthma. (A) IL-17RB staining in bronchial biopsies from healthy control subjects (n = 13) and subjects with asthma (n = 27) (original magnification 400). (B) Quantitation of IL-17RB stained cells in the epithelium. (C) Correlation between the numbers of IL-17RB stained cells and IL-25 stained cells in airway epithelium for healthy controls and subjects with asthma. Some subjects were not included in the analyses of IL-17RB staining because bronchial biopsies from those subjects were not adequate for immunohistochemistry due to limitations in the amount of intact tissue seen in the sections. Figure E2. Percentage of IL-25-low and IL-25-high subjects with positive skin prick tests to specific allergens. Figure E3. Bronchial epithelial POSTN transcript levels are increased in subjects with high epithelial IL-25 expression. Levels of transcripts for POSTN in bronchial brushings were determined by quantitative PCR. Values are relative to the median value for healthy controls. Figure E4. MUC5AC and MUC5B proteins in healthy controls and subjects with IL-25 low and IL-25 high asthma. Representative images of immunofluorescent staining for MUC5AC (green), MUC5B (red) and DAPI nuclear staining (blue) in E5
6 bronchial biopsies (original magnification 200). Figure E5. Sensitivity and specificity of biomarkers for ICS responsiveness. Receiver operating characteristic curve analysis of the sensitivity and specificity of plasma IL-25, blood eosinophil numbers, sputum eosinophil percentage and biopsy eosinophil numbers for ICS responsiveness. Responsive to ICS was defined as > 7.5% improvement in FEV 1 after 8 weeks of ICS treatment. AUC, area under the curve. Figure E6. Plasma IL-25 levels are decreased after ICS treatment in subjects with IL-25-high asthma. Plasma IL-25 levels in subjects with IL-25-low asthma (A) and IL-25-high asthma (B) before and after ICS treatment for 4 weeks. E6
7 Supplementary Table E1 ALLERGENS USED IN SKIN PRICK TEST Allergen Cockroach Bombyx mori silk Dermatophagoides farinae Dermatophagoides pteronyssinus Cat hair Dog hair Poplar pollen Platanus hispanica pollen Mugwort pollen Ragweed pollen Alternaria Cladosponium Aspergillus Penicillum
8 Supplementary Table E2. PRIMERS FOR QUANTITATIVE PCR Gene Type Sequence IL-25 Forward GGCCTGTCAGTCAGTGCCCC Reverse CACAGGGGCCAAGCATCTGG IL-33 Forward GTGACGGTGTTGATGGTAAGAT Reverse AGCTCCACAGAGTGTTCCTTG TSLP Forward ATGTTCGCCATGAAAACTAAGGC Reverse GCGACGCCACAATCCTTGTA IL-17RB Forward CAGAGTGGATGCTACAACATGAT Reverse CGGAGTACCCAGCTTACATTCA MUC5AC Forward CAGCACAACCCCTGTTTCAAA Reverse GCGCACAGAGGATGACAGT MUC5B Forward GCCTACGAGGACTTCAACGTC Reverse CCTTGATGACAACACGGGTGA CLCA1 Forward ATGGCTATGAAGGCATTGTCG Reverse TGGCACATTGGGGTCGATTG POSTN Forward GACCGTGTGCTTACACAAATTG Reverse AAGTGACCGTCTCTTCCAAGG SERPINB2 Forward AGCCCAACGATGACTACTTACT Reverse ACCCAAGAGTTGATGTCCTTTCT β-actin Forward GCAAGCAGGACTATGACGAG Reverse CAAATAAAGCCATGCCAATC GAPDH Forward AAGGTGAAGGTCGGAGTCAAC Reverse GGGGTCATTGATGGCAACAATA
9 Supplementary Table E3. THE PERCENTAGE OF IL-25-LOW AND IL-25-HIGH ASTHMA PREDICTED BY DIFFERENT PLASMA IL-25 CUTOFFS Plasma IL-25 (pg/ml) IL-25-low (%) Plasma IL-25 (pg/ml) IL-25-high (%) 50 11/22 (50.0%) >50 19/21 (90.5%) 55 16/22 (72.7%) >55 17/21 (80.9%) 60 17/22 (77.3%) >60 12/21 (57.1%)
10 Figure E1
11 Figure E2
12 Figure E3
13 Figure E4
14 Figure E5
15 Figure E6
Supplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationGrass pollen immunotherapy induces Foxp3 expressing CD4 + CD25 + cells. in the nasal mucosa. Suzana Radulovic MD, Mikila R Jacobson PhD,
Radulovic 1 1 2 3 Grass pollen immunotherapy induces Foxp3 expressing CD4 + CD25 + cells in the nasal mucosa 4 5 6 7 Suzana Radulovic MD, Mikila R Jacobson PhD, Stephen R Durham MD, Kayhan T Nouri-Aria
More informationIL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells
IL-13 Augments Compressive Stress-induced Tissue Factor Expression in Human Airway Epithelial Cells Jennifer A. Mitchel, Silvio Antoniak, Joo-Hyeon Lee, Sae-Hoon Kim, Maureen McGill, David I. Kasahara,
More informationThe toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells
1 SUPPLEMENTARY INFORMATION The toll-like receptor 4 ligands Mrp8 and Mrp14 play a critical role in the development of autoreactive CD8 + T cells Karin Loser 1,2,6, Thomas Vogl 2,3, Maik Voskort 1, Aloys
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More information(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
More informationDownregulation of angiotensin type 1 receptor and nuclear factor-κb. by sirtuin 1 contributes to renoprotection in unilateral ureteral
Supplementary Information Downregulation of angiotensin type 1 receptor and nuclear factor-κb by sirtuin 1 contributes to renoprotection in unilateral ureteral obstruction Shao-Yu Yang 1,2, Shuei-Liong
More informationSupplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression
Supplementary Figure 1 Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression. Quantitative real-time PCR of indicated mrnas in DCs stimulated with TLR2-Dectin-1 agonist zymosan
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationErzsebet Kokovay, Susan Goderie, Yue Wang, Steve Lotz, Gang Lin, Yu Sun, Badrinath Roysam, Qin Shen,
Cell Stem Cell, Volume 7 Supplemental Information Adult SVZ Lineage Cells Home to and Leave the Vascular Niche via Differential Responses to SDF1/CXCR4 Signaling Erzsebet Kokovay, Susan Goderie, Yue Wang,
More informationMTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)
Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Immunoblotting Immunoblot analysis was performed as described previously (1). Due to high-molecular weight of MUC4 (~ 950 kda) and MUC1 (~ 250 kda) proteins, electrophoresis
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationSupplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
More informationHEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
More informationPair-fed % inkt cells 0.5. EtOH 0.0
MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded
More informationSUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods
SUPPLEMENTARY INFORMATION SUMO1 modification of PTEN regulates tumorigenesis by controlling its association with the plasma membrane Jian Huang 1,2#, Jie Yan 1,2#, Jian Zhang 3#, Shiguo Zhu 1, Yanli Wang
More informationProtection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
More informationPBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human
Anti-CD19-CAR transduced T-cell preparation PBMC from each patient were suspended in AIM V medium (Invitrogen) with 5% human AB serum (Gemini) and 300 international units/ml IL-2 (Novartis). T cell proliferation
More informationProgrammed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration
Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP-mediated inflammation in dsrna-induced retinal degeneration The Harvard community has made this article openly available. Please
More informationCells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2],
Supplementary information Methods Cells and viruses. Human isolates (A/Kawasaki/173/01 [H1N1], A/Yokohama/2057/03 [H3N2], and A/Hong Kong/213/03 [H5N1]) were grown in Madin-Darby canine kidney (MDCK) cells
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More informationTFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
More informationSupplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
More informationProteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival
Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationName Animal source Vendor Cat # Dilutions
Supplementary data Table S1. Primary and Secondary antibody sources Devi et al, TXNIP in mitophagy A. Primary Antibodies Name Animal source Vendor Cat # Dilutions 1. TXNIP mouse MBL KO205-2 1:2000 (WB)
More informationSupplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
More informationChemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic
Chemical Chaperones Mitigate Experimental Asthma By Attenuating Endoplasmic Reticulum Stress Lokesh Makhija, BE, Veda Krishnan, MSc, Rakhshinda Rehman, MTech, Samarpana Chakraborty, MSc, Shuvadeep Maity,
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSupplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
More informationSupplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
More informationSupplementary Figure 1
Supplementary Figure 1 Control Pancreatitis Supplementary Figure 2 A Panc Liver SI Spleen H 2 O B EZH2 fl/fl C EZH2 fl/fl 37bp EZH2 ERK2 D E 5 EZH2 fl/fl Fasting Glucose (mg/dl) 2 18 16 14 12 1 8 6 4 2
More informationPrevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma. patients. Supplemental data. First author: Baojun Wang
Prevalence and characterization of somatic mutations in Chinese aldosterone-producing adenoma patients Supplemental data First author: Baojun Wang Patients and tumor samples A total of 87 patients with
More informationCOPD lungs show an attached stratified mucus layer that separate. bacteria from the epithelial cells resembling the protective colonic
COPD lungs show an attached stratified mucus layer that separate bacteria from the epithelial cells resembling the protective colonic mucus SUPPLEMENTARY TABLES AND FIGURES Tables S1 S8, page 1 and separate
More informationSUPPLEMENTARY MATERIAL. Sample preparation for light microscopy
SUPPLEMENTARY MATERIAL Sample preparation for light microscopy To characterize the granulocytes and melanomacrophage centers, cross sections were prepared for light microscopy, as described in Material
More informationp47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO
Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,
More informationVEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization
Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,
More informationIslet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
More informationImmunoCAP. Specific IgE blood test
Allergy- Specific IgE blood test provides clinicians with an accurate and convenient method of helping to rule in or rule out allergy in patients with allergy-like symptoms. Allergy- Positive About Allergy-
More informationSupplemental Information
Supplemental Information Tobacco-specific Carcinogen Induces DNA Methyltransferases 1 Accumulation through AKT/GSK3β/βTrCP/hnRNP-U in Mice and Lung Cancer patients Ruo-Kai Lin, 1 Yi-Shuan Hsieh, 2 Pinpin
More informationSREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer
SREBP-2 promotes stem cell-like properties and metastasis by transcriptional activation of c-myc in prostate cancer Supplementary Material Supplementary Methods Supplementary References Supplementary Figure
More informationDevelopment Supplementary information
Supplemental Materials and Methods Mosaic clonal analysis GSC and SP clones were induced with the FLP/FRT-mediated mitotic recombination technique (Xu and Rubin, 1993) in files with following genotypes:
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/366/ra25/dc1 Supplementary Materials for Viral entry route determines how human plasmacytoid dendritic cells produce type I interferons Daniela Bruni, Maxime
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationAsthma and Its Many Unmet Needs: Directions for Novel Therapeutic Approaches
Asthma and Its Many Unmet Needs: Directions for Novel Therapeutic Approaches William W. Busse,, M.D. University of Wisconsin School of Medicine and Public Health Madison, WI, USA Disclosure Slide Employment
More informationSupplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and
Supplementary Methods: Omalizumab Trial This double-blind, randomized, placebo-controlled trial was conducted at the University of Utah Hospital and Primary Children s Hospital, Salt Lake City, UT, both
More informationHuman Allergen Specific IgE ELISA Kits
Intended Use Human Allergen Specific IgE ELISA Kits These kits are in vitro assays for the qualitative or quantitative detection of allergen-specific IgE antibodies in human serum. They are intended for
More informationImmunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on
Supplemental Methods Immunohistochemical Analyses Immunostaining was performed on tumor biopsy samples arranged in a tissue-microarray format or on prostatectomy sections obtained post-study. Briefly,
More informationMouse Anti-HDM IgG Antibody Assay Kit
Mouse Anti-HDM IgG Antibody Assay Kit Catalog # 3030 For Research Use Only - Not Human or Therapeutic Use INTRODUCTION Asthma is a common chronic inflammatory disease that affects 300 million people of
More informationSupporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
More informationDecreased Circulating Interleukin-35 Levels Are Related to Interleukin-4-Producing CD8 + T Cells in Patients with Allergic Asthma
ORIGINAL ARTICLE Iran J Allergy Asthma Immunol August 2015; 14(4):379-385. Decreased Circulating Interleukin-35 Levels Are Related to Interleukin-4-Producing CD8 + T Cells in Patients with Allergic Asthma
More informationCell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC-
Supplemental material and methods Reagents. Hydralazine was purchased from Sigma-Aldrich. Cell Culture. The human thyroid follicular carcinoma cell lines FTC-238, FTC-236 and FTC- 133, human thyroid medullary
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationBMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice
SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana
More informationSupplementary Table; Supplementary Figures and legends S1-S21; Supplementary Materials and Methods
Silva et al. PTEN posttranslational inactivation and hyperactivation of the PI3K/Akt pathway sustain primary T cell leukemia viability Supplementary Table; Supplementary Figures and legends S1-S21; Supplementary
More informationSupplementary Materials for
immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef
More informationSoluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,
Revised Suppl. Data: Soluble ADAM33 1 Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Yatsenko AN, Georgiadis AP, Röpke A, et al. X-linked TEX11
More informationSUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
More informationSupplemental figures and figure legends (90517-INS-RG-RV-2) Supplemental Figure 1.
Supplemental figures and figure legends (957-INS-RG-RV-) Supplemental Figure. A B.5.5 Interaction p=.89 Model p
More informationSUPPORTING MATREALS. Methods and Materials
SUPPORTING MATREALS Methods and Materials Cell Culture MC3T3-E1 (subclone 4) cells were maintained in -MEM with 10% FBS, 1% Pen/Strep at 37ºC in a humidified incubator with 5% CO2. MC3T3 cell differentiation
More informationSupplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were
Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze
More informationSupporting Information
Supporting Information Fujishita et al. 10.1073/pnas.0800041105 SI Text Polyp Scoring. Intestinal polyps were counted as described (1). Briefly, the small and large intestines were excised, washed with
More informationIKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung
IKKα Causes Chromatin Modification on Pro-Inflammatory Genes by Cigarette Smoke in Mouse Lung Se-Ran Yang, Samantha Valvo, Hongwei Yao, Aruna Kode, Saravanan Rajendrasozhan, Indika Edirisinghe, Samuel
More informationExpression of acid base transporters in the kidney collecting duct in Slc2a7 -/-
Supplemental Material Results. Expression of acid base transporters in the kidney collecting duct in Slc2a7 -/- and Slc2a7 -/- mice. The expression of AE1 in the kidney was examined in Slc26a7 KO mice.
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or
More informationAspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells.
Aspergillus fumigatus activates PAR-2 and skews toward a Th2 bias in airway epithelial cells. Tetsuya Homma, Atsushi Kato, Bharat Bhushan, James E. Norton, Lydia A. Suh, Roderick G. Carter, Dave S. Gupta,
More informationAirway Inflammation in Asthma Chih-Yung Chiu 1,2, Kin-Sun Wong 2 1 Department of Pediatrics, Chang Gung Memorial Hospital, Keelung, Taiwan.
REVIEW ARTICLE Chih-Yung Chiu 1,2, Kin-Sun Wong 2 1 Department of Pediatrics, Chang Gung Memorial Hospital, Keelung, Taiwan. 2 Division of Pediatric Pulmonology, Department of Pediatrics, Chang Gung Memorial
More informationFunctional Effects of TGF-beta1 on Mesenchymal Stem Cell Mobilization in Cockroach Allergen Induced Asthma
Functional Effects of TGF-beta1 on Mesenchymal Stem Cell Mobilization in Cockroach Allergen Induced Asthma Pei-Song Gao, MD, PhD Division of Allergy & Clinical Immunology Johns Hopkins University School
More informationOligo Sequence* bp %GC Tm Hair Hm Ht Position Size Ref. HIVrt-F 5 -CTA-gAA-CTT-TRA-ATg-CAT-ggg-TAA-AAg-TA
Human immunodeficiency virus (HIV) detection & quantitation by qrt-pcr (Taqman). Created on: Oct 26, 2010; Last modified by: Jul 17, 2017; Version: 3.0 This protocol describes the qrt-pcr taqman based
More informationComparison of Young and Old Cardiac Telocytes Using Atomic Force Microscopy
Comparison of Young and Old Cardiac Telocytes Using Atomic Force Microscopy Jiali Luo 1, 2, 3, 4, a, Shanshan Feng 1, 2, 3, 4, b 1Key Laboratory of Regenerative Medicine, Ministry of Education, Jinan University,
More informationab LDL Uptake Assay Kit (Cell-Based)
ab133127 LDL Uptake Assay Kit (Cell-Based) Instructions for Use For the detection of LDL uptake into cultured cells. This product is for research use only and is not intended for diagnostic use. Version
More informationPretargeting and Bioorthogonal Click Chemistry-Mediated Endogenous Stem Cell Homing for Heart Repair
Pretargeting and Bioorthogonal Click Chemistry-Mediated Endogenous Stem Cell Homing for Heart Repair Mouse Model of Myocardial Infarction (MI) All animal work was compliant with the Institutional Animal
More informationTSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet
Website: thermofisher.com Customer Service (US): 1 800 955 6288 ext. 1 Technical Support (US): 1 800 955 6288 ext. 441 TSH Receptor Monoclonal Antibody (49) Catalog Number MA3-218 Product data sheet Details
More informationExpressional Changes In Growth And Inflammatory Mediators During Achilles Tendon Repair In Diabetic Rats.
Expressional Changes In Growth And Inflammatory Mediators During Achilles Tendon Repair In Diabetic Rats. Paul W. Ackermann, MD, PhD 1, Aisha Ahmed, PhD 1, Nicos Schizas, MD 1, Jian Li, MD, PhD 1, Mahmood
More informationNeutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury
Neutrophils contribute to fracture healing by synthesizing fibronectin+ extracellular matrix rapidly after injury Bastian OW, Koenderman L, Alblas J, Leenen LPH, Blokhuis TJ. Neutrophils contribute to
More informationFigure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow
SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)
More informationAirway epithelial gene expression in the diagnostic evaluation of smokers with suspect lung cancer
Airway epithelial gene expression in the diagnostic evaluation of smokers with suspect lung cancer Avrum Spira, Jennifer E Beane, Vishal Shah, Katrina Steiling, Gang Liu, Frank Schembri, Sean Gilman, Yves-Martine
More informationIdentifying Biologic Targets to Attenuate or Eliminate Asthma Exacerbations
Identifying Biologic Targets to Attenuate or Eliminate Exacerbations exacerbations are a major cause of disease morbidity and costs. For both children and adults, viral respiratory infections are the major
More informationSupplementary data Supplementary Figure 1 Supplementary Figure 2
Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna
More informationSuperior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum...1. Trademarks: HiLyte Fluor (AnaSpec, Inc.)
Table of Contents Fluor TM Labeling Dyes Superior Fluorescent Labeling Dyes Spanning the Full Visible Spectrum....1 Fluor TM 405 Dye, an Excellent Alternative to Alexa Fluor 405 & DyLight 405....2 Fluor
More informationAllergy. pp. 4 5 pp. 6 7 pp BAT Allergens Antibodies
Allergy pp. 4 5 pp. 6 7 pp. 8 10 BAT Allergens Antibodies Our portfolio Flow cytometry validated antibodies for a broad range of research applications (immunology, hematology, cancer research, etc.) available
More informationOncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
More informationDetection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer.
Detection of Circulating Tumor Cells Harboring a Unique ALK-Rearrangement in ALK- Positive Non-Small-Cell Lung Cancer Pailler, et al Data Supplement Table S1. Numbers and Percentages of ALK-Rearranged
More informationEffec<ve Use of PI3K and MEK Inhibitors to Treat Mutant K Ras G12D and PIK3CA H1047R Murine Lung Cancers
Effec
More informationSupplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were
Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl
More informationMesenchymal Stem Cells Reshape and Provoke Proliferation of Articular. State Key Laboratory of Bioreactor Engineering, East China University of
Mesenchymal Stem Cells Reshape and Provoke Proliferation of Articular Chondrocytes by Paracrine Secretion Lei Xu, Yuxi Wu, Zhimiao Xiong, Yan Zhou, Zhaoyang Ye *, Wen-Song Tan * State Key Laboratory of
More informationLDL Uptake Cell-Based Assay Kit
LDL Uptake Cell-Based Assay Kit Catalog Number KA1327 100 assays Version: 07 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 Principle of the Assay...
More informationMATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
More informationSupplementary Table 1. Characterization of HNSCC PDX models established at MSKCC
Supplementary Table 1. Characterization of HNSCC PDX models established at MSKCC Supplementary Table 2. Drug content and loading efficiency estimated with F-NMR and UV- Vis Supplementary Table 3. Complete
More informationSupplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the
Supplementary Figure 1. HOPX is hypermethylated in NPC. (a) Methylation levels of HOPX in Normal (n = 24) and NPC (n = 24) tissues from the genome-wide methylation microarray data. Mean ± s.d.; Student
More informationSUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
More informationSupplementary Data Table of Contents:
Supplementary Data Table of Contents: - Supplementary Methods - Supplementary Figures S1(A-B) - Supplementary Figures S2 (A-B) - Supplementary Figures S3 - Supplementary Figures S4(A-B) - Supplementary
More informationEffective Targeting of Quiescent Chronic Myelogenous
Cancer Cell, Volume 7 Supplemental Information Effective Targeting of Quiescent Chronic Myelogenous Leukemia Stem Cells by Histone Deacetylase Inhibitors in Combination with Imatinib Mesylate Bin Zhang,
More informationDepartment of Pharmaceutical Sciences, School of Pharmacy, Northeastern University, Boston, MA 02115, USA 2
Pancreatic Cancer Cell Exosome-Mediated Macrophage Reprogramming and the Role of MicroRNAs 155 and 125b2 Transfection using Nanoparticle Delivery Systems Mei-Ju Su 1, Hibah Aldawsari 2, and Mansoor Amiji
More informationEvaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers
Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180
More information