Metabolic defects underlying dyslipidemia in abdominal obesity
|
|
- Gerard Williamson
- 5 years ago
- Views:
Transcription
1 Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/ Consultant to MSD, Novartis, Kowa, Sanofi-Aventis
2 What is ectopic fat accumulation? Caloric Intake and/ or Energy Expenditure Positive Energy Balance Lipid overflow into liver, pancreas, muscle and heart FFA Inflamed adipose tissue Imbalance between loading and export of lipids results in ectopic fat accumulation at organs
3 The fatty liver produces most CVD risk factors uc l G e s o V L D L L D H ALT, AST Genetic Predisposition Caloric excess Fat in the diet? Fructose Sucrose The Fatty Liver ; Overproduction of Cardiometabolic Risk Factors Fibrinogen Angiotensinogen CRP, SAA TNF-а, IL-6 FVII, PAI-1
4 Is liver fat the culprit of dyslipidemia? Hepatic steatosis(nafld) is linked to insulin resistance in the liver Hepatic steatosis associates with features of the atherogenic lipid triad Hepatic steatosis associates with intraabdominal obesity
5 Regulation of lipid metabolism in the liver FFA flux Dietary fatty acids DNL Fatty acid oxidation VLDL assembly VLDL secretion
6 Determination of liver fat content using MR spectroscopy water peak Liver fat 6 % Liver fat 23 % triglyceride peak Ryysy L et al. Diabetes, 2000
7 VLDL1 TG production Relationship between VLDL1 production rate and plasma VLDL1 TG pools mg/kg/day 600 r=0.62 p< VLDL1 TG pool, mg/kg VLDL1 TG production rate is the predictor for VLDL1 TG pool size Adiels M et al. ATVB 2005;25:
8 VLDL1 TG production is linked with detrimental changes of LDL size and HDL cholesterol LDL size vs VLDL1 TG production mg/kg/day HDL Chol vs VLDL1 TG production mg/kg/day 600 r=-0.56 p< LDL size, nm r=-0.64 p< HDL Cholesterol, mmol/l Adiels M et al. Diabetologia 2006;49:755-65
9 The relationship between VLDL1 production and liver fat assessed using proton spectroscopy TG VLDL1 production mg/kg/day r=0.58 p< Liver fat % Liver fat content is the driving force for VLDL TG overproduction Adiels M et al. Diabetologia 2006;49:
10 Defective regulation of VLDL metabolism by insulin in Type 2 diabetes patients Oxidation Denovo lipogenesis mg/day FFA 1000 FA Remnants Chol ester Degradation TG VLDL1 apo B production MTP VLDL2 apob IDL LDL LPL HL IDL HL LDL Small dense LDL LPL -51% Controls Type 2 VLDL1 LPL VLDL2 Insulin fails to suppress VLDL1 apo B production Accumulation of VLDL1 particles
11 Characteristics of the subjects Low liver fat (n=10) BMI, kg/m2 Subcutaneous fat, cm2 Intra-abdominal fat, cm2 Liver fat, % M-value, mg kg-1 min-1 F-triglycerides, mmol/l HDL-chol, mmol/l LDL size, nm 26.0± ± ± ± ± ± ± ±0.8 High liver fat (n=10) 28.4± ± ±861* 11.2±4.7*** 4.0±2.1* 2.0± ±0.3** 25.3±1.1** Adiels M et al. Diabetologia 2007;50:
12 High liver fat: lack of VLDL1 suppression in response to insulin Low liver fat <5.5% High liver fat >5.5% % of total VLDL at baseline VLDL1 TG production rate Δ 61% p< Time (min) Adiels M et al. Diabetologia 2007;50:
13 Normal production and regulation of VLDL1 particles in normal healthy subjects Low Liver Fat Insulin TG apob VLDL1 VLDL2 VLDL2 Adiels M et al. Diabetologia 2007;50:
14 Overproduction and dysregulation of VLDL1 particles in Type 2 diabetes High Liver Fat Insulin TG apob VLDL1 VLDL2 VLDL2 High liver fat is linked with hepatic insulin resistance and overproduction of large VLDL particles Adiels M et al. Diabetologia 2007;50:
15 Sources of fatty acids for liver and VLDL-TG FFA POOL 2 CM 2 TG DNL GLUCOSE 3 1 FA STORAGE? β-ox 4 LIVER TG ApoB 5 VLDL TG INSULIN Adiels M et al. ATVB, 2008;28;
16 Whole-body palmitate rate of appearance in obese subjects without and with NAFLD Palmitate RA (µmol/min) (n=14 in both groups) 160 NAFLD * 120 Normal IHTG Liver fat % BMI (kg/m2) 3.4 ± ± ± ± 1.2 The rate of the release of fatty acids from AT is increased in obese subjects with NAFLD Fabbrini E et al. Gastroenterology 2008;134:
17 VLDL-TG secretion rate is increased in obese subjects with NAFLD Non-systemic fatty acids 30 * Systemic plasma FFA (µmol/min) Liver fat % BMI (kg/m2) * 3.4 ± ± ± ± 1.2 Fatty acids derived from nonsystematic sources are the major factors responsible for the increase in VLDL-TG secretion Fabbrini E et al. Gastroenterology 2008;134:
18 Sources of fatty acids for liver fat and VLDL-Triglycerides Increased rate of FFA flux from AT results in increased rate of hepatic FFA uptake Intrahepatic DNL is enhanced in subjects with NAFLD The production and secretion of large VLDL particles correlates with liver fat content Basal hepatic lipid oxidation seems to be unaltered in subjects with NAFLD Overproduction of VLDL particles is NOT able to adequately compensate for increase of hepatic TG production liver fat accumulation
19 Regulation of DNL by SREBP1-C, ChREBP and LXRs in liver Insulin signaling pathway Glucose signaling pathway LXR LXR? SREBP ? ChREBP GK L-PK ACC FAS ELOVL-6 SCD-1 GPAT DGAT ?? TG Postic C and Girard J. J Clin Invest 2008;118:
20 Imbalance of liporegulation; the culprit of fatty liver and dyslipidemia Insulin resistance/ Hyperinsulinemia Inflamed adipose tissue FFA flux Excess dietary fat De Novo lipogenesis ECS dysregulation Lipid oxidation VLDL Atherogenic dyslipidemia
21 Why do not all people with a big waist have dyslipidemia? Elevated VLDL1 concentrations Insulin resistance Normal lipid profile Visceral obesity Insulin resistance Visceral obesity Low HDL The atherogenic triad Small, dense LDL particles
22 My warmest thanks for my collaborators Current players Gothenburg The ladies of the lab Imaging Team Anne Hiukka Aino Soro-Paavonen Sanni Söderlund Jukka Westerbacka Hannele Yki-Järvinen Hannele Hilden Virve Naatti Helinä Perttunen-Nio Martin Adiels Jan Boren Sven-Olof Olofsson Nina Lundbom Jesper Lundbom Antti Hakkarainen
23
Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD
Role of apolipoprotein B-containing lipoproteins in the development of atherosclerosis Jan Borén MD, PhD Our laboratory focuses on the role of apolipoprotein (apo) B- containing lipoproteins in normal
More information1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones?
1Why lipids cannot be transported in blood alone? 2How we transport Fatty acids and steroid hormones? 3How are dietary lipids transported? 4How lipids synthesized in the liver are transported? 5 Lipoprotien
More information2.5% of all deaths globally each year. 7th leading cause of death by % of people with diabetes live in low and middle income countries
Lipid Disorders in Diabetes (Diabetic Dyslipidemia) Khosrow Adeli PhD, FCACB, DABCC Head and Professor, Clinical Biochemistry, The Hospital for Sick Children, University it of Toronto Diabetes A Global
More informationThe rapid increase in obesity prevalence is one of the
Dual Metabolic Defects Are Required to Produce Hypertriglyceridemia in Obese Subjects Marja-Riitta Taskinen, Martin Adiels, Jukka Westerbacka, Sanni Söderlund, Juhani Kahri, Nina Lundbom, Jesper Lundbom,
More informationThe Metabolic Syndrome Update The Metabolic Syndrome Update. Global Cardiometabolic Risk
The Metabolic Syndrome Update 2018 Marc Cornier, M.D. Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine
More informationPathophysiology of Lipid Disorders
Pathophysiology of Lipid Disorders Henry Ginsberg, M.D. Division of Preventive Medicine and Nutrition CHD in the United States CHD is the single largest killer of men and women 12 million have history
More information3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.
U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,
More informationMETABOLISM of ADIPOSE TISSUE
METABOLISM of ADIPOSE TISSUE 2. LF UK Prof. Rudolf Poledne, PhD. TYPES OF ADIPOSE TISSUE brown adipose tissue subcutaneous adipose tissue visceral adipose tissue ADIPOSE TISSUE FUNCTIONS: thermal isolation
More informationZuhier Awan, MD, PhD, FRCPC
Metabolism, Atherogenic Properties and Agents to Reduce Triglyceride-Rich Lipoproteins (TRL) The Fifth IAS-OSLA Course on Lipid Metabolism and Cardiovascular Risk Muscat, Oman, February 8-11, 2019 Zuhier
More informationObesity, Metabolic Syndrome, and Diabetes: Making the Connections
Obesity, Metabolic Syndrome, and Diabetes: Making the Connections Alka M. Kanaya, M.D. Associate Professor of Medicine & Epi/Biostats University of California, San Francisco February 26, 21 Roadmap 1.
More informationMetabolic Syndrome. Bill Roberts, M.D., Ph.D. Professor of Pathology University of Utah
Metabolic Syndrome Bill Roberts, M.D., Ph.D. Professor of Pathology University of Utah Objectives Be able to outline the pathophysiology of the metabolic syndrome Be able to list diagnostic criteria for
More informationThe Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Update 2013 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine Denver Health
More informationHigh density lipoprotein metabolism
High density lipoprotein metabolism Lipoprotein classes and atherosclerosis Chylomicrons, VLDL, and their catabolic remnants Pro-atherogenic LDL HDL Anti-atherogenic Plasma lipid transport Liver VLDL FC
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationRoadmap. Diabetes and the Metabolic Syndrome in the Asian Population. Asian. subgroups 8.9. in U.S. (% of total
Diabetes and the Metabolic Syndrome in the Asian Population Alka Kanaya, MD Associate Professor of Medicine, UCSF Feb 26, 2010 Roadmap 1. Diabetes in Asian Americans Prevalence in the U.S. Risk factors
More informationNon alcoholic fatty liver disease and atherosclerosis Raul Santos, MD
Non alcoholic fatty liver disease and atherosclerosis Raul Santos, MD Sao Paulo Medical School Hospital Sao Paulo, Brazil Disclosure Honoraria received for consult and/or speaker : Astra Zeneca, Amgen,
More informationThe art of tracing dietary fat in humans. Leanne Hodson
The art of tracing dietary fat in humans Leanne Hodson Dietary fat Other lipoproteins: IDL, LDL, HDL Hodson and Fielding linical Lipidology (2010) Relationship between blood & dietary fatty acids Typically:
More informationDisclosures. Background 1 What is Known MENOPAUSE, ESTROGENS, AND LIPOPROTEIN PARTICLES. Background 2 What is Not Known 10/2/2017
Disclosures MENOPAUSE, ESTROGENS, AND LIPOPROTEIN PARTICLES Grants: NIH, Quest Diagnostics Consultant: Quest Diagnostics Merck Global Atherosclerosis Advisory Board Ronald M. Krauss, Children s Hospital
More informationThe role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
More informationMetabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine
Metabolic Syndrome: An overview. Kevin Niswender MD, PhD Vanderbilt University School of Medicine Setting the scene GB, 43 yo AA man followed for hypothyroidism returns on LT4 125 mcg/d and has a TSH=1.1
More informationBachelorarbeit Fructose and weight gain
Bachelorarbeit Fructose and weight gain Bogner-Strauß, Juliane Gertrude, Assoc.Prof. Mag.rer.nat. Dr.rer.nat. Von Johanna Maria Ticar Mat: 0730208 Graz, 27.07.2011 Abstract The prevalence of obesity is
More informationMetabolic Syndrome in Asians
Metabolic Syndrome in Asians Alka Kanaya, MD Asst. Professor of Medicine, UCSF Asian CV Symposium, November 17, 2007 The Metabolic Syndrome Also known as: Syndrome X Insulin Resistance Syndrome The Deadly
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationAcute suppression of VLDL 1 secretion rate by insulin is associated with hepatic fat content and insulin resistance
Diabetologia (2007) 50:2356 2365 DOI 10.1007/s00125-007-0790-1 ARTICLE Acute suppression of VLDL 1 secretion rate by insulin is associated with hepatic fat content and insulin resistance M. Adiels & J.
More informationResponses of blood lipids to aerobic and resistance type of exercise
Responses of blood lipids to aerobic and resistance type of exercise Labros Sidossis, Ph.D. Laboratory of Nutrition and Clinical Dietetics Harokopio University of Athens, Greece Triacylglycerol structure
More informationHypertriglyceridemia: Why, When, and How to Treat. Gregory Cohn, MD, FNLA, FASPC
Hypertriglyceridemia: Why, When, and How to Treat Gregory Cohn, MD, FNLA, FASPC DISCLOSURES Consultant to Akcea Therapeutics (in the past 12 months). OUTLINE I. Lipoproteins II. Non-HDL-C III. Causes and
More informationUpdate On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID?
Update On Diabetic Dyslipidemia: Who Should Be Treated With A Fibrate After ACCORD-LIPID? Karen Aspry, MD, MS, ABCL, FACC Assistant Clinical Professor of Medicine Warren Alpert Medical School of Brown
More informationTHE CLINICAL BIOCHEMISTRY OF LIPID DISORDERS
THE CLINICAL BIOCHEMISTRY OF LIPID DISORDERS Hormonal regulation INSULIN lipid synthesis, lipolysis CORTISOL lipolysis GLUCAGON lipolysis GROWTH HORMONE lipolysis CATECHOLAMINES lipolysis LEPTIN catabolism
More information* Author to whom correspondence should be addressed; Tel.: ; Fax:
Int. J. Mol. Sci. 2014, 15, 6184-6223; doi:10.3390/ijms15046184 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Obesity and Its Metabolic Complications:
More informationDiabetic dyslipidaemia: from basic research to clinical practice*
Diabetologia (2003) 46:733 749 DOI 10.1007/s00125-003-1111-y Review Diabetic dyslipidaemia: from basic research to clinical practice* M.-R. Taskinen Department of Medicine, Division of Cardiology, University
More informationEstablishment of Efficacy of Intervention in those with Metabolic Syndrome. Dr Wendy Russell - ILSI Europe Expert Group
Establishment of Efficacy of Intervention in those with Metabolic Syndrome Dr Wendy Russell - ILSI Europe Expert Group Conflict of interest regarding this presentation: I have no conflict of interest to
More informationLipoproteins Metabolism
Lipoproteins Metabolism LEARNING OBJECTIVES By the end of this Lecture, the student should be able to describe: What are Lipoproteins? Describe Lipoprotein Particles. Composition of Lipoproteins. The chemical
More informationChapter (5) Etiology of Low HDL- Cholesterol
Chapter (5) Etiology of Low HDL- Cholesterol The aim of this chapter is to summarize the different etiological factors mainly the role of life-style and different disease conditions contributing to the
More informationFast-food, Fatty liver, & Insulin Resistance. Giulio Marchesini Clinical Dietetics Alma Mater Studiorum University of Bologna
Fast-food, Fatty liver, & Insulin Resistance Giulio Marchesini Clinical Dietetics Alma Mater Studiorum University of Bologna Supersize Me Unhealthy Effects of Fast Food After consuming three meals a day
More informationFoodGate: The break-in, cover-up, and aftermath. Robert H. Lustig, M.D., M.S.L. Cristin Kearns, D.D.S., M.B.A. Laura Schmidt, Ph.D., M.P.H., L.C.S.W.
FoodGate: The break-in, cover-up, and aftermath Robert H. Lustig, M.D., M.S.L. Cristin Kearns, D.D.S., M.B.A. Laura Schmidt, Ph.D., M.P.H., L.C.S.W. Osher Mini Med School for the Public, Mar 6, 2018 Decrease
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationMetabolism and Atherogenic Properties of LDL
Metabolism and Atherogenic Properties of LDL Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy & Affiliate Associate Professor of Internal
More informationMenopausal Status and Abdominal Obesity Are Significant Determinants of Hepatic Lipid Metabolism in Women
Menopausal Status and Abdominal Obesity Are Significant Determinants of Hepatic Lipid Metabolism in Women Leanne Hodson, PhD; Rajarshi Banerjee, DPhil; Belen Rial, PhD; Wiebke Arlt, MD, DSc; Martin Adiels,
More informationEffect of fructose overfeeding. hepatic de novo lipogenesis and insulin sensitivity in healthy males
Effect of fructose overfeeding and fish oil administration on hepatic de novo lipogenesis and insulin sensitivity in healthy males David Faeh 1,2, Kaori Minehira 1, Jean-Marc Schwarz 3,4, Raj Periasami
More informationLipid/Lipoprotein Structure and Metabolism (Overview)
Lipid/Lipoprotein Structure and Metabolism (Overview) Philip Barter President, International Atherosclerosis Society Centre for Vascular Research University of New South Wales Sydney, Australia Disclosures
More informationANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism
ANSC/NUTR 618 LIPIDS & LIPID METABOLISM Lipoprotein Metabolism I. Chylomicrons (exogenous pathway) A. 83% triacylglycerol, 2% protein, 8% cholesterol plus cholesterol esters, 7% phospholipid (esp. phosphatidylcholine)
More information13/09/2012. Dietary fatty acids. Triglyceride. Phospholipids:
CARDIOVASCULAR DISEASES (CVD) and NUTRITION Major cause of morbidity & mortality in Canada & other developed countries e.g., majority of approved health claims on food labels relate to lowering CVD Relation
More informationNAFLD AND TYPE 2 DIABETES
NAFLD AND TYPE 2 DIABETES Sonia Caprio, MD STOPNASH Symposium on the Origin and Pathways of Nonalcoholic Steatohepatitis Washington 7, 215 Global Projection of Diabetes Hossain P et al. N Engl J Med 27;356:213
More informationIL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA
UNIGASTRO Il fegato come centrale metabolica e i fattori di danno oltre ai virus epatitici IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA Dr Elisabetta Bugianesi Divisione di Gastro-Epatologia
More information"Fatty acid dysregulation in NAFLD" Studying the fasting to fed state transition. Outline
"Fatty acid dysregulation in NAFLD" STOPNASH Symposium on the Origins and Pathways of Nonalcoholic Steatohepatitis October 7, 25 Elizabeth J Parks, PhD, FAHA Division of Gastroenterology/Hepatology Department
More informationMetabolism, Atherogenic Properties and Agents to reduce Triglyceride-Rich Lipoproteins Manfredi Rizzo, MD, PhD
Metabolism, Atherogenic Properties and Agents to reduce Triglyceride-Rich Lipoproteins Manfredi Rizzo, MD, PhD Associate Professor of Internal Medicine Faculty of Medicine, University of Palermo, Italy
More informationInteractions of exercise and diet in health prevention
Interactions of exercise and diet in health prevention Dr Jason Gill Institute of Cardiovascular and Medical Sciences University of Glasgow Physical activity and health outcomes does one size fit all?
More informationMETABOLIC SYNDROME AND HCV: FROM HCV
METABOLIC SYNDROME AND HCV: FROM THEORY TO PRACTICE HCV Steatosis Insulin resistance Arun J Sanyal M.D. Chairman, Div. of Gastroenterology, Hepatology and Nutrition Virginia Commonwealth University Richmond,
More informationBehind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL
Behind LDL: The Metabolism of ApoB, the Essential Apolipoprotein in LDL and VLDL Sung-Joon Lee, PhD Division of Food Science Institute of Biomedical Science and Safety Korea University Composition of Lipoproteins:
More informationCardiovascular Complications of Diabetes
VBWG Cardiovascular Complications of Diabetes Nicola Abate, M.D., F.N.L.A. Professor and Chief Division of Endocrinology and Metabolism The University of Texas Medical Branch Galveston, Texas Coronary
More informationLipoprotein Particle Profile
Lipoprotein Particle Profile 50% of people at risk for HEART DISEASE are not identified by routine testing. Why is LPP Testing The Most Comprehensive Risk Assessment? u Provides much more accurate cardiovascular
More informationMetabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Metabolic Syndrome Update 21 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes University of Colorado Denver Denver Health Medical Center The Metabolic
More informationCholesterol metabolism. Function Biosynthesis Transport in the organism Hypercholesterolemia
Cholesterol metabolism Function Biosynthesis Transport in the organism Hypercholesterolemia - component of all cell membranes - precursor of bile acids steroid hormones vitamin D Cholesterol Sources: dietary
More informationHIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte
More informationOverproduction of Very Low Density Lipoproteins Is the Hallmark of the Dyslipidemia in the Metabolic Syndrome
ATVB In Focus Metabolic Syndrome and Atherosclerosis Series Editor: Marja-Riitta Taskinen Preview Brief Reviews in this Series: Grundy, SM. Metabolic syndrome pandemic. Arterioscler Thromb Vasc Biol. 2008;28:629
More informationHSN301 Diet and Disease Entire Note Summary
Topic 1: Metabolic Syndrome Learning Objectives: 1. Define obesity 2. Factors causing obesity 3. Obesity as a risk factor for metabolic syndrome 4. The pathogenesis of metabolic syndrome 5. Treatment of
More informationThere are many ways to lower triglycerides in humans: Which are the most relevant for pancreatitis and for CV risk?
There are many ways to lower triglycerides in humans: Which are the most relevant for pancreatitis and for CV risk? Michael Davidson M.D. FACC, Diplomate of the American Board of Lipidology Professor,
More informationAssociation between skeletal muscle fat content and very-low density. lipoprotein-apolipoprotein B-100 transport in obesity: effect of weight loss
Association between skeletal muscle fat content and very-low density lipoprotein-apolipoprotein B-100 transport in obesity: effect of weight loss D.C. Chan, S.K. Gan, A.T.Y. Wong, P.H.R. Barrett, G.F.
More informationThe New Gold Standard for Lipoprotein Analysis. Advanced Testing for Cardiovascular Risk
The New Gold Standard for Lipoprotein Analysis Advanced Testing for Cardiovascular Risk Evolution of Lipoprotein Testing The Lipid Panel Total Cholesterol = VLDL + LDL + HDL Evolution of Lipoprotein Testing
More informationPlasma lipoproteins & atherosclerosis by. Prof.Dr. Maha M. Sallam
Biochemistry Department Plasma lipoproteins & atherosclerosis by Prof.Dr. Maha M. Sallam 1 1. Recognize structures,types and role of lipoproteins in blood (Chylomicrons, VLDL, LDL and HDL). 2. Explain
More informationAntisense Mediated Lowering of Plasma Apolipoprotein C-III by Volanesorsen Improves Dyslipidemia and Insulin Sensitivity in Type 2 Diabetes
Antisense Mediated Lowering of Plasma Apolipoprotein C-III by Volanesorsen Improves Dyslipidemia and Insulin Sensitivity in Type 2 Diabetes Andres Digenio, MD, PhD; Richard L. Dunbar, MD; Veronica J. Alexander,
More informationImpact of Exercise on Patients with Diabetes Mellitus
Impact of Exercise on Patients with Diabetes Mellitus Bret Goodpaster, Ph.D. Exercise Physiologist Assistant Professor of Medicine University of Pittsburgh Division of Endocrinology and Metabolism Learning
More informationEnergy balance. Factors affecting energy input. Energy input vs. Energy output Balance Negative: weight loss Positive: weight gain
1 Energy balance Energy input vs. Energy output Balance Negative: weight loss Positive: weight gain Special implications Infancy, Illness, Pregnancy & Lactation, Sports Factors affecting energy input neuro-endocrine
More informationN-3 Fatty Acids Non-HDL-Cand LDL-C Thomas Dayspring MD, FACP
Omega or N-3 Fatty Acids (FA) significantly reduce TG synthesis and significantly deplete the TG content of VLDL particles indicated by significantly reduced V. FA are the substrate for TG synthesis. N3-FA
More informationLipids digestion and absorption, Biochemistry II
Lipids digestion and absorption, blood plasma lipids, lipoproteins Biochemistry II Lecture 1 2008 (J.S.) Triacylglycerols (as well as free fatty acids and both free and esterified cholesterol) are very
More informationLipid Metabolism Prof. Dr. rer physiol. Dr.h.c. Ulrike Beisiegel
Lipid Metabolism Department of Biochemistry and Molecular Biology II Medical Center Hamburg-ppendorf 1 Lipids. visceral fat. nutritional lipids 0 1.5 3 4.5 9 h. serum lipids. lipid accumulation in the
More informationATP III (Adult Treatment Panel III) CLASSIFICATION C IN ADULTS
LABORATORY AND RISK FACTORS OF ATHEROSCLEROSIS S R. Mohammadi Biochemist (Ph.D.) Faculty member of Medical Faculty RISK FACTORS FOR CHD Clinical Risk Factors Laboratory Risk Factors MAJOR CLINICAL RISK
More informationUnit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins
Unit IV Problem 3 Biochemistry: Cholesterol Metabolism and Lipoproteins - Cholesterol: It is a sterol which is found in all eukaryotic cells and contains an oxygen (as a hydroxyl group OH) on Carbon number
More informationMetabolic syndrome. Metabolic syndrome and prediabetes appear to be the same disorder, just diagnosed by a different set of biomarkers.
Metabolic syndrome Metabolic syndrome is a disorder of energy utilization and storage, diagnosed by a co-occurrence of three out of five of the following medical conditions: abdominal (central) obesity,
More informationWe are being killed by fructose by Robert Harrison Black
We are being killed by fructose by Robert Harrison Black bob@life401.com Executive summary: We are having an epidemic of metabolic syndrome which includes, obesity, fatty liver disease, type two diabodies
More informationThe spectrum of nonalcoholic fatty liver disease (NAFLD)
Nonalcoholic Fatty Liver Disease as the Transducer of Hepatic Oversecretion of Very-Low-Density Lipoprotein Apolipoprotein B-100 in Obesity Dick C. Chan, Gerald F. Watts, SengKhee Gan, Annette T.Y. Wong,
More informationReplacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins
Replacement Of Partially Hydrogenated Soybean Oil By Palm Oil In Margarine Without Unfavorable Effects On Serum Lipoproteins Muller H, Jordal O, et al. (998) Replacement of partially hydrogenated soybean
More informationMetabolic Syndrome.
www.bmiweightloss.com.au What is the metabolic syndrome? The was first described in 1988 by Gerald Reavson It was originally described as the clustering of four conditions These conditions when present
More informationLipoprotein Pathophysiology. Lipoprotein Pathophysiology
Lipoprotein Pathophysiology Genetic Dyslipidemia Thomas A. Hughes, M.D. Professor of Medicine Division of Endocrinology, Metabolism, and Diabetes University of Tennessee Health Science Center GW is a 47
More informationNOTES. Developed by Fabio Comana, MA., MS., All rights Reserved Page 1
Session 455: Core Essentials in Science Fabio Comana, MA, MS, NASM CPT, CES & PES; ACE CPT & LWMC; ACSM HFS, NSCA CSCS; CISSN National Academy of Sports Medicine fabio.comana@nasm.org NOTES Developed by
More informationHypertriglyceridemia. Ara Metjian, M.D. Resident s Report 20 December 2002
Hypertriglyceridemia Ara Metjian, M.D. Resident s Report 20 December 2002 Review of Lipids Chylomicrons (CM): Dietary lipids absorbed through the GI tract are assembled intracellularly into CM. Very Low
More informationNiacin Metabolism: Effects on Cholesterol
Niacin Metabolism: Effects on Cholesterol By Julianne R. Edwards For Dr. William R. Proulx, PhD, RD Associate Professor of Nutrition and Dietetics In partial fulfillments for the requirements of NUTR342
More informationADVANCED CARDIOMETABOLIC SCREENING
ADVANCED CARDIOMETABOLIC SCREENING INTRODUCTION SignatureMD and its affiliated physicians continuously seek out technology to identify health risk factors before they become serious diseases. SignatureMD
More informationAdipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University
Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More informationTreatment of Atherosclerosis in 2007
Treatment of Atherosclerosis in 2007 Szilard Voros, M.D. Medical Director Cardiovascular MR and CT Piedmont Hospital, Piedmont Hospital Our Paradigm Genotype Phenotype Environment Atherosclerotic Disease
More informationFructose in diabetes: Friend or Foe. Kim Chong Hwa MD,PhD Sejong general hospital, Division of Endocrinology & Metabolism
Fructose in diabetes: Friend or Foe Kim Chong Hwa MD,PhD Sejong general hospital, Division of Endocrinology & Metabolism Contents What is Fructose? Why is Fructose of Concern? Effects of Fructose on glycemic
More informationProf. John Chapman, MD, PhD, DSc
Prof. John Chapman, MD, PhD, DSc Director of the Dyslipidemia and Atherosclerosis Research Unit of the National Institute for Health and Medical Research (INSERM) at the Pitié-Salpétrière Hospital in Paris
More informationTerm-End Examination December, 2009 MCC-006 : CARDIOVASCULAR EPIDEMIOLOGY
MCC-006 POST GRADUATE DIPLOMA IN CLINICAL CARDIOLOGY (PGDCC) 00269 Term-End Examination December, 2009 MCC-006 : CARDIOVASCULAR EPIDEMIOLOGY Time : 2 hours Maximum Marks : 60 Note : There will be multiple
More informationYun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019
Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,
More informationJoslin Diabetes Center Advances in Diabetes and Thyroid Disease 2013 Consensus and Controversy in Diabetic Dyslipidemia
Consensus and Controversy in Diabetes and Dyslipidemia Om P. Ganda MD Director, Lipid Clinic Joslin diabetes Center Boston, MA, USA CVD Outcomes in DM vs non- DM 102 Prospective studies; 698, 782 people,
More informationFat Metabolism, Insulin and MTHFR
Fat Metabolism, Insulin and MTHFR BCAA, SAMe and ACAT Carolyn Ledowsky Overview of This Presentation 1. Fat Metabolism and MTHFR 2. SAMe and Fat Metabolism 3. Acetyl Co A and Fat Metabolism 4. How to Maintain
More informationHigh intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes
High intensity exercise improves cardiac structure and function and reduces liver fat in adults with Type 2 diabetes Sophie Cassidy, s.cassidy@ncl.ac.uk 1) Concentric remodelling 1.2 * Eccentricity ratio
More informationChanges in Cardiotrophin-1 and Fibroblast Growth Factor-21 with Weight Loss. Robert Lawrence Bowers
Changes in Cardiotrophin-1 and Fibroblast Growth Factor-21 with Weight Loss by Robert Lawrence Bowers A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the
More informationInternal and Emergency Medicine Official Journal of the Italian Society of Internal Medicine. ISSN Volume 8 Number 3
Hepatic Steatosis Index and Lipid Accumulation Product as middle-term predictors of incident metabolic syndrome in a large population sample: data from the Brisighella Heart Study Arrigo F. G. Cicero,
More informationTesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies
Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Copyright 2016. All Rights Reserved. Property of Theratechnologies Inc. Mechanism of Action of Tesamorelin
More informationCHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL
CHAPTER FORTY FIVE ENDOGENOUS LIPID TRANSPORT PATHWAY: VLDL AND IDL You will notice that the endogenous pathway is very similar to the exogenous pathway What is the average daily amount of triacylglycerol
More informationEnergy balance. Factors affecting energy input. Energy input vs. Energy output Balance Negative: weight loss Positive: weight gain
1 Energy balance Energy input vs. Energy output Balance Negative: weight loss Positive: weight gain Special implications Infancy, Illness, Pregnancy & Lactation, Sports Factors affecting energy input neuro-endocrine
More informationThe Metabolic Syndrome Prof. Jean-Pierre Després
The Metabolic Syndrome 1 Jean-Pierre Després, Ph.D., FAHA, FIAS Quebec Heart and Lung Institute Department of Medicine Université Laval Québec, Canada Reaven s syndrome X Triglycerides HDL cholesterol
More informationMetabolic syn and CVD. Dr : dehestani Imam reza hospital
Metabolic syn and CVD { Dr : dehestani Imam reza hospital Global Distribution of CVDs as Causes of Death, WHO 2011 Worldwide Mortality from Ischemic Heart Disease and Cerebrovascular Disease 2011 Ischemic
More informationLipids Carbohydrate Protein. Fatty Acids Glycerol. Mono/di-saccarides. Aminoacids. Fat Liver Muscle. Triglycerides Glycogen Protein
Lipids Carbohydrate Protein Fatty Acids Glycerol Mono/di-saccarides Fat Liver Muscle Aminoacids Triglycerides Glycogen Protein Microvascular Macrovascular Diabetes-specific Diabetes-enhanced HbA1c 5.7(6.0)
More informationWidespread concern about the role of SFA in heart disease: Is it justified?
Widespread concern about the role of SFA in heart disease: Is it justified? 1. What is the association of SFA intake and LDL-C? 2. Is LDL-C the best biomarker? 3. If SFA is reduced, does it matter what
More informationObjectives. Objectives. Alejandro J. de la Torre, MD Cook Children s Hospital May 30, 2015
Alejandro J. de la Torre, MD Cook Children s Hospital May 30, 2015 Presentation downloaded from http://ce.unthsc.edu Objectives Understand that the obesity epidemic is also affecting children and adolescents
More informationGlossary For TheFatNurse s For All Ages Series Apolipoprotein B (APOB or ApoB) are the primary apolipoproteins of chylomicrons and low-density lipoproteins (LDL - known commonly by the misnomer "bad cholesterol"
More information