HIV VPR alters fat metabolism. Dorothy E Lewis PhD/Ashok Balasubramanyam MD
|
|
- Frederick Hopkins
- 6 years ago
- Views:
Transcription
1 HIV VPR alters fat metabolism Dorothy E Lewis PhD/Ashok Balasubramanyam MD
2 Old Dogma for HIV associated lipodystrophy Differentiation Block (PI) Lipoatrophy Apoptosis (NRTI) Stem cell Preadipocyte Adipocyte C/EBPβ/δ SREBP1 PPAR-γ Induction LPL, HSL, ap2, of lipogenic perilipin genes BUT, happens without ART and in Elite suppressors COULD HIV CAUSE????
3 Metabolic features of HIV (218) Less lipoatrophy Less severe dyslipidemia More generalized obesity Dysglycemia, CVD, osteoporosis, NAFLD
4 Could there be a direct viral cause? VPR in virally suppressed people VPR is systemic and circulates VPR acts without whole virus
5 Vpr in virally suppressed patients (Immunoaffinity Capillary Electrophoresis) no ART NRTI HAART HAART with undetectable VL N (2) (25) (61) (7) (25) Agarwal et al, Science Transl Med 213
6 Mouse Models to study VPR effects A. Vpr-Transgenic Model Inducible expression of Vpr in liver and fat PEPCK SV4 3 UT Tissue-specific promoter Tetracycline transactivator Tet repressor and DNA binding domain VP16 activation domain (teto) 7 Transgene coding region Vpr SV4 3 UT B. Circulating Vpr Model (svpr treatment) Alzet pump filled with vehicle or svpr Incision made to implant Alzet pump Mouse before and after Alzet implant
7 Vpr mrna Expression in Liver and Adipose Tissues of Mice Liver: Vpr + Fat: Vpr + Vpr Expressed in Liver and Adipose Tissues Also Circulates in the Blood of Mice Serum Vpr (pg/ml) Agarwal et al, Science Transl Med 213
8 Vpr Increases Lipolysis and Blunts Fat Oxidation Increased lipolysis Ra FFA (mmol/kg/h) 5 25 Ra FFAt Ra FFAn Ra FFA (mmol/kg/h) 4 2 Ra FFAt Ra FFAn Vehicle svpr Blunted fat oxidation during fast RER RER Vehicle svpr Agarwal et al, Science Transl Med 213
9 Vpr Decreases Fat Mass Fat weight (% of body wt) svpr-treated Fat weight (% of body wt) IF PGF RPF Total WAT BAT IF PGF RPF Total WAT BAT Vehicle svpr
10 A. Insulin B. AKT-p(S473) / AKT Blood glucose (mg/dl) Vpr Causes Modest Insulin Resistance 12 Wk AKT Min after i.p. glucose injection C. D. Blood glucose (mg/dl) Plasma triglycerides (mg/dl) Wk Min after i.p. glucose injection
11 VPR Mechanisms VPR acts on adipocyte differentiation VPR acts on adipocyte function Lentiviral VPR in cultured adipocytes
12 Early expression of Vpr Vpr Blocks Differentiation of Preadipocytes Preadipocyte proliferation Adipocyte differentiation -2d d 2d 4d 6d 8d 1d 12d Lentiviral infection Doxy induction of viral transgene expression Adipocyte differentiation medium added A 3T3-L1 rtta Vpr Vpr-R8A B. Relative mrna expression Day 1 Day 2 Day 3 Pref1 Relative mrna expression Day2 Day3 Day 4 Day 5 Day 6 PPARγ2 Relative mrna expression Day 6 Day 8 Day 1 Day 12 GLUT4 Control rtta Vpr R8A
13 Vpr Inhibits Preadipocyte Differentiation By blocking Cell Cycle 3T3-L1 rtta Vpr Vpr-R8A
14 Vpr Increases Lipolysis in Mature Adipocytes Late expression of Vpr Preadipocyte proliferation Adipocyte differentiation -2d d 2d 4d 5d 6d 8d 1d 12d Lentiviral infection Adipocyte differentiation medium added Doxy induction of viral transgene expression A. FFA (meq/l).6.3. Basal Stimulated B. Fold enrichment (Input corrected) rtta Vpr Adiponectin ap2 HSL NC Adipo NC ap2 NC HSL Ab PPARγ PPARγ GR PPARγ PPARγ GR Rosi Dexa
15 VPR mechanisms VPR inhibits adipocyte differentiation VPR increases lipolysis in adipocytes What are other consequences????
16 A. Macrophage Infiltration in Fat of Vpr Mice B. C. Vehicle svpr Vehicle svpr D E. F48+ cells / section 1 5 Average fat cell size (µm 2 ) 3 15 F. G. H. F48+ cells / section 16 8 Vehicle svpr Crown like structures /section 6 3 Vehicle svpr Average fat cell size (µm 2 ) 6 3 Vehicle svpr
17 HIV infection in fat HIV/SIV infected immune cells in adipose HIV is infectious but not much transcription HIV VPR could have direct effect in vivo Couturier et al AIDS 215, Couturier et al Retrovirology 216
18 Other consequences of VPR? VPR expressed from transgene in adipose and liver from PEPCK promoter Is there an effect on liver fat metabolism??
19 HIV VPR causes NASH A B Oil Red O liver (% area)
20 VPR increases lipid storage 14 weeks 28 weeks 16 Oil Red O liver (% area) Oil Red O liver (% area)
21 VPR increases liver weight and TGs 5 Std 6. Vehicle svpr Liver weight (% of body weight) TG (relative density units) x1 3 2 Triglycerides (mg / gm liver) Wk 28-Wk 14-Wk Figure 1
22 Liver function enzymes in VPR mice
23 Vpr Increases Hepatic Lipogenesis A. mrna fold difference D. [ 14 C] fatty acids (dpm) / million hepaotocytes / h x B. mrna fold difference mrna fold difference 6 3 E. Dgat Fasn Scd-1 Acc 6 3 svpr mrna fold difference C. 4 2 Srebp1c Chrebp L-pk Dgat Fasn Scd-1 Acc Srebp1c Chrebp L-pk
24 Vpr increases proteins associated with liver lipogenesis SREBP1c Chrebp α-tubulin nsrebp1c nchrebp TBP FASN α-tubulin Acc-p(S79) Acc A. B. Relative protein amount (normalized to α-tubulin) 12 6 SREBP1c ChREBP Relative protein amount (normalized to TBP) 1.5 nsrebp1c nchrebp C. 3 D. FASN/α-tubulin Acc-p(s79) / Acc Vehicle svpr SREBP1c Chrebp α-tubulin nsrebp1c nchrebp TBP FASN α-tubulin Acc-p(S79) Acc E. F. Vehicle svpr Relative protein amount (normalized to α-tubulin) SREBP1c ChREBP Relative protein amount (normalized to TBP) 6 3 Vehicle nsrebp1c svpr nchrebp G. H. FASN / α-tubulin 4 2 pacc / Acc 2 1 Vehicle svpr Vehicle svpr
25 Vpr Blunts Hepatic Fat Oxidation A. B Fatty acid oxidation in liver (dpm/mg/h) RER C. D mrna fold difference.6 mrna fold change 1.5 Pparα PPARa E. F Cpt1 Aox Ehhadh Hsd17b1 acaa2 Lcad Vehicle svpr mrna fold difference.6 mrna fold difference 1.5. Pparα PPARa Cpt1 Aox Ehhadh Hsd17b1 acaa2 Lcad
26 Vpr Inhibits Hepatic VLDL-TG Export A. B. C. MTP BA mrna fold difference.6 MTP expression (normalized to α-tubulin.4 Triglycerides released into plasma (mg/dl) 7 35 min I hr 2 hr D. 2.5 E. Lpl mrna fold difference Heart IF PGF Skeletal Muscle Post heparin Serum LPL mass (pg/ml)
27 Do these Vpr Mouse Models Explain Adipose / Liver Metabolic defects in HIV+ Humans? Lipolysis Fat oxidation Fat mass Fatty liver FGF21 Vpr Mice HIV+ Humans SAT beiging + + Circulating Vpr without intact HIV + + Koch s Postulates?
28 CREDITS Expression / Function Studies: Neeti Agarwal Dinakar Iyer Toni Oplt Sanjeet Patel Jeffrey Kopp Ulrich Schubert Terry Phillips Tomoshige Kino Human Samples: Maria Rodriguez-Barradas Adipose HIV Reservoir Dorothy Lewis Jacob Couturier Sara Cromer Human / Mouse Metabolic Studies: R. V. Sekhar Farook Jahoor Sue Samson Sanjeet Patel Jordan Lake
29 Vpr Associates With Hepatic Genes Involved in Lipid and Sterol Metabolism A. B. C.
30 A. Relative luciferase activity (HepG2) x unrx GW3965 T9137 Vector+LXRE Vpr+LXRE LXR+LXRE Vpr+LXR+LXRE Relative luciferase activit y (Huh7) C. D. Fold enrichment (Input corrected) # # # ### # # ns ## Vpr Coactivates LXR B. Thousands LXR LXR+GW3965 Vpr Vpr+GW3965 Vpr+LXR Vpr+LXR+GW3965 # # # unrx GW3965 T9137 Vector+LXRE Vpr+LXRE LXR+LXRE Vpr+LXR+LXRE GW Vpr LXR LXRE Srebp1c Lxr NC Srebp1c NC Lxr
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/5/213/213ra164/dc1 Supplementary Materials for HIV-1 Vpr Induces Adipose Dysfunction in Vivo Through Reciprocal Effects on PPAR/GR Co-Regulation Neeti
More informationSupplementary Table 2. Plasma lipid profiles in wild type and mutant female mice submitted to a HFD for 12 weeks wt ERα -/- AF-1 0 AF-2 0
Supplementary Table 1. List of specific primers used for gene expression analysis. Genes Primer forward Primer reverse Hprt GCAGTACAGCCCCAAAATGG AACAAAGTCTGGCCTGTATCCA Srebp-1c GGAAGCTGTCGGGGTAGCGTC CATGTCTTCAAATGTGCAATCCAT
More informationAAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
More informationMetabolic defects underlying dyslipidemia in abdominal obesity
Metabolic defects underlying dyslipidemia in abdominal obesity Professor Marja-Riitta Taskinen Department of Medicine, Division of Cardiology Helsinki University Hospital, Finland Disclosures: Honorariums/
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationcontrol kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat
body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary
More informationGene Polymorphisms and Carbohydrate Diets. James M. Ntambi Ph.D
Gene Polymorphisms and Carbohydrate Diets James M. Ntambi Ph.D Fatty Acids that Flux into Tissue Lipids are from Dietary Sources or are Made De novo from Glucose or Fructose Glucose Fructose Acetyl-CoA
More informationIn The Name Of God. In The Name Of. EMRI Modeling Group
In The Name Of God In The Name Of God EMRI Modeling Group Cells work together in functionally related groups called tissues Types of tissues: Epithelial lining and covering Connective support Muscle movement
More information1,8 1,6 1,4 1,2 1. EE/g lean mass 0,8 0,6 0,4 0,2. Ambulatory locomotor activity. (beam brakes/48h) V MCH MCHpf 0,86 0,85 0,84 0,83 0,82 0,81 0,8
Supplementary figure 1 vehicle A -pf Energy expenditure (kcal/kg/48h) 25 2 15 1 5 V pf EE/g lean mass 1,8 1,6 1,4 1,2 1,8,6,4,2 Total locomotor activity (beam brakes/48h) C D E 7 6 5 4 3 2 1 V pf Ambulatory
More information3-Thia Fatty Acids A New Generation of Functional Lipids?
Conference on Food Structure and Food Quality 3-Thia Fatty Acids A New Generation of Functional Lipids? Rolf K. Berge rolf.berge@med.uib.no Fatty acids- Essential cellular metabolites Concentrations must
More information18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC
Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1
More informationBEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli
BEIGE AND BROWN FAT: BASIC BIOLOGY AND NOVEL THERAPEUTICS Dr. Carl Ascoli Symposium Co-Chairs: Bruce M. Spiegelman (Harvard/Dana Farber) and Sven Enerbäck (U.Gothenburg) April 17-23, 2015 Snowbird Resort,
More informationSupplementary Information. MicroRNA-33b knock-in mice for an intron of sterol regulatory
Supplementary Information MicroRNA-33b knock-in mice for an intron of sterol regulatory element-binding factor 1 (Srebf1) exhibit reduced HDL-C in vivo Takahiro Horie, Tomohiro Nishino, Osamu Baba, Yasuhide
More informationSupplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original
Supplementary Fig. 1 eif6 +/- mice show a reduction in white adipose tissue, blood lipids and normal glycogen synthesis. The cohort of the original phenotypic screening was n=40. For specific tests, the
More informationGPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
More informationThe role of apolipoprotein D in lipid metabolism and metabolic syndrome
UQÀM: Department of Biological Sciences The role of apolipoprotein D in lipid metabolism and metabolic syndrome Catherine Mounier PhD Apolipoprotein D Apolipoprotéine D (apod) Secreted protein Associated
More informationSupporting Information Table of content
Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting
More informationSupplementary Information
Supplementary Information Notch deficiency decreases hepatic lipid accumulation by induction of fatty acid oxidation No-Joon Song,#, Ui Jeong Yun,#, Sunghee Yang, Chunyan Wu, Cho-Rong Seo, A-Ryeong Gwon,,
More informationSupplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR
Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very
More informationSupplemental Table 1. List of primers used for real time PCR.
Supplemental Table 1. List of primers used for real time PCR. Primer Sequence Primer Sequence Mouse Pcsk9-F TTGCAGCAGCTGGGAACTT Mouse Scd1-F CATCATTCTCATGGTCCTGCT Mouse Pcsk9-R CCGACTGTGATGACCTCTGGA Mouse
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
More informationSupplementary Figure S1
Lipidomic-based investigation into the regulatory effect of Schisandrin B on palmitic acid level in non-alcoholic steatotic livers Hiu Yee Kwan 1,2, Xuyan Niu 3, Wenlin Dai 4, Tiejun Tong 4, Xiaojuan Chao
More informationRegulation of Lipid Homeostasis: Lipid Droplets
Regulation of Lipid Homeostasis: Lipid Droplets Bernd Helms Article Brand Recter Hendrik Mertens 1 The Basics I: FAs The Basics II: FA Activation 2 Basics III: TG-FA Interplay. Why? Adipocytes 3 Foam cells
More informationTargeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity
Targeting of the circadian clock via CK1δ/ε to improve glucose homeostasis in obesity Peter S. Cunningham, Siobhán A. Ahern, Laura C. Smith, Carla S. da Silva Santos, Travis T. Wager and David A. Bechtold
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
More informationSupplemental Table 1. Plasma NEFA and liver triglyceride levels in ap2-hif1ako and ap2-hif2ako mice under control and high fat diets.
Supplemental Table 1. Plasma NEFA and liver triglyceride levels in Hif1aKO and Hif2aKO mice under control and high fat diets. Hif1a (n=6) Hif1aK O (n=6) Hif2a Hif2aK O Hif1a (n=5) Hif1aKO (n=5) Hif2a Hif2aK
More informationInterplay between FGF21 and insulin action in the liver regulates metabolism
Research article Interplay between FGF21 and insulin action in the liver regulates metabolism Brice Emanuelli, 1 Sara G. Vienberg, 1 Graham Smyth, 1 Christine Cheng, 2 Kristin I. Stanford, 1 Manimozhiyan
More informationIL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA
UNIGASTRO Il fegato come centrale metabolica e i fattori di danno oltre ai virus epatitici IL METABOLISMO EPATICO DEI CARBOIDRATI IN FISIOLOGIA E PATOLOGIA Dr Elisabetta Bugianesi Divisione di Gastro-Epatologia
More informationNASH Bench to Bedside
NASH Bench to Bedside October 2006 Anna Mae Diehl, M.D. Gastroenterology Division Duke University NonAlcoholic Fatty Liver Disease Common ~1/4-1/3 1/3 US adults Outcome highly variable Course indolent
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
More informationSupplemental Information Supplementary Table 1. Tph1+/+ Tph1 / Analyte Supplementary Table 2. Tissue Vehicle LP value
Supplemental Information Supplementary Table. Urinary and adipose tissue catecholamines in Tph +/+ and Tph / mice fed a high fat diet for weeks. Tph +/+ Tph / Analyte ewat ibat ewat ibat Urine (ng/ml)
More informationSupporting Information
Supporting Information Charalambous et al. 10.1073/pnas.1406119111 SI Experimental Procedures Serum and Tissue Biochemistry. Enzymatic assay kits were used for determination of plasma FFAs (Roche), TAGs
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationAMPK. Tomáš Kuc era. Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kuc era Ústav lékar ské chemie a klinické biochemie 2. lékar ská fakulta, Univerzita Karlova v Praze 2013 AMPK AMP-ACTIVATED PROTEIN KINASE present in all eukaryotic
More informationEffects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice
Effects of growth hormone secretagogue receptor agonist and antagonist in nonobese type 2 diabetic MKR mice Rasha Mosa (MBCHC, M.D, PhD candidate) School of Biomedical Sciences University of Queensland
More informationMales- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)
Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous
More informationSalt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice
Salt-inducible kinase 2 links transcriptional coactivator p300 phosphorylation to the prevention of ChREBP-dependent hepatic steatosis in mice Julien Bricambert,, Catherine Postic, Renaud Dentin J Clin
More informationACC ELOVL MCAD. CPT1α 1.5 *** 0.5. Reverbα *** *** 0.5. Fasted. Refed
Supplementary Figure A 8 SREBPc 6 5 FASN ELOVL6.5.5.5 ACC.5.5 CLOCK.5.5 CRY.5.5 PPARα.5.5 ACSL CPTα.5.5.5.5 MCAD.5.5 PEPCK.5.5 G6Pase 5.5.5.5 BMAL.5.5 Reverbα.5.5 Reverbβ.5.5 PER.5.5 PER B Fasted Refed
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationUp-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice
Up-Regulation of Mitochondrial Activity and Acquirement of Brown Adipose Tissue-Like Property in the White Adipose Tissue of Fsp27 Deficient Mice Shen Yon Toh 1,2,3., Jingyi Gong 2., Guoli Du 2., John
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationFSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets
Research article Related Commentary, page 2693 FSP27 contributes to efficient energy storage in murine white adipocytes by promoting the formation of unilocular lipid droplets Naonobu Nishino, 1 Yoshikazu
More informationMaster class Biomolecular Sciences Molecular Cell Biology.
Master class Biomolecular Sciences Molecular Cell Biology. 04-09-08: Paul van Bergen en Henegouwen. Clathrin-indep Endocytosis 11-09-08: Willem Stoorvogel. Endocytosis and MHC classii 18-09-08: X-track
More informationSupplementary Table 1.
Supplementary Table 1. Expression of genes involved in brown fat differentiation in WAT of db/db mice treated with HDAC inhibitors. Data are expressed as fold change (FC) versus control. symbol FC SAHA
More informationAMPK. Tomáš Kučera.
AMPK (AMP- ACTIVATED PROTEIN KINASE ) Tomáš Kučera tomas.kucera@lfmotol.cuni.cz Department of Medical Chemistry and Clinical Biochemistry 2nd Faculty of Medicine, Charles University in Prague and Motol
More informationActivation of Bile Acid Signaling Shapes the Gut Microbiota to Improve Diabetes and Fatty Liver Disease
Activation of Bile Acid Signaling Shapes the Gut Microbiota to Improve Diabetes and Fatty Liver Disease John Chiang, Ph.D. Northeast Ohio Medical University Rootstown, OH, USA International Conference
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationGlucose. Glucose. Insulin Action. Introduction to Hormonal Regulation of Fuel Metabolism
Glucose Introduction to Hormonal Regulation of Fuel Metabolism Fasting level 3.5-5 mmol (1 mmol = 18 mg/dl) Postprandial 6-10 mmol Amount of glucose in circulation is dependent on: Absorption from the
More informationSUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
More informationMobilisation des lipides du tissu adipeux et insulinorésistance. Dominique Langin
Obesity Research Laboratory Institut Universitaire de France Franco-Czech Laboratory for Clinical Research on Obesity Mobilisation des lipides du tissu adipeux et insulinorésistance Dominique Langin Séminaire
More informationHmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC. Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC
Supplement Table I: primers for Real Time RT-PCR Gene Foward Reverse Hmgcoar AGCTTGCCCGAATTGTATGTG TCTGTTGTAACCATGTGACTTC Cyp7α GGGATTGCTGTGGTAGTGAGC GGTATGGAATCAACCCGTTGTC Cyp27a1 GTGGTCTTATTGGGTACTTGC
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSupplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
More informationA synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis
A synergistic anti-obesity effect by a combination of capsinoids and cold temperature through the promotion of beige adipocyte biogenesis Kana Ohyama, 1,2 Yoshihito Nogusa, 1 Kosaku Shinoda, 2 Katsuya
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationTherapeutic Targets for NASH in HIV
Therapeutic Targets for NASH in HIV Unique opportunities and challenges Richard K. Sterling, MD, MSc, FACP, FACG, AGAF, FAASLD VCU Professor of Hepatology Chief of Hepatology Program Director, Transplant
More informationTesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies
Tesamorelin Clinical Data Overview Jean-Claude Mamputu, PhD Senior Medical Advisor, Theratechnologies Copyright 2016. All Rights Reserved. Property of Theratechnologies Inc. Mechanism of Action of Tesamorelin
More information2.5. AMPK activity
Supplement Fig. A 3 B phos-ampk 2.5 * Control AICAR AMPK AMPK activity (Absorbance at 45 nm) 2.5.5 Control AICAR Supplement Fig. Effects of AICAR on AMPK activation in macrophages. J774. macrophages were
More informationHepatic overexpression of CD36 improves glycogen homeostasis and attenuates high-fat
MCB Accepted Manuscript Posted Online 15 August 2016 Mol. Cell. Biol. doi:10.1128/mcb.00138-16 Copyright 2016, American Society for Microbiology. All Rights Reserved. 1 2 Hepatic overexpression of CD36
More informationSupplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice
Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,
More informationHormones and Target Tissues
Hormones and Target Tissues The hypothalamus is the coordination center of the endocrine system Hypothalamus is a small region of the forebrain in animals with skulls It receives and integrates nerve signals
More informationDietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and
Dietary supplementation in treating non-alcoholic fatty liver disease Dr. Ahmad Saedi Associate Professor School of Nutritional Sciences and Dietetics Tehran University of Medical Sciences Honorary Academic
More informationCan physical exercise and exercise mimetics improve metabolic health in humans?
Can physical exercise and exercise mimetics improve metabolic health in humans? Patrick Schrauwen, PhD NUTRIM school for Nutrition and Translational Research in Metabolism Department of Human Biology,
More informationYun-Jung Choi, Jiangao Song, Jeff D. Johnson, Charles McWherter. NASH-TAG Conference Park City, Utah January 4, 2019
Combination Therapy of Seladelpar and Liraglutide Attenuates Obesity, Hepatic Steatosis and Fibrosis in a Diet-induced and Biopsy-confirmed Mouse Model of NASH Yun-Jung Choi, Jiangao Song, Jeff D. Johnson,
More informationFGF21 Resistance in Adipose Tissues as a Cause of Insulin Resistance
Resistance in Adipose Tissues as a Cause of Insulin Resistance The ICDM 213 & 5 th AASD Scientific Meeting Seoul, Korea, Nov 8, 213 Aimin Xu Dept of Medicine & Dept of Pharmacology and Pharmacy The University
More informationInvestigating the Role of Nuclear Receptors in HIV/HAART-Associated. Dyslipidemic Lipodystrophy. A Thesis. Submitted to the Faculty.
Investigating the Role of Nuclear Receptors in HIV/HAART-Associated Dyslipidemic Lipodystrophy A Thesis Submitted to the Faculty of Drexel University by Jennifer Berbaum in partial fulfillment of the requirements
More informationEffect of BI-1 on insulin resistance through regulation of CYP2E1
Effect of BI-1 on insulin resistance through regulation of CYP2E1 Geum-Hwa Lee 1, Kyoung-Jin Oh 2, 3, Hyung-Ryong Kim 4, Hye-Sook Han 2, Hwa-Young Lee 1, Keun-Gyu Park 5, Ki-Hoan Nam 6, Seung-Hoi Koo 2
More informationSteatoNet- Modelling steatosis identifies candidate systemic flux distribution
SteatoNet- Modelling steatosis identifies candidate systemic flux distribution deregulations Adviti Naik 1,2, Damjana Rozman 3, Aleš Belič 2* 1 Faculty of Computer Sciences and Informatics, University
More informationThe Metabolic Syndrome Update The Metabolic Syndrome: Overview. Global Cardiometabolic Risk
Update 2013 Marc Cornier, M.D. Associate Professor of Medicine Division of Endocrinology, Metabolism & Diabetes Anschutz Health and Wellness Center University of Colorado School of Medicine Denver Health
More informationDiosgenin, antagonism of LXRs 36 DNA microarray, sesame seed lignan regulation of liver fatty acid metabolism gene expression 12 18, 22, 23
Subject Index ACC, see Acyl-CoA carboxylase 1 -Acetoxychavicol acetate, inducible nitric oxide synthase suppression in cancer chemoprevention 199, 200 Acetylene carotenoids, anti-inflammatory activity
More informationQuantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
More informationSupplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
More informationFactors Regulating Features of Metabolic Syndrome
University of Kentucky UKnowledge Theses and Dissertations--Pharmacy College of Pharmacy 2017 Factors Regulating Features of Metabolic Syndrome Sonja S. Pijut University of Kentucky, srhee2@uky.edu Digital
More informationHepatic oleate regulates adipose tissue lipogenesis and fatty acid oxidation
Hepatic oleate regulates adipose tissue lipogenesis and fatty acid oxidation Maggie S. Burhans 1, Matthew T. Flowers 2, Kristin R. Harrington 2, Laura M. Bond 2, Chang-An Guo 2, Rozalyn M. Anderson 3,4,
More informationFor more information about how to cite these materials visit
Author(s): Arno Kumagai, M.D., 2009 License: Unless otherwise noted, this material is made available under the terms of the Creative Commons Attribution Noncommercial Share Alike 3.0 License: http://creativecommons.org/licenses/by-nc-sa/3.0/
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More informationAMP-activated Protein Kinase: An Emerging Drug Target to Regulate Imbalances in Lipid and Carbohydrate Metabolism to Treat Cardio- Metabolic Diseases
July 10, 2012 Manuscript ID# JLR/2012/025882 AMP-activated Protein Kinase: An Emerging Drug Target to Regulate Imbalances in Lipid and Carbohydrate Metabolism to Treat Cardio- Metabolic Diseases Rai Ajit
More informationAdipose Tissue as an Endocrine Organ. Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University
Adipose Tissue as an Endocrine Organ Abdel Moniem Ibrahim, MD Professor of Physiology Cairo University Functions of Adipose Tissue Adipose tissue expresses and secretes a variety of bioactive peptides,
More informationEmerging roles of SIRT1 in fatty liver diseases
852 Review Ivyspring International Publisher International Journal of Biological Sciences 2017; 13(7): 852-867. doi: 10.7150/ijbs.19370 Emerging roles of SIRT1 in fatty liver diseases Ren-Bo Ding, Jiaolin
More informationRequires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c
Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla
More informationFigure 1. Effects of FGF21 on adipose tissue. (A) Representative histological. findings of epididymal adipose tissue (B) mrna expression of
SUPPLEMENTAL MATERIAL EN-12-2276 Figure 1. Effects of FGF21 on adipose tissue. (A) Representative histological findings of epididymal adipose tissue (B) mrna expression of adipocytokines in adipose tissue.
More informationSupporting Information. Supporting Tables. S-Table 1 Primer pairs for RT-PCR. Product size. Gene Primer pairs
Supporting Information Supporting Tables S-Table 1 Primer pairs for RT-PCR. Gene Primer pairs Product size (bp) FAS F: 5 TCTTGGAAGCGATGGGTA 3 429 R: 5 GGGATGTATCATTCTTGGAC 3 SREBP-1c F: 5 CGCTACCGTTCCTCTATCA
More informationHormonal and Metabolic Disorders of Human Immunodeficiency Virus Infection and Substance Abuse
American Journal of Infectious Diseases 2 (3): 125-129, 2006 ISSN 1553-6203 2006 Science Publications Hormonal and Metabolic Disorders of Human Immunodeficiency Virus Infection and Substance Abuse Jag
More informationPAX8-PPARγ Fusion Protein in thyroid carcinoma
Sidney H. Ingbar Lecture, ATA 10/17/2013: PAX8-PPARγ Fusion Protein in thyroid carcinoma Ronald J. Koenig, MD, PhD Division of Metabolism, Endocrinology & Diabetes University of Michigan Learning Objectives
More informationAMP-activated protein kinase: an emerging drug target to regulate imbalances in lipid and carbohydrate metabolism to treat cardio-metabolic diseases
Thematic Review Series: New Lipid and Lipoprotein Targets for the Treatment of Cardiometabolic Diseases AMP-activated protein kinase: an emerging drug target to regulate imbalances in lipid and carbohydrate
More informationAdipose tissue: Roles and function in diabetes and beyond. August 2015; SAGLB.DIA
Adipose tissue: Roles and function in diabetes and beyond August 2015; SAGLB.DIA.15.07.0398 Acknowledgement The following slides intend to summarise the key points presented during the Banting Medal for
More informationProject Summary. Funded by The Beef Checkoff. Regulation of Marbling Development in Beef Cattle by Specific Fatty Acids
Project Summary Regulation of Marbling Development in Beef Cattle by Specific Fatty Acids Principal Investigators: S. Smith 1, B. Johnson 2 and M. Doumit 3 Texas A&M University 1, Texas Tech University
More informationA Central Role of MG53 in Metabolic Syndrome. and Type-2 Diabetes
A Central Role of MG53 in Metabolic Syndrome and Type-2 Diabetes Yan Zhang, Chunmei Cao, Rui-Ping Xiao Institute of Molecular Medicine (IMM) Peking University, Beijing, China Accelerated Aging in China
More informationMolecular Mechanisms associated with the Cancer-Cachexia Syndrome
Molecular Mechanisms associated with the Cancer-Cachexia Syndrome Prof. Dr. Josep M. Argilés Department of Biochemistry & Molecular Biology University of Barcelona, Spain Disclosures: DANONE (Scientific
More informationThe Epigenetics of Obesity: Individual, Social, and Environmental Influences. K. J. Claycombe, Ph.D.
The Epigenetics of Obesity: Individual, Social, and Environmental Influences K. J. Claycombe, Ph.D. What can happen to our gene(s) that would cause obesity? Modification via Epigenetic alterations C
More informationANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity
ANSC/NUTR 601 GENERAL ANIMAL NUTRITION Stearoyl-CoA desaturase, VLDL metabolism, and obesity I. Stearoyl coenzyme A desaturase and obesity in rodents A. Stearoyl coenzyme A desaturase (SCD) is the 9 desaturase.
More informationSUPPLEMENTARY DATA. Nature Medicine: doi: /nm.4171
SUPPLEMENTARY DATA Supplementary Figure 1 a b c PF %Change - -4-6 Body weight Lean mass Body fat Tissue weight (g).4.3.2.1. PF GC iwat awat BAT PF d e f g week 2 week 3 NEFA (mmol/l) 1..5. PF phsl (Ser565)
More informationMouse Meda-4 : chromosome 5G bp. EST (547bp) _at. 5 -Meda4 inner race (~1.8Kb)
Supplemental.Figure1 A: Mouse Meda-4 : chromosome 5G3 19898bp I II III III IV V a b c d 5 RACE outer primer 5 RACE inner primer 5 RACE Adaptor ORF:912bp Meda4 cdna 2846bp Meda4 specific 5 outer primer
More informationReviewer #1 (Remarks to the Author)
Reviewer #1 (Remarks to the Author) The authors provide an interesting data set concerning the effects of an ATGL inhibitor on energy balance and indices of insulin action in mice fed a high fat diet.
More information3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.
U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,
More information* Author to whom correspondence should be addressed; Tel.: ; Fax:
Int. J. Mol. Sci. 2014, 15, 6184-6223; doi:10.3390/ijms15046184 Review OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Obesity and Its Metabolic Complications:
More informationSUPPLEMENTARY INFORMATION
-. -. SUPPLEMENTARY INFORMATION DOI: 1.1/ncb86 a WAT-1 WAT- BAT-1 BAT- sk-muscle-1 sk-muscle- mir-133b mir-133a mir-6 mir-378 mir-1 mir-85 mir-378 mir-6a mir-18 mir-133a mir- mir- mir-341 mir-196a mir-17
More information