Genetic variation of Japanese encephalitis virus in nature

Transcription

1 Journal of General Virology (1990), 71, Printed in Great Britain 2915 Genetic variation of Japanese encephalitis virus in nature Woan-Ru Chen,* Robert B. Tesh and Rebeca Rico-Hesse Yale Arbovirus Research Unit, Department of Epidemiology and Public Health, Yale University School of Medicine, P.O. Box 3333, New Haven, Connecticut 06510, U.S.A. Forty-six strains of Japanese encephalitis (JE) virus from a ovariety of geographic areas in Asia were examined by primer-extension sequencing of the RNA template. A 240 nucleotide sequence from the pre-m gene region was selected for study because it provided sufficient information for determining genetic relationships among the virus isolates. Using 12 % divergence as a cutoff point for virus relationships, the 46 isolates fell into three distinct genotypic groups. One genotypic group consisted of JE virus isolates from northern Thailand and Cambodia. A second group was composed of isolates from southern Thailand, Malaysia, Sarawak and Indonesia. The remainder of the isolates, from Japan, China, Taiwan, the Philippines, Sri Lanka, India and Nepal, made up a third group. The implications of these findings in relation to the epidemiology of JE are discussed. Results of this study demonstrate that the comparison of short nucleotide sequences can provide insight into JE virus evolution, transmission and, possibly, pathogenesis. Introduction Japanese encephalitis (JE) virus is a major cause of human encephalitis in Asia. Clinical cases of JE have been reported from at least 16 countries in eastern and southern Asia (reviewed by Burke & Leake, 1988). Up to cases are estimated to occur annually; 25% of these are fatal and 50% result in permanent neurological or psychiatric injury. Two distinct patterns of JE virus transmission have been observed, epidemic and endemic. In general, the disease is epidemic in temperate regions of Asia and endemic in tropical regions (Burke & Leake, 1988). The reason(s) for these two distinct patterns is unknown, but one possible explanation is that there are regional differences in virulence among JE virus strains. Antigenic and biochemical differences between JE virus isolates have been demonstrated by several techniques, including cross-neutralization (Banerjee, 1986), oligonucleotide fingerprinting of virion RNA (Hori et al., 1986; Banerjee & Ranadive, 1989) and reactivity with mouse monoclonal antibodies (Hasegawa, 1982; Kimura-Kuroda & Yasui, 1983; Kobayashi et al., 1984). In order to confirm and clarify these reported differences among JE virus strains, we examined 46 virus isolates from various sources and localities in Asia by primer-extension sequencing. The results corroborate that there are genomic differences between JE virus strains and that these genetic variants circulate in specific geographic regions of Asia. This method has allowed us to classify these viruses into genotypic groups. Methods Viruses. The 46 JE virus isolates included in this study are listed in Table 1, and were obtained from a number of different sources and had various passage histories. Fig. 1 shows the approximate geographic location of the site of virus isolations. The JaOArS982 virus strain, which has been completely sequenced by Sumiyoshi et al. (1987), was used as a reference for sequence comparisons. The identity of all other JE virus strains included in this study was confirmed by an indirect fluorescent antibody test, using a JE-specific monoclonal antibody provided by Dr P. W. Mason, Yale Arbovirus Research Unit, Yale University, Conn., U.S.A. Stocks of each virus were prepared in monolayer cultures of Aedes albopictus (C6/36) cells (Igarashi, 1978). Infection of cells. C6/36 cells were grown at 28 C in spinner bottles containing Eagle's MEM with Earle's salts, with 10% heat-inactivated (60 C for 20 rain) foetal bovine serum, 0-2 mmol non-essential amino acids, 26.7 mm-nahco3, 200 mm-l-glutamine, penicillin (250 units/ml), streptomycin (200 ~tg/ml) and amphotericin (2 ~g/ml). The suspension cultures of mosquito cells were infected with 10 ml of seed virus (m.o.i. < 1 p.f.u.). Virus was harvested from the culture medium 3 days post-infection by centrifugation of the suspension at r.p.m, for 10 min. Virus purification and RNA extraction. Following removal of cell debris by centrifugation, virions were precipitated from the supernatant by adding 7% polyethylene glycol 8000 and 2-3~ sodium chloride and this mixture was stirred overnight at 4 ~C. The following day, the mixture was centrifuged at r.p.m, for 10 min. The precipitate was resuspended in 9 ml of TS buffer (50 mm-tris-hcl, 50 mm-nac1 ph 7.8) and centrifuged at r.p.m, for 10 rain. The supernatant was layered onto 1 ml of a solution containing 30 % sucrose, 1 M-NaC1, 20 mm-tris-acetate ph 8-5 and 0.1% gelatin. After centrifugation (40000 r.p.m, at 4 C for 3 h), RNA was extracted from the purified virions as described previously by Rico-Hesse et al. (1987). Primer-extension sequencing and the dendrogram of sequence similarity. JE virus RNA sequences were determined using the dideoxynucleotide chain-termination method (Sanger et al., 1977; Biggin et al., 1983), SGM

2 2916 W.-R. Chen, R. B. Tesh and R. Rico-Hesse Table 1. Isolation history of JE virus strains used in this study Strain Year location Source Nakayama 1935 Japan, Nakayama Human brain Beijing China, Beijing Human brain Japan, Tokyo Human brain Japan, Sagiyama Bird blood Sagiyama 1957 Japan, Sagiyama C. tritaeniorhynchus JaGAr# Japan, Gunma C. tritaeniorhynchus JE(2-8) 1960 China, Shang Si C. tritaeniorhynchus SA China, Shang Si C. tritaeniorhynchus India, Tamil Nadu C. sp India, Vellore C. tritaeniorhynchus M Cambodia C. tritaeniorhynchus M Cambodia C. gelidus JE Sarawak C. tritaeniorhynchus Sri Lanka Human brain 78668A 1970 India, Lucknow Human brain WTP/70/ Malaysia, Kuala Lumpur Mosquito pool Taiwan C. tritaeniorhynchus HK Taiwan C. annulus India, Andhra Pradesh C. whitmorei India, West Bengal C. epidesmus India, Dibrugarh Human brain JKT Indonesia, Java C. tritaeniorhynchus Osaka 1979 Japan, Osaka C. tritaeniorhynchus 2373/ Thailand, Bangkok Human brain VN Vietnam, Ho Chi Mirth City C. fatigans India, Kolar C. pseudovishnui India, Goa Human brain JaOArS Japan, Osaka Mosquito pool KE Thailand, Kampanghet Human brain KE-105/ Thailand, Kampanghet Human brain B-0860/ Thailand, Kampanghet Pig blood KE-093/ Thailand, Kampanghet Human brain B-t065/ Thailand, Chumporn Pig brood B-1034/ Thailand, Chumporn Pig blood KPO Thailand, Kampanghet Mosquito pool 2909/ Thailand, Chiang Rai Human brain PhAn Philippines, Santo Cristo Pig blood B Thailand, Kampanghet Pig blood P India, Vellore Human brain B Nepal, Biratnagar Human spinal fluid Nepal Human spinal fluid B Thailand, Kampanghet Pig blood ML Taiwan, Mioli Pig blood CC Taiwan, Pingtong C. tritaeniorhynchus P Sri Lanka C. pseudovishnui H Sri Lanka Human brain *C., Cu&x. modified for RNA templates (Zimmern & Kaesberg, 1978), by extension of a synthetic DNA primer with reverse transcriptase as described previously (Rico-Hesse et al, 1987). Two primers were used to obtain the JE virus RNA sequence information: M-98, a 17-mer, 5' GTGTCCTCACACATGTA Y, which binds to the centre of the pre- M gene (map site 603 to 619; Sumiyoshi et al., 1987) and M-99, a 17- mer, 5" TTGGAATGCCTGGTCCG 3", which binds to the 3" end of the pre-m gene (map site 723 to 739; Sumiyoshi et al., 1987). The rationale behind the selection of a specific region of the genome for comparison has been described previously (Rico-Hesse, 1990). Briefly, different regions of the genome, encoding portions of the E, M, NS-1 and pre-m proteins, were surveyed for nucleotide differences among five JE virus strains. The pre-m sequences showed the highest number of third position or silent nucleotide differences, thus implying that this region is free of selective pressures that might obscure long-term evolutionary relationships among strains. Sequence information on 240 nucleotides (map numbers 456 to 695) from each JE virus strain were compared to all other strains for similarity. By pairwise alignment and statistical comparison of nucleotide differences, a dendrogram of virus relationships was generated by the NUCLDIFF computer program described previously (Rico-Hesse, 1990).

3 Genetic variation of JE virus 2917 q,=.. USSR \-tl... //-t~s/ 'E~_ ~'~ L v~ambodia ~ "Z~ Indonesia ~ c.,-- Fig. 1. Map of Asia showing the approximate locations where the 46 JE virus strains described here were isolated. The symbols denote each of the three genotypic groups to which the isolates were assigned by nucleotide sequence comparison. Results Nucleotide sequences of a portion of the pre-m region were obtained from 46 JE virus isolates. Each sequence was compared with the corresponding published sequence of the JaOArS982 reference strain (Fig. 2). Over the sequence of 240 nucleotides, the 45 JE virus isolates differed from JaOArS982 by between five (2~) and 39 (16~) nucleotides. All observed differences were base substitutions, with viruses clustering into distinct groups, according to the mutations fixed at specific sites. Most of the nucleotide changes in the strains studied here did not alter the encoded amino acids (Fig. 3); that is, most of the nucleotide differences were silent. One JE virus strain from Vietnam (VN-118) was identical to the JaOArS982 strain, and 23 other strains shared >/98 amino acid identity with the reference strain. Many of the amino acid changes were observed in more than two isolates. For example, 33 of the 46 isolates encoded threonine (T) instead of tyrosine (Y), which is present in JaOArS982, at amino acid position 124. The nucleotide sequences of two samples, JE (2-8) and SA-14, of the same JE virus were compared to determine whether sequence changes occurred with serial passage. JE virus strain SA-14 was originally isolated from a pool of mosquitoes in north-west China in 1960 (Table 1). The sample of SA-14 used in our study had been passaged 14 times by intracerebral inoculation in newborn mice and three times in C6/36 cells. The JE (2-8) vaccine strain was derived from the SA-14 strain by 100 serial passages in baby hamster kidney cells, treatment with u.v. light and five passages in newborn mice; finally, it was cloned three times in primary chick embryo cells (Chen& Beaty, 1982). The resultant virus, which has been tested in China as a candidate vaccine, has markedly reduced virulence for newborn mice and reduced infectivity for mosquitoes compared to the SA-14 parental strain (Chen & Beaty, 1982). Despite its extensive passage history and attenuation, the JE (2-8) strain differed by only a single nucleotide from its parent virus (SA-14) over the 240 nucleotide sequence studied (Fig. 2). This finding indicated that the region of the genome which we were studying was not significantly modified by growth in vitro. In addition, the host source of the virus isolates did not have any effect on the nucleotide sequences of this area of the genome. The nucleotide sequence similarity dendrogram (Fig. 4) revealed the genetic relationship among these 46 JE virus isolates. The percentage of divergence between any two strains is double the distance along the horizontal axis to the node that connects them. For example, the percentage difference between the Nakayama and JaOArS982 strains is ~ 5(Y/o). JE virus isolates from adjacent geographic regions and from the same time period showed the greatest nucleotide sequence similarities. The maximum divergence over the 240 nucleotide sequence of the 46 strains was 15.6~. In the dendrogram, we defined a JE virus genotypic group as virus isolates showing no more than 12~ genomic divergence within the nucleotide interval 456 to 695 (pre-m gene region). The limit for demarcating a genotypic group is arbitrary; the 12~ limit used in this study allowed us to distinguish the major clusters which would be expected to be related epidemiologically (Fig. 4). The top cluster included strains from north Thailand and Cambodia. The Cambodian strains were isolated in 1967 and were distinct when compared to recent virus isolates from Thailand (Fig. 3). Strains from southern Thailand, Malaysia, Sarawak and Indonesia formed a second genotypic group. The majority of the JE virus strains included in our study were from temperate regions of Asia; they formed the third genotypic group. It was also observed that strains originating from northern latitudes (third genotypic group) were similar to each other (1> 92~ identical) and were distinct from strains from southern latitudes (first and second genotypic groups) (see Fig. 1 also). JE virus strains from India and Japan fell into two distinct clusters within the third genotypic group; thus, substantial genetic diversity can be seen in isolates from the same country. Although additional genotypes of JE virus undoubtedly exist in nature, further sampling should not affect the qualitative interpretation of our results.

4 2918 W.-R. Chen, R. B. Tesh and R. Rico-Hesse Strain JaOArS982 Osaka ML-117 B JE (2-8) SA-14 JaGAr# HK 8256 CC Nakayama P Sagiyama VN-I18 Beijing A P-307 H PhAn 1242 Ctry Yr 456 5?'5 82 c~ucauagcu~cg~`g~agc~`t~ug~guu~`~cg~autr~c~ang6g~gct`~u~gaugacca~caac~cacggacauu~cagacguua~cgugau~cccaccucaaaaggagagaacaga c... c... c c-u... c... c... NEPL G0... C... A... NEPL GO... C... A GO... C... A GU... C GU... c... c CG... C... C---A... U CGU... CG... C---A... C CGO... C... C---A... C... C Gu... c... C---A... C... SRLN C-GU... O... A... r, C-G... C... A... G C-G... C... A... A C-G... C... A... A c-a... c... A... A C-G... C... A... A... r, C-G... C... A... A... G C---A... C... C---A... C C-G-A... C... A... C... C C---A... C... A--A... C... VTNM c... c... A u... c-a... c... A Go... C... A... C GO... C--C... C... C GU... C... C... SRLN GU... C--C---C... C... SRLN 87 --o... GU... C... C... C... C... PHIL c-u... c... c... u... CA... C... C... M-864 M-859 B-2582 KE-105/83 B-0860/83 KE / /84 KE-093/83 KPO-439 B-2239 C A M B 67 --A-C---C-GU--C... U... C-A--A--C--U--A--A... C... G... C... U--A... C A M B c... GU--C... U... C-A--A--C--U--A--A... C... G... C... U--A A-C... GU--C... U... C... A--C--U--A--A... C... U... G... C... C... C--A C... GU--C... U... C... A--C--U--A--A... C... G... C... C--A A-C... GU--C... U... C-A--A--C... A--A... C... G... C... C... C--A c... GU--C... U... C-A--A--C... A--A... C... G... C--A c... GU--C... U... C-A--A- -C- -U--A- -A... C... G... C... C--A C... GU--C... U... C-A--@k--C--U--A--A... C... G... C... C--A c... r;,u--c... u... C-A--A--C--U--A--A... C... G... C... C--A A-C... GU--C... U... C-A--A--C--U--A- -A... C... G... C--U... C... C--A c... GU--C... U... C-A--A--C--U--A--A... C... G... C... C... C--A... JE-827 JKT-1724 B-1065/83 B-1034/83 WTP/70/22 S A R A c... u... CG... C-A--A... A... A---C... G... G... A... C... G--U--A... I N D O 79 -C... e,... UUA-GC... C-A--A--C... A--A--A---C... G... A... C--G... -C--A--U... U--A... T H A I U--G---U... U... C-A--A--C... A--A---C... G-U... U--A... C--G... C--A--C--C... U--A... T H A I U--G---U... U... C-A--A- -C... A--A- --C... G-U... U- -A... C- -G... C- -A--C- -C... U--A--U-- - M A L A U--G---U... U... C-A--A--C... A--A---C... G-U... C... C--G... A--C--C... U--A...

5 Genetic variation of JE virus 2919 Strain JaOArS982 Osaka ML-117 B JE (2-8) SA-14 JaGAr# HK 8256 CC Nakayama P O Sagiyama VN-118 Bering A P-307 H PhAn 1242 M-864 M-859 B-2582 KE-105/83 B-0860/83 KE / /84 KE-093/83 KPO-439 B-2239 JE-827 JKT-1724 B-1065/83 B-1034/83 WTP/70/22 Ctry NEPL NEPL SRLN VTNM SRLN SRLN PHIL CAMB CAMB SARA INDO MALA Yr 5T UGcUGGGU cgggcaauagacg cggcuacaug GUGAGGAcAcUAUcAcG AcGAAUGUcc AAGc caccaugggcaa GAuccAGAGGAUGUGGAU GcUGGuGuGAcAAccAAGAA A A... u... u... A C... c... G... U... A C... C... G... U... A C... U... A c... u c... u c... u c u u... c... c--u u... c... c... c--u u... c--u--u... c... c--u u... c... u... c--u u... c c- -u u... c--c... c... c u... c--c... c--u u... A... A... C U... A... A... C U... A... C... C U... A... C... C... G 49 --u... A... C... G c... u... c... U---GC... c... G c... u... c... UGC... c... G C... U... C... G A... C... U--C... U--UGC... C... G A... U--C... UGC... C... G C... U... U... U "'U... A... C... U--U... A... C... UG--U--G... C... A--C... C "'U... A... C... U--U... A... C... UG--U... C'-C... A--C... U A... C... U- "U... A... C... G... AG-AG... C" "C... A--C... U A... C... U- -U... A... C... G... AG-AG... C- -C... A- -C... U U... A... C... U--U... A... C... G... G-AG... C-'C... A'-C... U U... A... C... U--U... A... C... G... AG-AG... C--C... A--C... U U... A... C... U--U... A... C... G... G--G... C--C... A--C... C... U U... A... C... U--U... A... C... G... GG-AG... C--C... A--C... C... U U... A... C... U--U... A... C... G... 6G-AG... C--C... A--C... C... U U... A--G--C... U--U... A... C... G... AG-AG... C--C... A--C... C... U U... A... C... U--U... A... U--A... A--AG-AG... C--C... A--C... C... U U... A... U... U... A... U... G... C... C... U U... A... U... A... C... C... UC... C... C... U U... A... C--U--U... A... C... UC... C... U U... A... C--U--U... A... C... C... C... U U... A... O... U... A... C... A... UC... C... C... O... Fig. 2. Comparison of the sequences of 240 nucleotides within the pre-m region for 46 JE virus isolates, obtained between 1935 and 1987 from various Asian localities. Strain numbers are listed first, followed by abbreviations for country of isolation (see Table 1) and the last two digits of the year of isolation. Nucleotide differences from JaOArS982, a virus isolated in Japan in 1982, are shown; dashes indicate identities. Nucleotide positions are numbered according to Sumiyoshi et al. (1987). The 240 nucleotides shown constitute the total sequence information used for each strain to construct the dendrogram in Fig. 4. Virus strains are arranged into genotypic groups.

6 2920 W.-R. Chen, R. B. Tesh and R. Rico-Hesse Strain JaOArS982 Ctry Osaka ]APN ML-117 B-2524 NEPL 9548 NEPL JE (2-8) SA-14 JaGAr# ilk 8256 CC SRLN Nakayama P Sagiyama VN 118 VTNM Beijing-I 78668A IN DI P-307 SRLN H SRLN PhAn 1242 PHIL M-864 CAMB M-859 CAMB B-2582 KE B-0860/83 KE / /84 KE-093/83 KPO-439 B-2239 Yr 121 Z01 82 VIAYAGAMKLSNFQGI(LLMT I N~TD I AOV[VI PTSKGENRCWVRAI DVGYMCEDT I TYECPKLTMGNDPEDVDCWCDNOE ~-s ,... s c c c c c... s R... s R---V-S... A R... S... A c... s c... v c... v c c... s c c... v c... v T----S cr T C c... A c--->s... A c c --i... A C... A H... S T H 67 -T-C....VSV T-C... NVS t-c... AV T-C... AV T'C... AV r-c... Av r-c... Av T-C... AV T-C... AV ~-C... AV r-c... AV... JE-827 JKT-1724 B-1065/83 B-1034/83 WTP/70/22 SARA INDO MALA v... v... M A-G-VRP... S vc... v... L vc... v... L vc... s... Fig. 3. Amino acid sequences deduced from the 240 nucleotides used for determining genetic relatedness among JE virus isolates. Strains are arranged into genotypic groups. Discussion JE virus was first isolated from humans in 1935 from the brain tissue of a fatal encephalitis case in Japan (reviewed by Burke & Leake, 1988). Since that time, it has been recognized in most countries of eastern and southern Asia. Strain variation among JE virus isolates has been demonstrated before by serological tests and by two-dimensional electrophoresis of T1 RNase digests of virion RNA (Hale & Lee, 1954; Fujie et al., 1962; Oda, 1976; Hasegawa, 1982; Kimura-Kuroda & Yasui, 1983, 1986; Kobayashi et al., 1984; Hori et al., 1986;'Banerjee & Ranadive, 1989). For example, examination of JE virus isolates from Japan with mouse monoclonal antibodies revealed substantial strain variation; strains could be roughly grouped according to time of isolation (Kobayashi et al., 1984). In most of the previous studies of genetic variation, comparisons were made between JE virus strains isolated within a single country (i.e. Japan) or between strains isolated from two distinct geographic regions (i.e. Japan and Thailand, or Japan and India). In general, the results have shown strain variation among JE virus isolates from different time periods and from widely separated geographic locations. In the present study, we examined 46 JE virus strains from a much wider geographic region and representing a 52-year time span. Our results confirm those of earlier studies and indicate that JE virus isolates from the same geographic region and time period are very similar, but that genetic variation occurs among strains from diverse regions or from different time periods in the same region. These findings indicate that JE virus is continuously evolving in nature. As mentioned previously, two distinct patterns of JE virus activity have been observed. In Japan, Taiwan, China, the maritime provinces of the Soviet Union, North and South Korea, Vietnam, northern Thailand, Burma, Nepal, Sri Lanka and India, epidemic activity has been reported (Burke & Leake, 1988). In most of these regions, virus activity is seasonal and a significant number of JE cases occur annually. In contrast, in areas such as Malaysia, Indonesia, southern Thailand and the Philippines, endemic virus activity and substantial

7 Genetic variation of JE virus 2921 KE B-0860/ /79 79 KE-093/83 83 I. 2909/84 84 r KE-105/83 83 B K PO B M-859 CAMB 67 M-864 CAMB 67 JE-827 SARA 68 JKT-1724 INDO 70 B-1065/83 83 B-1034/83 83 WTP/70/22 MALA Sagiyama Beijing-I 49 VN-II8 VTNM P SRLN 69 Nakayama 35 CC HK NEPL 85 B-2524 NEPL SA JE (2-8) 60 JaGAr /01 59 ML-II7 85 JaOArS Osaka I N DI A NDI 80 P-307 SRLN SRLN 87 Ph-An 1242 PttlL 84 I i 1 i 1 I I I I I I I I I Difference (%) Fig. 4. Dendrogram of genetic relationships of 46 JE viruses from different geographic areas of Asia. The percentage nucleotide sequence divergence between any two strains is twice the distance along the x-axis to the node that connects them. The dendrogram was constructed by pairwise comparison of all nucleotide sequences (map positions 456 to 695) (Sumiyoshi et al., 1987) by a computer program that assigned each base substitution an equivalent statistical weight. human infection have been demonstrated, yet the reported incidence of JE cases is relatively low (Fukunaga et al., 1974). One explanation for these two distinct patterns of virus activity is that there are regional differences in virulence among JE virus strains. Although the results of this study tell us nothing about the virulence of the viruses examined, they do indicate that there are significant genetic differences among virus strains circulating in the epidemic and endemic regions. For example, JE virus strains from southern Thailand, Malaysia, Sarawak and Indonesia (areas representing the endemic zone) formed a distinct cluster and were genetically different from the other JE virus isolates examined. Most of the latter virus strains, which fell into two distinct genotypic clusters, were isolated in areas of epidemic JE virus activity. The only exception was the pig isolate (PhAn 1242) from the Philippines; this geographic region is generally regarded to be in the zone of endemic JE activity. One of the major unanswered questions about the epidemiology of JE is how the virus is maintained in temperate regions such as Japan, Korea and northern China. One hypothesis is that the virus is maintained locally in mosquitoes (overwintering adults or transovarially infected eggs) or in hibernating vertebrates (Rosen, 1986; Takashima et al., 1988). An alternative explanation is that the virus is re-introduced annually by migrating birds or bats from tropical regions of Asia. The results of our studies indicate that the JE virus strains from Japan, China and Taiwan are genetically distinct from the virus isolates from tropical areas of southern Asia (Thailand, Cambodia, Malaysia, Sarawak, Indone-

8 2922 W.-R. Chen, R. B. Tesh and R. Rico-Hesse sia and the Philippines). JE virus isolates from different years in the same country (i.e. Japan and Taiwan) are genetically similar to each other, suggesting that these viruses probably are maintained locally by one or more of the aforementioned overwintering mechanisms. The authors are indebted to Drs C. Chastel, B. Q. Chen, J. Converse, R. Dickerman, L. V. D'Lima, E. Gould, D. Q. Ha, C. G. Hayes, N. Karabatsos, T. W. Lim, A. Nisalak, A. Oya, L. Rosen, H. Sumiyoshi and Y. C. Wu for providing the JE virus strains used in this study. We thank Dr Mark A. Pallansch, Centers for Disease Control, Atlanta, Georgia, U.S.A. for the use of the NUCLDIFF program. This work was supported by grants AI from the National Institutes of Health and DAMD G-7005 from the U.S. Army Medical Research and Development Command. References BANERJEE, K. (1986). Certain characteristics of Japanese encephalitis virus strains by neutralization test. Indian Journal of Medical Research 83, BANERJEE, K. & RANADIVE, S. N. (1989). Oligonucleotide fingerprint analysis of Japanese encephalitis virus strains of different geographical origin. Indian Journal of Medical Research 89, BIGGIN, M. D., GIBSON, T. J. ~, HUNG, G. F. (1983). Buffer gradient gels and 35S label as an aid to rapid DNA sequence determination. Proceedings of the National Academy of Sciences, U.S.A. 80, BURKE, D. S. & LEAKE, C. J. (1988). Japanese encephalitis. In The Arboviruses: Epidemiology and Ecology, vol. III, pp Edited by T. P. Monath. Boca Raton: CRC Press. CHEN, B. Q. & BEATY, B. (1982). Japanese encephalitis vaccine (2-8 strain) and parent (SA-14 strain) viruses in Culex tritaeniorhynchus mosquitoes. American Journal of Tropical Medicine and Hygiene 31, FUJIE, N., KURATA, I. & SAWADA, M. (1962). Studies on immunological differences between the same strains of Japanese B encephalitis virus. Japanese Journal of Veterinary Science 24, FUKUNAGA, T., ROJANASUPHOT, S., PISUTHIPORNKUL, S., WUNGKORB- KIAT, S., THAMMANICHANON, A., CHANTRPENKUL, e. & TUDA, P. (1974). Seroepidemiologic study of arbovirus infections in the northeast and south of Thailand. Biken Journal 17, HALE, J. H. & LEE, L. H. (1954). A serological investigation of six encephalitis viruses isolated in Malaya. British Journal of Experimental Pathology 35, HASEGAWA, H. (1982). Characterization of monoclonal antibodies against Japanese encephalitis virus (in Japanese). Journal of the Japanese Association of Infectious Disease 57, HURt, H., MORITA, K. & IGARASHI, A. (1986). Oligonucleotide fingerprint analysis on Japanese encephalitis virus strains isolated in Japan and Thailand. Acta virologica 30, IGARASHI, A. (1978). Isolation of a Singh's Aedes albopictus cell clone sensitive to dengue and Chikungunya viruses. Journal of General Virology 40, KIMURA-KURODA, J. & YASUI, K. (1983). Topographical analysis of antigenic determinants on envelope glycoprotein V3 (E) of Japanese encephalitis virus, using monoclonal antibodies. Journal of Virology 45, KIMu~-KugoDA, J. & YASUI, K. (1986). Antigenic comparison of envelope protein E between Japanese encephalitis virus and some other flaviviruses using monoclonal antibodies. Journal of General Virology 67, KOBAYASHI, Y., HASEGAWA, T., OYAMA, T., TAMAI, T. & KUSABA, T. (1984). Antigenic analysis of Japanese encephalitis virus by using monoclonal antibodies. Infection and Immunity 44, ODA, K. (1976). Antigenic characterization among strains of Japanese encephalitis virus isolated in Hyogo prefecture by the antibodyabsorption test. Kobe Journal of Medical Science 22, RIcO-HESSE, R. (1990). Molecular evolution and distribution of dengue viruses type 1 and 2 in nature. Virology 174, RICO-HESSE, R., PALLANSCH, M., NOT'fAY, B. K. &KEw, O. M. (1987). Geographic distribution of wild poliovirus type 1 genotypes. Virology 160, ROSEN, L. (1986). The natural history of Japanese encephalitis virus. Annual Review of Microbiology 40, SANGER, F., NICKLEN, S. COULSON, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences, U.S,A. 74, SUMIYOSHI, H., MORI, C., FUKE, 1., MOREl'A, K., KLrHARA, S., KONDOU, J., KIKUCrII, Y., NAGAMATU, H. & IGARASHI, A. (1987). Complete nucleotide sequence of the Japanese encephalitis virus genome RNA. Virology 161, TAKASHIMA, I., WATANABE, T., OUCHI, N. & HASHIMOTO, N. (1988). Ecological studies of Japanese encephalitis virus in Hokkaido: interepidemic outbreaks of swine abortion and evidence for the virus to overwinter locally. American Journal of Tropical Medicine and Hygiene 38, ZIMMERN, D. & KAESBERG, P. (1978). Y-Terminal nucleotide sequence of encephalomyocarditis virus RNA determined by reverse transcriptase and chain-terminating inhibitors. Proceedings of the National Academy of Sciences, U.S.A. 75, (Received 1.5 May 1990; Accepted 23 August 1990)