REGULATION OF GLUCOSE HOMEOSTASIS THROUGH XBP1-FOXO1 INTERACTION

Size: px
Start display at page:

Download "REGULATION OF GLUCOSE HOMEOSTASIS THROUGH XBP1-FOXO1 INTERACTION"

Transcription

1 REGULATION OF GLUCOSE HOMEOSTASIS THROUGH XBP-FOXO INTERACTION Yingjiang Zhou, Justin Lee, Candace M. Reno, Cheng Sun, Sang Won Park, Jason Chung, Jaemin Lee, Simon J. Fisher, Morris F. White, Sudha B. Biddinger, Umut Ozcan Nature Medicine doi:.38/nm.93

2 Supplementary Figures a DBD XBPs AD FoxO Luciferase b DBD FoxO AD XBPs Luciferase pm-xbps pvp6-foxo pg5-luc pm-foxo pvp6-xbps pg5-luc Cotransfection Cotransfection XBPs DBD AD FoxO TATA Box Luciferase FoxO DBD AD XBPs TATA Box Luciferase c BEZ35 Insulin pakt Ser473 pakt Thr38 Akt Supplementary Figure. XBPs interacts with FoxO in mammalian two-hybrid system. (a b Schematic diagram for mammalian two-hybrid system. (a XBPs cdna was cloned into pm vector to generate a fusion protein consisting of XBPs and GAL4-DBD. FoxO cdna was cloned into pvp6 vector to generate a fusion protein consisting of FoxO and VP6-AD. The three constructs, pm-xbps, pvp6-foxo and pg5-luc, were cotransfected into CHO cells to measure the interaction between XBPs and FoxO. (b FoxO cdna was fused to the GAL4-DBD in the pm vector and XBPs cdna was fused to the VP6-AD in the pvp6 vector. The two constructs were cotransfected into CHO cells together with pg5-luc to confirm the interaction between FoxO and XBP. (c BEZ35 inhibits insulin-stimulated Akt phosphorylation on both Thr38 and Ser473. Zhou, et al. Supplementary Figure Nature Medicine doi:.38/nm.93

3 a d Plasma insulin (ng ml Day 9 e XBPs Tubulin b Relative mrna level.5.5 Dnajb9 Pdia3 Hspa Time after glucose injection (min f Blood glucose (%Basal c 4 3 Day 3 Fed Day 5 6-h fasted Time after insulin injection(min g Ins IP:IR IP:IRS PY IR PY IRS h Nuclear pakt Ser473 Akt Lysate FoxO/tubulin FoxO/lamin A/C FoxO Tubulin FoxO Lamin A/C i Foxo/Rn8s Supplementary Figure. Low level of XBPs expression in the liver of ob/ob mice improves glucose homeostasis without enhancing the insulin receptor signaling. Nine week-old, male, 7 ob/ob mice were injected with Ad-LacZ (n = 6 or Ad-XBPs (n = 6 ( PFU g through tail vein. (a XBPs protein levels in the liver on post-injection day 9. (b mrna levels of ER chaperon genes in the liver. (c Blood glucose levels in fed and fasted states. (d Plasma insulin levels. (e Glucose tolerance test on day 5 and (f insulin tolerance test on day 7 after the injection. (g In vivo insulin receptor signaling, (h total and nuclear FoxO levels, and (i mrna levels of Foxo in the liver of Ad-LacZ or Ad-XBPs injected ob/ob mice. Error bars are ± s.e.m.; P values were determined by Student s t-test (P <.5, P <.. Zhou, et al. Suplementary Figure Nature Medicine doi:.38/nm.93

4 a Time after pyruvate injection (min b Glycogen Content (mg g c pir pir/ir pirs/irs pirs/irs pakt/akt Supplementary Figure 3. High-level expression of XBPs in the liver increase insulin receptor signaling. (a, b Seven-week-old, male, ob/ob mice were injected with Ad-LacZ (n = 6 or 7 Ad-XBPs (n = 6 (4 PFU g through tail vein. (a Pyruvate tolerance test was performed on day 4 after injection. (b Liver glycogen content in adenovirus-injected mice. (c Seven-weekold, male, ob/ob mice were injected with Ad-LacZ (n = 6 or Ad-XBPs (n = 6 (.8 PFU g 8 through tail vein. On day 6 after injection, in vivo insulin receptor signaling was analyzed in the liver of adenovirus-injected ob/ob mice. The ratios of phospho-ir, phospho-ir/total IR, phospho- Ser473 IRS/total IRS, phospho-irs/total IRS, and phospho-akt /total Akt were analyzed. Error bars are ± s.e.m.; P values were determined by Student s t-test (P <.5, P <., P <.. Zhou, et al. Supplementary Figure 3 Nature Medicine doi:.38/nm.93

5 Plasma insulin (ng ml Time after glucose injection (min Supplementary Figure 4. Glucose-stimulated insulin secretion during glucose tolerance test in ob/ob mice expressing medium dose of XBPs. Seven-week-old, male, ob/ob mice were injected 7 with Ad-LacZ (n = 6 or Ad-XBPs (n = 6 (4 PFU g through tail vein. GSIS was performed on day 6 after virus injection. Zhou, et al. Suplementary Figure 4 Nature Medicine doi:.38/nm.93

6 a Pre-Infection b Initial (% 8 6 LIRKO Time after insulin injection (min c mrna level 4 3 Dnajb9 Pdia3 Hspa5 d IRS/-DKO e 6 5 Initial (% Time after insulin injection (min mrna level 4 3 Dnajb9 Pdia3 Hspa5 Supplementary Figure 5. XBPs improves glucose homeostasis independent of insulin receptor signaling. (a Hyperglycemia induced by STZ treatment. (b Insulin tolerance test in Ad-LacZ or Ad-XBPs injected LIRKO mice (n = 7 in each group on day 6 post-infection. (c mrna levels of Dnajb9, Pdia3 and Hspa5 in the liver of Ad-LacZ or Ad-XBPs injected LIRKO mice. (d Insulin tolerance test in Ad-LacZ or Ad-XBPs injected IRS/ DKO mice (n = 8 in each group on day 6 post-infection. (e mrna levels of Dnajb9, Pdia3 and Hspa5 in the liver of Ad-LacZ or Ad-XBPs injected IRS/ DKO mice. Error bars are ± s.e.m.; P values were determined by Student s t-test (P <., P <.. Zhou, et al. Supplementary Figure 5 Nature Medicine doi:.38/nm.93

7 a 5 5 Day 3 b Time after glucose injection (min c Blood glucose (%Basal Time after insulin injection (min d Day 6 e Ad Cre Day Day 3 f Ad Cre Time after glucose injection (min Supplementary Figure 6. Over-expression or deletion of XBPs in the liver of normal diet-fed lean mice shows little effects on glucose homeostasis. (a d Normal diet-fed, seven-week-old, 7 male, WT mice were injected with Ad-LacZ (n = 6 or Ad-XBPs (n = 6 (4 PFU g through tail vein. (a Fed blood glucose levels on day 3 post-infection. (b Glucose tolerance test on day 5 after infection. (c Insulin tolerance test on day 7 post-infection. (d Blood glucose levels in 48-hr Flox/Flox fasted mice on day 6 after infection. (e, f Normal diet-fed, six week-old, male Xbp mice 8 were injected with either Ad-Cre or Ad-LacZ ( x PFU per mouse. (e Blood glucose levels on and 3 days after injection. (f Glucose tolerance test on day 35 post-infection.error bars are ± s.e.m.; P values were determined by Student s t-test (P <.5. Zhou, et al. Supplementary Figure 6 Nature Medicine doi:.38/nm.93

8 a Ad Cre Tun d e Blood glucose (%Basal h Relative mrna level XBPs Lamin A/C Ad-LacZ Ad-Cre Time after glucose injection (min Ad-LacZ Ad-Cre Time after insulin injection (min.5.5 G6pc Pck Ppargca b f Ins IP: IR IP: IRS g Lysate Nuclear Ad Cre c Ad Cre Day 4 Day 7 Day 4 Ad Cre Ad Cre PY IR FoxO Tubulin FoxO PY IRS pakt Akt S473 Lamin A/C Supplementary Figure 7. XBPs deficiency in the liver leads to accumulation of FoxO and creates glucose intolerance. Xbp flox/flox mice fed on HFD for 4 weeks were injected with Ad-Cre (n = 9 or Ad-LacZ (n = 9. (a Mice were injected with tunicamycin intraperitoneally on postinjection day 5 and XBPs levels were analyzed in the liver samples. (b Blood glucose levels were measured on post-injection day 4 and (c plasma insulin levels were determined on postinjection day 7 and 4. (d GTT on day 7 and (e ITT on day 4 after injection. (f In vivo insulin receptor signaling in the liver of adenovirus-injected mice. (g Total and nuclear FoxO levels in the liver. (h mrna levels of G6pc, Pck and Ppargca mrna levels in the liver. Error bars are ± s.e.m.; P values were determined by Student s t-test (P <.5, P <., P <.. Plasma insulin (ng ml Ad Cre Zhou, et al. Suplementary Figure 7 Nature Medicine doi:.38/nm.93

9 Supplementary Methods Reagents. XBP, phosphotyrosine, HA, IR β, and actin specific antibodies, HRP conjugated goat anti mouse and goat anti rabbit antibodies were from Santa Cruz Biotechnology. FoxO, FoxO3a, phospho-akt Thr38, phospho-akt Ser473, Akt, ubiquitin, α-tubulin, and lamin A/C specific antibodies were from Cell Signaling Technology. IRS specific antibody was from Millipore. Flag specific antibody, streptozotocin (STZ, and sodium pyruvate were from Sigma Aldrich. MG3 and Akti- VIII were from EMD Biosciences. BEZ35 was from Chemie Tek. Dulbecco s Modified Eagle Medium (DMEM, Opti MEM, F Nutrient Mixture, fetal bovine serum (FBS, Lipofectamine, LR Clonase II Enzyme Mix, TOP chemically competent cells, and Trizol were from Invitrogen. Nuclear Extraction Kit and Dithiobis (succinimidyl propionate were from Thermo Scientific. Detergent compatible protein assay kit, SYBR Green Supermix, and cdna Synthesis Kit were from Bio RAD. Fast Start Taq DNA polymerase and BM Chemiluminescence Blotting Substrate were from Roche. Dual luciferase reporter assay system was from Promega. Restriction enzymes, T4 Polynucleotide Kinase, and T4 DNA Ligase were from New England Biolabs. EasyTag EXPRESS 35 S Protein Labeling Mix and D [3 3 H] Glucose were from PerkinElmer. Cell culture. We cultured Mouse Embryonic Fibroblasts (MEFs and 93A cells in DMEM supplemented with % FBS, U ml penicillin and mg ml streptomycin. We cultured Chinese Hamster Ovary (CHO cells in F Nutrient Mixture supplemented with % FBS, U ml penicillin and mg ml streptomycin. We maintained cells at 37 o C in a 5% CO humidified atmosphere. Adenovirus production. We generated adenovirus with ViraPower Adenoviral Expression System (Invitrogen. We digested 5 μg of adenoviral constructs with Pac I and transfected the linearized DNA into 93A cells. We cultured the transfected cells until visible regions of cytopathic effect formed and expanded. We collected adenovirus Nature Medicine doi:.38/nm.93

10 producing cells and subjected cells to 3 cycles of freezing and thawing to release adenovirus. We stored adenovirus at 8 o C for later use. Adenovirus for animal experiments were amplified in 93A cells, purified with CsCl gradient ultracentrifugation, confirmed to be replication incompetent, and titrated. FoxO knockdown adenovirus generation. We generated FoxO knockdown adenovirus (Ad shfoxo with a targeting sequence as 5 -GAGCGTGCCCTACTT CAAG-3, which targets to a coding region of mouse Foxo gene. Nuclear protein extraction. We washed cells with ice cold PBS once and lysed cells with hypotonic lysis buffer ( mm HEPES, ph7.5; mm KCl; mm NaF; mm MgCl ; mm EDTA; mm EGTA; mm DTT;. mm Na 3VO 4; μg ml Leupeptin; μg ml Aproptonin; mm PMSF and nm Okadaic acid. We incubated cell lysates on ice for min and then mixed them with /6 volume of % NP 4 thoroughly. We vortexed samples and centrifuged them at 6,g, 4 o C for min. We saved supernatants as cytoplasmic fractions and pellets as nuclei. We extracted nuclear proteins from nuclei with nuclear lysis buffer (5 mm HEPES, ph 7.5; 5 mm NaCl; mm NaF; 5 mm MgCl; mm DTT; % Glycerol;.% NP 4; containing mm DTT;. mm Na 3VO 4; μg ml Leupeptin; μg ml Aproptonin; mm PMSF and nm Okadaic acid by repeated vortexing. We centrifuged samples at 6,g, 4 o C for min and saved supernatants as nuclear fractions. We extracted nuclear proteins from tissues using NE PER Nuclear and Cytoplasmic Extraction Reagents (Thermo per the manufacturer s instructions. We cut mg of liver tissues into small pieces and homogenized them with a tissue grinder in the hypotonic cytoplasmic buffer. We centrifuged tissue lysates at 6,g, 4 o C for 5 min to separate cytoplasmic proteins in the supernatants and nuclei in the pellets. We extracted nuclear proteins from nuclei with Nuclear Extraction Buffer by vortexing and centrifugation. Nature Medicine doi:.38/nm.93

11 Western blotting. We lysed cells with pre chilled lysis buffer (5 mm Tris HCl, ph 7.4; mm NaF; mm Na 4P O 7; mm Na 3VO 4; mm EGTA; mm EDTA; % NP 4; mg ml Leupeptin; mg ml Aproptonin; mm PMSF and nm Okadaic acid and incubated lysates on ice for min. We centrifuged cell lysates at 6,g, 4 o C for min and collected supernatants for protein concentration determination. We boiled protein samples in Laemmli buffer at o C for 5 min. We resolved proteins by SDS PAGE and electrotransferred proteins onto polyvinylidene fluoride membranes. We blocked membranes in % blocking reagent (Roche at room temperature for h. We incubated blots with primary antibody at 4 o C overnight and with secondary antibody at room temperature for h. After extensive washing, we developed blots using a chemiluminescence assay system (Roche and exposed blots to films for appropriate time period. We performed densitometry with Image J (NIH for signal quantification on immunoblots. For reprobing, we incubated blots in a stripping buffer (6.5 mm Tris HCl, ph 6.7; % SDS; mm mercaptoethanol at 5 o C for min with vigorous shaking. We washed blots with Tris Buffered Saline containing.% Tween and incubated blots with blocking buffer, primary and secondary antibodies in sequence. FoxO ubiquitination. We cultured MEFs in cm cell culture dishes. We transfected cells with 5 μg of ubiquitin expressing plasmids and then infected cells with or 6 h after transfection. After 6 h incubation with adenovirus, we treated cells with μm MG3 or DMSO for h. We lysed cells with lysis buffer and cleared cell lysates by centrifugation at 6,g, 4 o C for min. We incubated cell lysates with FoxO specific antibody overnight and with Protein A sepharose beads for additional h at 4 o C. After extensively washing, we boiled immunoprecipitates in Laemmli buffer and subjects protein samples to Western blotting with ubiquitin specific antibody. Reverse transcription and quantitative real time PCR. We extracted total RNA from cells or animal tissues using Trizol reagent (Invitrogen according to the manufacturer s Nature Medicine doi:.38/nm.93

12 instructions. We conducted reverse transcription with μg of total RNA using a cdna synthesis kit (Bio Rad under the following conditions: 5 C for 5 min, 4 C for 3 min, and 85 C for 5 min. We analyzed the abundance of gene expression with SYBR Green Supermix on iq5 Multicolor Real Time PCR Detection System (Bio Rad. We normalized gene expression levels with 8S ribosome RNA (Rn8s level. The primer sequences were as follows. Rn8s forward: Rn8s reverse: Dnajb9 forward: Dnajb9 reverse: Pdia3 forward: Pdia3 reverse: Hspa5 forward: Hspa5 reverse: G6pc forward: G6pc reverse: Pck forward: Pck reverse: Ppargca forward: Ppargca reverse: Igfbp forward: Igfbp reverse: Foxo forward: Foxo reverse: Insr forward: Insr reverse: 5 -AGT CCC TGC CCT TTG TAC ACA-3 ; 5 -CGA TCC GAG GGC CTC ACT A-3 ; 5 -CCC CAG TGT CAA ACT GTA CCA G-3 ; 5 -AGC GTT TCC AAT TTT CCA TAA ATT-3 ; 5 -GAG GCT TGC CCC TGA GTA TG-3 : 5 -GTT GGC AGT GCA ATC CAC C-3 ; 5 -TCA TCG GAC GCA CTT GGA A-3 ; 5 -CAA CCA CCT TGA ATG GCA AGA-3 ; 5 -CCG GTG TTT GAA CGT CAT CT-3 ; 5 -CAA TGC CTG ACA AGA CTC CA-3 ; 5 -ATC ATC TTT GGT GGC CGT AG-3 ; 5 -ATC TTG CCC TTG TGT TCT GC-3 ; 5 -TGA TGT GAA TGA CTT GGA TAC AGA CA-3 ; 5 -CAA TGC CTG ACA AGA CTC CA-3 ; 5 -GAGAGCCCAGAGATGACAGA-3 ; 5 -TCCATCCAGGGATGTCTCAC-3 ; 5 -GTG AAC ACC ATG CCT CAC AC-3 ; 5 -CAC AGT CCA AGC GCT CAA TA AATGGCAACATCACACACTACC-3 ; 5 -CAGCCCTTTGAGACAATAATCC-3 ; Animal. We purchased leptin deficient (ob/ob and WT mice from the Jackson Laboratory and housed mice in a temperature controlled, air conditioned and specific Nature Medicine doi:.38/nm.93

13 pathogen free animal facility at Children s Hospital Boston on h light and h dark cycle. Mice were fed with normal chow or a high fat diet (45% calorie from fat, Research Diets Inc., and had a free access to water. We performed all animal experiments in accordance with the protocols approved by Animal Care and Use Committee at Children s Hospital Boston. STZ induced type diabetes mouse model. We dissolved STZ powder in ice cold. M sodium citrate solution (ph 4.5 immediately before use. We injected 8 week old, male C57BL6/J mice with STZ solution ( mg kg intraperitoneally. We measured blood glucose levels in STZ injected mice 5 d after injection. We used mice with blood glucose level around 5 mg dl for experiments. Adenovirus injection through tail vein. We thawed adenovirus at room temperature right before injection and diluted virus with saline to a final volume of μl per mouse. We put mice in a restrainer and heated the tail with a heating lamp to achieve vasodilatation. We injected adenovirus to mice through tail vein with a 8 gauge needle. After injection, we applied mild pressure at the injection spot until no bleeding. Blood glucose and plasma insulin measurements. We measured mouse blood glucose levels with whole blood from tail vein using a glucose meter (Bayer. For plasma insulin measurement, we collected mouse blood from tail vein with heparin treated capillary tubes and incubated blood on ice until centrifugation. We harvested plasma by centrifugation at 8,g, 4 o C for min and measured plasma insulin concentration with an Ultra Sensitive Mouse Insulin ELISA kit from Crystal Chem. Glucose Tolerance Test (GTT, Insulin Tolerance Test (ITT and Pyruvate Tolerance Test (PTT. For GTT, we fasted mice overnight (7 pm 9 am and injected mice with D glucose intraperitoneally. We measured blood glucose levels, 5, 3, 6, 9 and min after injection. The dose of glucose injection was.5g kg for ob/ob mice; Nature Medicine doi:.38/nm.93

14 g kg for LIRKO mice and IRS/IRS DKO mice; g kg for Xbp Flox/Flox mice. For ITT, we fasted mice for 6 hours (8 am pm and injected mice intraperitoneally with recombinant human insulin from Eli Lilly. We measured blood glucose levels, 5, 3, 6, 9 and min after insulin injection. The dose of insulin injection was IU kg for ob/ob mice; IU kg for LIRKO, IRS/IRS DKO and Xbp Flox/Flox mice. For PTT, we fasted mice overnight (7 pm 9 am and injected mice intraperitoneally with sodium pyruvate solution ( g kg. We measured blood glucose levels, 5, 3, 6, 9 and min after pyruvate injection.. Dong, X.C., et al. Inactivation of hepatic Foxo by insulin signaling is required for adaptive nutrient homeostasis and endocrine growth regulation. Cell Metab 8, (8. Nature Medicine doi:.38/nm.93

Supplementary Materials

Supplementary Materials Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi

More information

c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP

c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative

More information

Supplementary Figure 1 a

Supplementary Figure 1 a Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans

More information

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'

CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3' Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA

More information

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis

Plasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG

More information

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.

Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed. Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons

More information

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification. Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA

More information

Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N

Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using

More information

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53

a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,

More information

Supplementary Document

Supplementary Document Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.

More information

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and

Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;

More information

Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at

Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for

More information

Supplementary Appendix

Supplementary Appendix Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. H3F3B expression in lung cancer. a. Comparison of H3F3B expression in relapsed and non-relapsed lung cancer patients. b. Prognosis of two groups of lung cancer

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG

More information

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most

Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL

BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 1 2 3 4 Materials and Methods Cell culture BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) 5 supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 6 penicillin-streptomycin.

More information

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.

Supplementary Table 2. Conserved regulatory elements in the promoters of CD36. Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice

More information

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c

Requires Signaling though Akt2 Independent of the. Transcription Factors FoxA2, FoxO1, and SREBP1c Cell Metabolism, Volume 14 Supplemental Information Postprandial Hepatic Lipid Metabolism Requires Signaling though Akt2 Independent of the Transcription Factors FoxA2, FoxO1, and SREBP1c Min Wan, Karla

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because

Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because Supplementary Figure S1 Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because importin-α6 was shown to be testis-specific. Human and chicken importin protein

More information

A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly

A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging

More information

Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.

Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n. University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.

More information

HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates

HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates Department of Microbiology, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, USA

More information

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards

Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in

More information

RayBio KinaseSTAR TM Akt Activity Assay Kit

RayBio KinaseSTAR TM Akt Activity Assay Kit Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments

Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M

More information

Supplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota

Supplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota Supplementary Information Bamboo shoot fiber prevents obesity in mice by modulating the gut microbiota Xiufen Li 1,2, Juan Guo 1, Kailong Ji 1,2, and Ping Zhang 1,* 1 Key Laboratory of Tropical Plant Resources

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Lats1/2 deleted ihbs and ihps showed decreased transcripts of hepatocyte related genes (a and b) Western blots (a) and recombination PCR (b) of control and

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and

More information

Culture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600)

Culture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) A. B. C. D. E. PA JSRI JSRI 2 PA DSAM DSAM 2 DSAM 3 PA LNAP LNAP 2 LNAP 3 PAO Fcor Fcor 2 Fcor 3 PAO Wtho Wtho 2 Wtho 3 Wtho 4 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described

More information

Journal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype

Journal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype J. Cell Sci. : doi:.4/jcs.59: Supplementary information E9. A Arl8b /- Arl8b -/- Arl8b Arl8b non-specific band Gapdh Tbp E7.5 HE Inset B D Control al am hf C E Arl8b -/- al am hf E8.5 F low middle high

More information

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS

A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism SUPPLEMENTARY FIGURES, LEGENDS AND METHODS A Hepatocyte Growth Factor Receptor (Met) Insulin Receptor hybrid governs hepatic glucose metabolism Arlee Fafalios, Jihong Ma, Xinping Tan, John Stoops, Jianhua Luo, Marie C. DeFrances and Reza Zarnegar

More information

Nature Immunology: doi: /ni.3836

Nature Immunology: doi: /ni.3836 Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:

More information

Protocol for Gene Transfection & Western Blotting

Protocol for Gene Transfection & Western Blotting The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp,

Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat. day, cells were transduced with adenoviruses expressing GFP, MKP-3 or shgfp, SUPPLEMENTAL METHODS Over-expression of MKP-3 and knockdown of MKP-3 and FOXO1 in primary rat hepatocytes Primary rat hepatocytes were seeded as described in experimental procedures. The next day, cells

More information

Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis

Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Supplementary Data Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Keqiang Chen, Mingyong Liu, Ying Liu, Teizo Yoshimura, Wei Shen, Yingying Le, Scott

More information

The Schedule and the Manual of Basic Techniques for Cell Culture

The Schedule and the Manual of Basic Techniques for Cell Culture The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293

More information

Supplementary Information

Supplementary Information Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding

More information

Supplementary Information

Supplementary Information Supplementary Information Remodeling of heterochromatin structure slows neuropathological progression and prolongs survival in an animal model of Huntington s disease Junghee Lee, Yu Jin Hwang, Yunha Kim,

More information

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:

General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry: General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems

More information

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of

More information

Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade

Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha

More information

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells

MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells Margaret S Ebert, Joel R Neilson & Phillip A Sharp Supplementary figures and text: Supplementary Figure 1. Effect of sponges on

More information

Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E

Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili

More information

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van

More information

BIOLOGY 621 Identification of the Snorks

BIOLOGY 621 Identification of the Snorks Name: Date: Block: BIOLOGY 621 Identification of the Snorks INTRODUCTION: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on

More information

Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac

Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac ONLINE SUPPLEMENT TO Crosstalk between mineralocorticoid and angiotensin II signaling for cardiac remodeling An Di ZHANG,,3, Aurelie NGUYEN DINH CAT*,,3, Christelle SOUKASEUM *,,3, Brigitte ESCOUBET, 4,

More information

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3

Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Supporting Online Material Material and Methods References Supplemental Figures S1, S2, and S3 Sarbassov et al. 1 Material and Methods Materials Reagents were obtained from the following sources: protein

More information

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice

Supplemental Information. Increased 4E-BP1 Expression Protects. against Diet-Induced Obesity and Insulin. Resistance in Male Mice Cell Reports, Volume 16 Supplemental Information Increased 4E-BP1 Expression Protects against Diet-Induced Obesity and Insulin Resistance in Male Mice Shih-Yin Tsai, Ariana A. Rodriguez, Somasish G. Dastidar,

More information

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and

HEK293FT cells were transiently transfected with reporters, N3-ICD construct and Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections

More information

Western Immunoblotting Preparation of Samples:

Western Immunoblotting Preparation of Samples: Western Immunoblotting Preparation of Samples: Total Protein Extraction from Culture Cells: Take off the medium Wash culture with 1 x PBS 1 ml hot Cell-lysis Solution into T75 flask Scrap out the cells

More information

SUPPORTING INFORMATION

SUPPORTING INFORMATION SUPPORTING INFORMATION Biology is different in small volumes: endogenous signals shape phenotype of primary hepatocytes cultured in microfluidic channels Amranul Haque, Pantea Gheibi, Yandong Gao, Elena

More information

www.lessonplansinc.com Topic: Protein Synthesis - Sentence Activity Summary: Students will simulate transcription and translation by building a sentence/polypeptide from words/amino acids. Goals & Objectives:

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

Supplementary Materials and Methods

Supplementary Materials and Methods DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze

More information

SUPPLEMENTARY RESULTS

SUPPLEMENTARY RESULTS SUPPLEMENTARY RESULTS Supplementary Table 1. hfpr1- Flpln-CHO hfpr2-flpln-cho pec 50 E max (%) Log( /K A) Log( /K A) N pec 50 E max (%) Log( /K A) Log( /K A) n ERK1/2 phosphorylation fmlp 9.0±0.6 80±7

More information

CIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR

CIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR CIRCRESAHA/2004/098145/R1 - ONLINE 1 Expanded Materials and Methods Validation by Semi-quantitative Real-Time Reverse Transcription PCR Expression patterns of 13 genes (Online Table 2), selected with respect

More information

Supplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease

Supplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease Cell Stem Cell, Volume 23 Supplemental Information Th17 Lymphocytes Induce Neuronal Cell Death in a Human ipsc-based Model of Parkinson's Disease Annika Sommer, Franz Maxreiter, Florian Krach, Tanja Fadler,

More information

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables

Description of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were

More information

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC

18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA. 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT. Acc1 AGCAGATCCGCAGCTTG ACCTCTGCTCGCTGAGTGC Supplementary Table 1. Quantitative PCR primer sequences Gene symbol Sequences (5 to 3 ) Forward Reverse 18s AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA 36b4 GTTCTTGCCCATCAGCACC AGATGCAGCAGATCCGCAT Acc1

More information

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands)

MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) Supplemental data Materials and Methods Cell culture MTC-TT and TPC-1 cell lines were cultured in RPMI medium (Gibco, Breda, The Netherlands) supplemented with 15% or 10% (for TPC-1) fetal bovine serum

More information

Supporting Information

Supporting Information Supporting Information Malapeira et al. 10.1073/pnas.1217022110 SI Materials and Methods Plant Material and Growth Conditions. A. thaliana seedlings were stratified at 4 C in the dark for 3 d on Murashige

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL Table S1. Primers and fluorescent probes used for qrt-pcr analysis of relative expression levels of PPP family phosphatases. gene name forward primer, 5-3 probe, 5-3 reverse primer,

More information

Supplementary Figure S1

Supplementary Figure S1 Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight

More information

McAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers.

McAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers. Mclpine PERK-GSK3 regulates foam cell formation Supplemental Material Supplementary Table I. Sequences of real time PCR primers. Primer Name Primer Sequences (5-3 ) Product Size (bp) GRP78 (human) Fwd:

More information

Supplementary Figure 1

Supplementary Figure 1 Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated

More information

Protocol for purification of recombinant protein from 300 ml yeast culture

Protocol for purification of recombinant protein from 300 ml yeast culture Protocol for purification of recombinant protein from 300 ml yeast culture Equipment and reagents needed: Zirconia beads (0.5 mm diameter from BSP, Germany) Paint Shaker (at 4 C) Tube rotator for 15 ml

More information

ice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.

ice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS. Cell cycle analysis For cell cycle analysis, single cell suspensions of E12.5 fetal liver cells were suspended in 4 ml ice-cold 7% ethanol with gentle vortexing, incubated at -2 C for 4 hours, and washed

More information

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance

Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Cell Metabolism, Volume 11 Supplemental Information Defective Hepatic Autophagy in Obesity Promotes ER Stress and Causes Insulin Resistance Ling Yang, Ping Li, Suneng Fu, Ediz S. Calay, and Gökhan S. Hotamisligil

More information

Loyer, et al. microrna-21 contributes to NASH Suppl 1/15

Loyer, et al. microrna-21 contributes to NASH Suppl 1/15 Loyer, et al. microrna-21 contributes to NASH Suppl 1/15 SUPPLEMENTARY MATERIAL: Liver MicroRNA-21 is Overexpressed in Non Alcoholic Steatohepatitis and Contributes to the Disease in Experimental Models

More information

Supplementary Figure 1a

Supplementary Figure 1a Supplementary Figure 1a Hours: E-cadherin TGF-β On TGF-β Off 0 12 24 36 48 24 48 72 Vimentin βactin Fig. S1a. Treatment of AML12 cells with TGF-β induces EMT. Treatment of AML12 cells with TGF-β results

More information

supplementary information

supplementary information Figure S1 Nucleotide binding status of RagA mutants. Wild type and mutant forms of MycRagA was transfected into HEK293 cells and the transfected cells were labeled with 32 Pphosphate. MycRagA was immunoprecipitated

More information

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination

AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse

More information

Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast

Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast Supplemental Figures, Tables and Results Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast Sami Hocine 1, Pascal Raymond 2, Daniel Zenklusen 2, Jeffrey A. Chao 1 &

More information

Minute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit User Manual (v5)

Minute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit User Manual (v5) Minute TM Plasma Membrane Protein Isolation and Cell Fractionation Kit Catalog number: SM-005 Description Minute TM plasma membrane (PM) protein isolation kit is a novel and patented native PM protein

More information

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage

More information

Fig. S1. Generation of pancreas-specific Stard13 PA-deleted mice. (A) Schematic representation of the targeted Stard13 flox allele, indicating the

Fig. S1. Generation of pancreas-specific Stard13 PA-deleted mice. (A) Schematic representation of the targeted Stard13 flox allele, indicating the Fig. S1. Generation of pancreas-specific Stard13 PA-deleted mice. (A) Schematic representation of the targeted Stard13 flox allele, indicating the loxp sites (in pink) flanking exon 5 of the gene, FRT-flanked-Hygromicin,

More information

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus changes in corresponding proteins between wild type and Gprc5a-/-

More information

Chromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles.

Chromatin IP (Isw2) Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. Chromatin IP (Isw2) 7/01 Toshi last update: 06/15 Reagents Fix soln: 11% formaldehyde, 0.1 M NaCl, 1 mm EDTA, 50 mm Hepes-KOH ph 7.6. Freshly prepared. Do not store in glass bottles. 2.5 M glycine. TBS:

More information

TetR repressor-based bioreporters for the detection of doxycycline using Escherichia

TetR repressor-based bioreporters for the detection of doxycycline using Escherichia Supplementary materials TetR repressor-based bioreporters for the detection of doxycycline using Escherichia coli and Acinetobacter oleivorans Hyerim Hong and Woojun Park * Department of Environmental

More information

Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10

Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10 J. gen. Virol. (1988), 69, 945-949. Printed in Great Britain 945 Key words: BTV/genome segment lo/nucleotide sequence Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10 By

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice

BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana

More information

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization

Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Figure 1. Neither the activation nor suppression of the MAPK pathway affects the ASK1/Vif interaction. (a, b) HEK293 cells were cotransfected with plasmids encoding

More information

Lezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code

Lezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Lezione 10: Sintesi proteica Synthesis of proteins Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza

More information

Trident Membrane Protein Extraction Kit

Trident Membrane Protein Extraction Kit Cat. No. Size Shelf life GTX16373 5/ 20 tests 12 months at the appropriate storage temperatures (see below) Contents Component Storage Amount for 5 tests Amount for 20 tests Buffer A -20 o C 2.5 ml 10

More information

PATIENTS AND METHODS. Subjects

PATIENTS AND METHODS. Subjects PATIENTS AND METHODS Subjects Twenty-nine morbidly obese subjects involved in a gastric surgery program were enrolled in the study between October 25 and March 21. Bariatric surgery was performed in patients

More information

Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies

Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies Borneo Journal of Resource Science and Technology (2013) 3(2): 15-20 Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies EDMUND UI-HANG SIM *1, NUR DIANA ANUAR 2, TENG-AIK ONG 3, GUAN-

More information

Supplemental Figures: Supplemental Figure 1

Supplemental Figures: Supplemental Figure 1 Supplemental Figures: Supplemental Figure 1 Suppl. Figure 1. BM-DC infection with H. pylori does not induce cytotoxicity and treatment of BM-DCs with H. pylori sonicate, but not heat-inactivated bacteria,

More information

Supplementary Information. Cryptochrome Mediates Circadian Regulation of camp. Signalling and Hepatic Gluconeogenesis

Supplementary Information. Cryptochrome Mediates Circadian Regulation of camp. Signalling and Hepatic Gluconeogenesis Supplementary Information Cryptochrome Mediates Circadian Regulation of camp Signalling and Hepatic Gluconeogenesis Eric E. Zhang 1,2*, Yi Liu 3,5*, Renaud Dentin 3, Pagkapol Y. Pongsawakul 1, Andrew C.

More information

Nuclear Extraction Kit

Nuclear Extraction Kit Nuclear Extraction Kit Catalog Number KA1346 50 assays Version: 07 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Principle of the Assay... 3 General Information... 4

More information