ice-cold 70% ethanol with gentle vortexing, incubated at -20 C for 4 hours, and washed with PBS.
|
|
- Chloe Shepherd
- 5 years ago
- Views:
Transcription
1 Cell cycle analysis For cell cycle analysis, single cell suspensions of E12.5 fetal liver cells were suspended in 4 ml ice-cold 7% ethanol with gentle vortexing, incubated at -2 C for 4 hours, and washed with PBS. Cells were then incubated with.2 mg/ml RNase (Invitrogen) / PBS at 37 C for 6 minutes. Propidium iodide (PI) was added at a final concentration of 5 µg/ml. Flow cytometry was carried out on a Becton Dickinson FACS LSR with CELLQuest (Becton Dickinson) software. Data were analyzed using FlowJo (Tree Star Inc., Ashland, OR) analysis software. Preparation of Native erythroblastic islands and Reconstituted erythroblastic islands Native erythroblastic islands were isolated from fetal livers using a previously described protocol 1. E13.5 fetal livers were dissected and dispersed by enzymatic digestion with collagenase S-1 (Nitta Gelatin, Osaka, Japan) and DNase I (Sigma-Aldrich, St. Louis, MO). Digested fetal liver cells (2 1 6 cells in 2 µl medium) were allowed to attach to glass coverslips for 2 minutes at 37 C in 5% CO 2. Attached cells were then flooded with medium and incubated for 4 hours. Adherent macrophages with attached erythroid clusters were obtained by dipping coverslips in RPMI to remove nonadherent cells and were then processed for immunofluorescence analysis ( Native erythroblastic island). To strip erythroblasts from macrophages, cells were incubated in PBS lacking Ca 2+ and Mg 2+ for 1 minutes. The remaining adherent fetal liver cells were allowed to re-spread in RPMI containing 1% FBS for 2 hours before receiving fresh erythroblasts (1 1 6 erythroblasts in 5 µl medium from c-maf +/+ or c-maf -/- E14.5 fetal liver). Finally, the reconstituted clusters were dipped to remove the unbound cells before being processed for immunofluorescence
2 ( Reconstituted erythroblastic island). Immunofluorescence staining was performed with rat anti-mouse F4/8 antibody (Serotec, Oxford, United Kingdom), visualized by Alexa 488-conjugated chicken anti-rat IgG (Molecular Probes, Eugene OR) and PE-conjugated anti-mouse TER-119 antibody (BioLegend, San Diego, CA). The number of erythroblasts attached to macrophages was determined by counting the total number of cells present in each island visualized using a Leica fluorescence microscope (Leica Microsystems, Tokyo, Japan). Four to six embryos were analyzed per combination group. For each combination, at least 2 macrophages per embryo were analyzed. Microarray analysis of fetal liver macrophages Fetal liver cells from E15.5 c-maf +/+ and c-maf -/- embryos were incubated with APC-conjugated anti-mac-1 antibody (ebioscience) and PE-conjugated anti-f4/8 antibody (Serotec). Mac-1 + F4/8 + cells were sorted by a FACSAria cell sorter (Becton Dickinson) as fetal liver macrophages. Total RNA was extracted from fetal liver macrophages using a QIAGEN RNeasy Mini Kit according to the manufacturer s instructions. The microarray procedure was performed as described in the Affymetrix GeneChip Expression Analysis Manual (Affymetrix). Biotin-labeled crna was synthesized from 4 to 6 µg RNA and hybridized to a GeneChip Mouse Genome Array (Affymetrix). After washing, arrays were stained with streptavidin-phycoethrin and analyzed on a scanner. Each array was analyzed using the GeneSpring (Agilent Technologies, Palo Alto, CA) program to calculate the average density for each probe set (Affymetrix). Data normalization and data analyses were performed using GeneSpring. The data have been deposited in the Gene Expression Omnibus database under the accession number GSE2335.
3 Table S1. Primer sequences used for PCR Primers Used for PCR Gene VCAM-1 forward VCAM-1 reverse EMP forward EMP reverse Rb forward Rb reverse IL-6 forward IL-6 reverse IL-1β forward IL-1β reverse IL-12b forward IL-12b reverse TNF-α forward TNF-α reverse Primer sequence 5 - GGA TGA ACA CTC TTA CCT GTG C -3' 5 - GGT CAA AGG GAT ACA CAT TAG GG -3' 5 - CCA CCA GAC ACA CAT ATC TC -3' 5 - CTG CAC ACA GGG CAG TCA GG -3' 5'- GTG ACA GAG TGC TCA AAA GA -3' 5'- ATC CTT GCT CTC ATT CAT TC -3' 5'- CAC AGA GGA TAC CAC TCC CAA CA -3' 5'- TCC ACG ATT TCC CAG AGA ACA -3' 5'- CAA CCA ACA AGT GAT ATT CTC CAT G -3' 5'- GAT CCA CAC TCT CCA GCT GCA -3' 5'- AGA CAT GGA GTC ATA GGC TCT G -3' 5'- CCA TTT TCC TTC TTG TGG AGC A -3' 5'- GCC ACC ACG CTC TTC TGT CT -3' 5'- TGA GGG TCT GGG CCA TAG AAC -3' PCR conditions were: 95 C for 3 s; 4 cycles of 95 C for 5 s, 6 C for 6 s; 1 stage of 95 C for 15 s, 6 C for 3 s, 95 C for 15 s. Other primers were as reported previously. 2-4
4 Figure S1. c-maf is not expressed in placenta and c-maf deficient placenta appeared normal (A-B) Immunofluorescence staining of c-maf in the lens section using anti-c-maf antibody (clone M-153, Santa Cruz Biotechnology) (A) and placental section (B). Green: c-maf, blue: Hoechst. The scale bar represents 2 µm in the upper panel of B. The other scale bar represents 1 µm. Representative pictures are shown. Note that c-maf localizes in the nuclei of lens because c-maf is a nuclear localizing transcription factor, whereas such localization is not observed in the placental section. (C) Relative c-maf mrna expression of placenta, limb and head. Total RNA obtained from 3 mg or less of these tissues were used for analyses. n = 4 per tissue from wild-type E13.5 animals. (D) Hematoxylin and eosin staining of placental sections from E13.5 c-maf +/+ and c-maf -/- animals. The scale bar represents 1 µm. Figure S2. Definitive erythropoiesis in fetal liver is impaired in c-maf -/- embryos (A) Typical flow cytometric profiles of c-maf +/+ and c-maf -/- fetal liver cells isolated from E13.5 embryos double labeled with a FITC-conjugated anti-cd71 monoclonal antibody (mab) and a APC-conjugated anti-ter-119 mab. Regions R1 to R5 are defined by a characteristic staining pattern of cells as indicated. The mean percentages for the populations in each region are shown in red. In c-maf -/- fetal liver, the percentages of R3, R4 and R5 were reduced, whereas the percentages of R1 and R2 were increased compared with c-maf +/+ fetal liver. (B) Comparison of c-maf +/+ and c-maf -/- fetal livers in the ratio of R1 to R5. represents c-maf +/+ ; represents c-maf -/-. n = 5 ~ 7 per group; *p <.5. (C) The ratio of annexin V positive cells from R1 to R5 was compared in c-maf +/+ and c-maf -/- fetal livers. represents c-maf +/+ ; represents c-maf -/-. n = 5 ~ 7 per group; *p <.5. Figure S3. Decreased mrna expression of βmajor/βminor globins in c-maf -/- fetal liver The Mac-1 negative fraction was isolated by Mac-1 magnetic beads. Analyses of mrna expression of mouse β-globin chains showed that mrna expression of βmajor/βminor globins was decreased,
5 whereas embryonic β-globin genes (εy-globin and βh1-globin) were maintained in the Mac-1 negative fraction of E13.5 c-maf -/- fetal liver cells. represents c-maf +/+ ; represents c-maf -/-. n = 7 per group. *p <.1. Expression of the c-maf +/+ fetal liver Mac-1 negative fraction was set to 1.. Data are presented as mean ± SEM. Figure S4. The in vitro erythroid colony formation of c-maf -/- fetal liver cells is not impaired (A) Hemoglobin levels in day 2 CFU-Es from c-maf +/+ and c-maf -/- E13.5 fetal liver cells are shown. The scale bar represents 2 µm. (B) Diameters of CFU-Es from c-maf +/+ and c-maf -/- E13.5 fetal liver cells are shown. represents c-maf +/+ ; represents c-maf -/-. Twenty-seven to twenty-nine colonies from 4 fetal livers per group were counted. Data are presented as mean ± SEM. p =.1. (C) Cytospun cells from day 2 CFU-Es (from E13.5 fetal liver cells in c-maf +/+ upper panel, and c-maf -/- ; lower panel) were stained with May-Grünwald Giemsa. Note enucleated red blood cells were observed in the cytospin picked from c-maf -/- CFU-Es. The scale bar represents 2 µm. Figure S5. Erythroid differentiation is not impaired in c-maf -/- fetal liver cells transplanted mice (A) Flow cytometric analysis of bone marrow cells prepared from femur of recipient mice that received c-maf +/+ or c-maf -/- fetal liver cells. Bone marrow cells were labeled with a FITC-conjugated anti-ter-119 monoclonal antibody (mab) and an APC-conjugated anti-cd44 mab. Regions I to V are defined by a characteristic staining pattern and forward scatter (FSC) intensity of cells as indicated 5. Representative profiles are shown. (B) Comparison of region I to region V showing ratios of bone marrow cells from mice transplanted with c-maf +/+ and c-maf -/- fetal liver cells. (C) The numbers of cells in region I to region V per femur are shown. Note that erythroid differentiation status in c-maf -/- fetal liver cells transplanted mice is comparable with that in the c-maf +/+ fetal liver cells transplanted control. represents bone marrow cells from mice transplanted with c-maf +/+ fetal liver cells; represents bone marrow cells from mice
6 transplanted with c-maf -/- fetal liver cells. n = 5 per group; FLC, fetal liver cells; Figure S6. VCAM-1 expression of bone marrow macrophages in c-maf -/- fetal liver cells transplanted mice is not decreased After 6-1 weeks following transplantation, the donor leukocytes (Left) in bone marrow cells and the donor macrophages in bone marrow macrophages (Right; Mac-1 positive cells) were analyzed. The chimerism of the mice reconstituted with c-maf -/- fetal liver cells was comparable with that of the mice reconstituted with c-maf +/+ fetal liver cells. Figure S7. c-maf -/- fetal liver macrophage mrna expression profiles at E13.5 mrna expression profiles of Rb and inflammatory cytokines. The population was enriched for the Mac-1-negative cells (open bar) and Mac-1-positive cells (gray bar). n = 7 per group. *p <.5. Data are presented as mean ± SEM. N.A. : not analyzed.
7 REFERENCES 1. Iavarone A, Emerson RK, Dai XM, et al. Retinoblastoma promotes definitive erythropoiesis by repressing Id2 in fetal liver macrophages. Nature. 24;432(72): Nakamura M, Hamada M, Hasegawa K, et al. c-maf is essential for the F4/8 expression in macrophages in vivo. Gene. 29;445(1-2): Atarashi K, Nishimura J, Shima T, et al. ATP drives lamina propria T(H)17 cell differentiation. Nature. 28;455(7214): Sankaran VG, Xu J, Ragoczy T, et al. Developmental and species-divergent globin switching are driven by BCL11A. Nature. 29;46(7259): Chen K, Liu J, Heck S, Chasis JA, An X, Mohandas N. Resolving the distinct stages in erythroid differentiation based on dynamic changes in membrane protein expression during erythropoiesis. Proc Natl Acad Sci U S A. 29;16:
8 igure S1 A c-maf Hoechest Merge B 1.5 Placenta Relative c-maf mrna expression Lens C D c-maf +/+ c-maf -/ Placenta Limb Head
9 Figure S2 A 1 4 c-maf +/+ c-maf -/- R2: 6.6 R3: 53.3 R2: 13.5 R3: B Cell Number ( x1 6 ) CD R1: TER c-maf +/+ * c-maf -/- R4: 12.3 R5:.6 R1 R2 R3 R4 R5 * * C Percentage of Apoptotic cells in each reagion (%) R1: R4: 8. R5:.3 R1 R2 R3 R4 R5 * *
10 Figure S3 Relative gene expression in Mac-1 negative fraction in E13.5 fetal liver cells c-maf+/+ c-maf-/- εy globin βh1 globin βmajor/βminor globins *
11 Figure S4 A B 3 c-maf -/- c-maf +/+ c-maf -/- c-maf +/+ C Diameter of CFU-E (μm) 2 1 c-maf +/+ c-maf -/-
12 Figure S5 A I IV c-maf +/+ FLC transplanted mice IV III II Count V III II I V TER-119 FITC FSC CD44 APC 1 4 I 1 4 IV III c-maf -/- FLC transplanted mice CD44 APC V IV III II Count V II I TER-119 FITC FSC CD44 APC B C Frequency of each region in TER-119 positive cells (%) c-maf +/+ FLC transplanted mice c-maf -/- FLC transplanted mice I II III IV V Cell number of each region per femur (x1 6 ) I II III IV V
13 Figure S6 c-maf +/+ FLC transplanted mice c-maf -/- FLC transplanted mice Percentage of doner leukocytes in BM cell (%) Percentage of doner macrophages in BM macrophages (%)
14 Figure S7 Relative gene expression Rb IL-6 Mac-1 positive Mac-1 negative c-maf +/+ c-maf -/- c-maf +/+ c-maf -/- * IL-1β * N.A. N.A. c-maf +/+ c-maf -/- IL-12β TNF α Relative gene expression c-maf +/+ c-maf cmaf -/- c-maf +/+ c-maf -/-
Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
More informationCD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'
Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA
More informationa) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
More informationc Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
More informationFigure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
More informationToluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in
More informationAbbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
More informationPlasmids Western blot analysis and immunostaining Flow Cytometry Cell surface biotinylation RNA isolation and cdna synthesis
Plasmids psuper-retro-s100a10 shrna1 was constructed by cloning the dsdna oligo 5 -GAT CCC CGT GGG CTT CCA GAG CTT CTT TCA AGA GAA GAA GCT CTG GAA GCC CAC TTT TTA-3 and 5 -AGC TTA AAA AGT GGG CTT CCA GAG
More informationSupplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N
MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using
More informationSupplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
More informationSupplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
More informationSUPPLEMENTARY INFORMATION
doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and
More informationSupplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. H3F3B expression in lung cancer. a. Comparison of H3F3B expression in relapsed and non-relapsed lung cancer patients. b. Prognosis of two groups of lung cancer
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
More informationSupplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
More informationSupplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for
More informationBHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL
1 2 3 4 Materials and Methods Cell culture BHP 2-7 and Nthy-ori 3-1 cells were grown in RPMI1640 medium (Hyclone) 5 supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine, and 100 U/mL 6 penicillin-streptomycin.
More informationSupplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
More informationAstaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E
Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili
More informationSupplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
More informationTable S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments
SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M
More informationNature Immunology: doi: /ni.3836
Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:
More informationCitation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.
University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.
More informationPhylogenetic analysis of human and chicken importins. Only five of six importins were studied because
Supplementary Figure S1 Phylogenetic analysis of human and chicken importins. Only five of six importins were studied because importin-α6 was shown to be testis-specific. Human and chicken importin protein
More informationSupplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease
Cell Stem Cell, Volume 23 Supplemental Information Th17 Lymphocytes Induce Neuronal Cell Death in a Human ipsc-based Model of Parkinson's Disease Annika Sommer, Franz Maxreiter, Florian Krach, Tanja Fadler,
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
More informationA smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging
More informationSupplementary Figure 1
Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated
More informationSupplementary Materials and Methods
DD2 suppresses tumorigenicity of ovarian cancer cells by limiting cancer stem cell population Chunhua Han et al. Supplementary Materials and Methods Analysis of publicly available datasets: To analyze
More informationDescription of Supplementary Files. File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables
Description of Supplementary Files File Name: Supplementary Information Description: Supplementary Figures and Supplementary Tables Supplementary Figure 1: (A), HCT116 IDH1-WT and IDH1-R132H cells were
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described
More informationFormylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis
Supplementary Data Formylpeptide receptor2 contributes to colon epithelial homeostasis, inflammation, and tumorigenesis Keqiang Chen, Mingyong Liu, Ying Liu, Teizo Yoshimura, Wei Shen, Yingying Le, Scott
More informationCulture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600)
A. B. C. D. E. PA JSRI JSRI 2 PA DSAM DSAM 2 DSAM 3 PA LNAP LNAP 2 LNAP 3 PAO Fcor Fcor 2 Fcor 3 PAO Wtho Wtho 2 Wtho 3 Wtho 4 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB
More informationSupplemental Figures: Supplemental Figure 1
Supplemental Figures: Supplemental Figure 1 Suppl. Figure 1. BM-DC infection with H. pylori does not induce cytotoxicity and treatment of BM-DCs with H. pylori sonicate, but not heat-inactivated bacteria,
More informationBeta Thalassemia Case Study Introduction to Bioinformatics
Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Lats1/2 deleted ihbs and ihps showed decreased transcripts of hepatocyte related genes (a and b) Western blots (a) and recombination PCR (b) of control and
More informationBIOLOGY 621 Identification of the Snorks
Name: Date: Block: BIOLOGY 621 Identification of the Snorks INTRODUCTION: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on
More informationSupplementary Figure 1a
Supplementary Figure 1a Hours: E-cadherin TGF-β On TGF-β Off 0 12 24 36 48 24 48 72 Vimentin βactin Fig. S1a. Treatment of AML12 cells with TGF-β induces EMT. Treatment of AML12 cells with TGF-β results
More informationSUPPLEMENTAL METHODS Cell culture RNA extraction and analysis Immunohistochemical analysis and laser capture microdissection (LCM)
SUPPLEMENTAL METHODS Cell culture Human peripheral blood mononuclear cells were isolated from healthy donors by Ficoll density gradient centrifugation. Monocyte differentiation to resting macrophages ()
More informationCross-talk between mineralocorticoid and angiotensin II signaling for cardiac
ONLINE SUPPLEMENT TO Crosstalk between mineralocorticoid and angiotensin II signaling for cardiac remodeling An Di ZHANG,,3, Aurelie NGUYEN DINH CAT*,,3, Christelle SOUKASEUM *,,3, Brigitte ESCOUBET, 4,
More informationSupplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade
Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha
More informationJournal of Cell Science Supplementary information. Arl8b +/- Arl8b -/- Inset B. electron density. genotype
J. Cell Sci. : doi:.4/jcs.59: Supplementary information E9. A Arl8b /- Arl8b -/- Arl8b Arl8b non-specific band Gapdh Tbp E7.5 HE Inset B D Control al am hf C E Arl8b -/- al am hf E8.5 F low middle high
More informationBeta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015
Bioinformatics in Medical Product Development SMPD 287 Three Beta Thalassemia Sami Khuri Department of Computer Science San José State University Hemoglobin Outline Anatomy of a gene Hemoglobinopathies
More informationSupplementary Information
Supplementary Information Remodeling of heterochromatin structure slows neuropathological progression and prolongs survival in an animal model of Huntington s disease Junghee Lee, Yu Jin Hwang, Yunha Kim,
More informationSUPPORTING INFORMATION
SUPPORTING INFORMATION Biology is different in small volumes: endogenous signals shape phenotype of primary hepatocytes cultured in microfluidic channels Amranul Haque, Pantea Gheibi, Yandong Gao, Elena
More informationTetR repressor-based bioreporters for the detection of doxycycline using Escherichia
Supplementary materials TetR repressor-based bioreporters for the detection of doxycycline using Escherichia coli and Acinetobacter oleivorans Hyerim Hong and Woojun Park * Department of Environmental
More informationwww.lessonplansinc.com Topic: Protein Synthesis - Sentence Activity Summary: Students will simulate transcription and translation by building a sentence/polypeptide from words/amino acids. Goals & Objectives:
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/10/473/eaai7696/dc1 Supplementary Materials for Astrocyte-shed extracellular vesicles regulate the peripheral leukocyte response to inflammatory brain lesions
More informationCIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR
CIRCRESAHA/2004/098145/R1 - ONLINE 1 Expanded Materials and Methods Validation by Semi-quantitative Real-Time Reverse Transcription PCR Expression patterns of 13 genes (Online Table 2), selected with respect
More informationA basic helix loop helix transcription factor controls cell growth
A basic helix loop helix transcription factor controls cell growth and size in root hairs Keke Yi 1,2, Benoît Menand 1,3, Elizabeth Bell 1, Liam Dolan 1,4 Supplementary note Low soil phosphate availability
More informationSupporting Information
Supporting Information Malapeira et al. 10.1073/pnas.1217022110 SI Materials and Methods Plant Material and Growth Conditions. A. thaliana seedlings were stratified at 4 C in the dark for 3 d on Murashige
More informationSupplementary information
Supplementary information Full methods The conduct of the study was approved by an NHS research ethical committee prior to commencement (reference 12/WS/0288) and was conducted according to the principles
More information*To whom correspondence should be addressed. This PDF file includes:
www.sciencemag.org/cgi/content/full/science.1212182/dc1 Supporting Online Material for Partial Retraction to Detection of an Infectious Retrovirus, XMRV, in Blood Cells of Patients with Chronic Fatigue
More informationPATIENTS AND METHODS. Subjects
PATIENTS AND METHODS Subjects Twenty-nine morbidly obese subjects involved in a gastric surgery program were enrolled in the study between October 25 and March 21. Bariatric surgery was performed in patients
More informationSupplementary Figure S1
Supplementry Figure S Tissue weights (g).... Liver Hert Brin Pncres Len mss (g) 8 6 -% +% 8 6 Len mss Len mss (g) (% ody weight) Len mss (% ody weight) c Tiilis nterior weight (g).6...... Qudriceps weight
More informationSUPPLEMENTARY RESULTS
SUPPLEMENTARY RESULTS Supplementary Table 1. hfpr1- Flpln-CHO hfpr2-flpln-cho pec 50 E max (%) Log( /K A) Log( /K A) N pec 50 E max (%) Log( /K A) Log( /K A) n ERK1/2 phosphorylation fmlp 9.0±0.6 80±7
More informationHCV Persistence and Immune Evasion in the Absence of Memory T Cell Help.
SOM Text HCV Persistence and Immune Evasion in the Absence of Memory T Cell Help. Arash Grakoui 1, Naglaa H. Shoukry 2, David J. Woollard 2, Jin-Hwan Han 1, Holly L. Hanson 1, John Ghrayeb 3, Krishna K.
More informationSupporting Information
Supporting Information Molecular Recognition Based DNA Nanoassemblies on the Surfaces of Nanosized Exosomes Shuo Wan,, Liqin Zhang,,, Sai Wang, Yuan Liu,, Cuichen Wu, Cheng Cui, Hao Sun, Muling Shi, Ying
More informationBaseline clinical characteristics for the 81 CMML patients Routine diagnostic testing and statistical analyses... 3
Next-Generation Sequencing Technology Reveals a Characteristic Pattern of Molecular Mutations in 72.8% of Chronic Myelomonocytic Leukemia (CMML) by Detecting Frequent Alterations in TET2, CBL, RAS, and
More informationSupplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota
Supplementary Information Bamboo shoot fiber prevents obesity in mice by modulating the gut microbiota Xiufen Li 1,2, Juan Guo 1, Kailong Ji 1,2, and Ping Zhang 1,* 1 Key Laboratory of Tropical Plant Resources
More informationINTERLEUKIN-10 FACILITATES BOTH CHOLESTEROL UPTAKE AND EFFLUX IN MACROPHAGES
SUPPLEMENTAL DATA INTERLEUKIN-10 FACILITATES BOTH CHOLESTEROL UPTAKE AND EFFLUX IN MACROPHAGES Xinbing Han, Shiro Kitamoto, Qingyu Lian and William A. Boisvert Vascular Medicine Research Unit, Brigham
More informationLezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Lezione 10: Sintesi proteica Synthesis of proteins Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza
More informationExpression of Selected Inflammatory Cytokine Genes in Bladder Biopsies
Borneo Journal of Resource Science and Technology (2013) 3(2): 15-20 Expression of Selected Inflammatory Cytokine Genes in Bladder Biopsies EDMUND UI-HANG SIM *1, NUR DIANA ANUAR 2, TENG-AIK ONG 3, GUAN-
More informationNucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10
J. gen. Virol. (1988), 69, 945-949. Printed in Great Britain 945 Key words: BTV/genome segment lo/nucleotide sequence Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10 By
More informationLoyer, et al. microrna-21 contributes to NASH Suppl 1/15
Loyer, et al. microrna-21 contributes to NASH Suppl 1/15 SUPPLEMENTARY MATERIAL: Liver MicroRNA-21 is Overexpressed in Non Alcoholic Steatohepatitis and Contributes to the Disease in Experimental Models
More informationRelationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia
elationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia H.J. Ou 1, G. Huang 2, W. Liu 3, X.L. Ma 2, Y. Wei 4, T. Zhou 5 and Z.M. Pan 3 1 Department of Neurology, The
More informationViral hepatitis, which affects half a billion people
GASTROENTEROLOGY 2006;130:435 452 BASIC LIVER, PANCREAS, AND BILIARY TRACT Natural Killer Cells Ameliorate Liver Fibrosis by Killing Activated Stellate Cells in NKG2D-Dependent and Tumor Necrosis Factor
More informationUniversity of Groningen. Vasoregression in incipient diabetic retinopathy Pfister, Frederick
University of Groningen Vasoregression in incipient diabetic retinopathy Pfister, Frederick IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from
More informationSupplementary information
Supplementary information Unique polypharmacology nuclear receptor modulator blocks inflammatory signaling pathways Mi Ra Chang 1, Anthony Ciesla 1, Timothy S. Strutzenberg 1, Scott J. Novick 1, Yuanjun
More informationSingle-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast
Supplemental Figures, Tables and Results Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast Sami Hocine 1, Pascal Raymond 2, Daniel Zenklusen 2, Jeffrey A. Chao 1 &
More informationAn epithelial circadian clock controls pulmonary inflammation and glucocorticoid action
An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action Supplementary Figure : Expression levels of toll-like receptor 4 (Tlr4) in muse lung does not change throughout the
More informationIsolate Sexual Idiomorph Species
SUPLEMENTARY TABLE 1. Isolate identification, sexual idiomorph and species of each isolate used for MAT locus distribution in Paracoccidioides species. Isolate Sexual Idiomorph Species Pb01 MAT1-1 P. lutzii
More informationSUPPLEMENTARY METHODS
SUPPLEMENTARY METHODS Histological analysis. Colonic tissues were collected from 5 parts of the middle colon on day 7 after the start of DSS treatment, and then were cut into segments, fixed with 4% paraformaldehyde,
More informationwithout LOI phenotype by breeding female wild-type C57BL/6J and male H19 +/.
Sakatani et al. 1 Supporting Online Material Materials and methods Mice and genotyping: H19 mutant mice with C57BL/6J background carrying a deletion in the structural H19 gene (3 kb) and 10 kb of 5 flanking
More informationSUPPLEMENTARY INFORMATION
BASELINE ISCHAEMIA a b Phd2 +/- c d Collateral growth and maintenance SMC recruitment SMC proliferation Phd2 +/- NF- B off NF- B on NF- B on NF- B on Endothelial cell Smooth muscle cell Pro-arteriogenic
More informationThe Effect of Epstein-Barr Virus Latent Membrane Protein 2 Expression on the Kinetics of Early B Cell Infection
The Effect of Epstein-Barr Virus Latent Membrane Protein 2 Expression on the Kinetics of Early B Cell Infection Laura R. Wasil, Monica J. Tomaszewski, Aki Hoji, David T. Rowe* Department of Infectious
More informationMethodology Report Efficient Differentiation of Mouse Embryonic Stem Cells into Insulin-Producing Cells
Experimental Diabetes Research Volume 2012, Article ID 201295, 5 pages doi:10.1155/2012/201295 Methodology Report Efficient Differentiation of Mouse Embryonic Stem Cells into Insulin-Producing Cells Szu-Hsiu
More informationDetection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany
HLA ISSN 2059-2302 BRIEF COMMUNICATION Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany C. J. Hernández-Frederick 1, N. Cereb 2,A.S.Giani 1, J.
More informationDevelopment of RT-qPCR-based molecular diagnostic assays for therapeutic target selection of breast cancer patients
Development of RT-qPCR-based molecular diagnostic assays for therapeutic target selection of breast cancer patients Sangjung Park The Graduate School Yonsei University Department of Biomedical Laboratory
More informationSupporting Information. Mutational analysis of a phenazine biosynthetic gene cluster in
Supporting Information for Mutational analysis of a phenazine biosynthetic gene cluster in Streptomyces anulatus 9663 Orwah Saleh 1, Katrin Flinspach 1, Lucia Westrich 1, Andreas Kulik 2, Bertolt Gust
More informationInterferon γ regulates idiopathic pneumonia syndrome, a. Th17 + CD4 + T-cell-mediated GvH disease
Interferon γ regulates idiopathic pneumonia syndrome, a Th17 + CD4 + T-cell-mediated GvH disease Nora Mauermann, Julia Burian, Christophe von Garnier, Stefan Dirnhofer, Davide Germano, Christine Schuett,
More informationMcAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers.
Mclpine PERK-GSK3 regulates foam cell formation Supplemental Material Supplementary Table I. Sequences of real time PCR primers. Primer Name Primer Sequences (5-3 ) Product Size (bp) GRP78 (human) Fwd:
More informationSUPPORTING ONLINE MATERIAL
SUPPORTING ONLINE MATERIAL SUPPORTING ONLINE TEXT Efficiency of SCNT Alive fetuses at mid-gestation The rate of viable (beating heart) embryos at day 12.5-14.5 dpc was assessed after sacrifice of foster
More informationResistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and Gerard D. Wright.
Supplementary Data for TetX is a Flavin-Dependent Monooxygenase Conferring Resistance to Tetracycline Antibiotics by Wangrong Yang, Ian F. Moore, Kalinka P. Koteva, Donald W. Hughes, David C. Bareich and
More informationEnhanced detection and serotyping of Streptococcus pneumoniae using multiplex polymerase chain reaction
Original article http://dx.doi.org/10.3345/kjp.2012.55.11.424 Korean J Pediatr 2012;55(11):424-429 eissn 1738-1061 pissn 2092-7258 Enhanced detection and serotyping of Streptococcus pneumoniae using multiplex
More informationTable S1. Primers used to quantitatively amplify the human mirnas precursors and indicated genes
Table S1. Primers used to quantitatively amplify the human mirnas precursors and indicated genes Forward primer (5 3 ) Rervese primer (5 3 ) U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT 5S TACGGCCATACCACCCTGAA
More informationThe Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital
The Clinical Performance of Primary HPV Screening, Primary HPV Screening Plus Cytology Cotesting, and Cytology Alone at a Tertiary Care Hospital Jung-Woo Choi MD, PhD; Younghye Kim MD, PhD; Ju-Han Lee
More informationCD14 + S100A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer
CD14 + S1A9 + Monocytic Myeloid-Derived Suppressor Cells and Their Clinical Relevance in Non-Small Cell Lung Cancer Po-Hao, Feng M.D., Kang-Yun, Lee, M.D. Ph.D., Ya-Ling Chang, Yao-Fei Chan, Lu- Wei, Kuo,Ting-Yu
More information3) Table_S1: Clinical Characteristics of Breast Cancer Patients. 5) Table_S3: Primer sequences used for qt-pcr of ChIP samples
Supplemental Section: 1) Eight supplemental figures and legends 2) Supplemental Materials and Methods 3) Table_S1: Clinical Characteristics of Breast Cancer Patients 4) Table_S2: Oligonucleotide sequences
More informationSupplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
More informationMutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients
Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients Shuichi OTABE, Karine CLEMENT, Séverine DUBOIS, Frederic LEPRETRE, Veronique PELLOUX,
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationEngineering a polarity-sensitive biosensor for time-lapse imaging of apoptotic processes and degeneration
nature methods Engineering a polarity-sensitive biosensor for time-lapse imaging of apoptotic processes and degeneration Yujin E Kim, Jeannie Chen, Jonah R Chan & Ralf Langen Supplementary figures and
More informationThe Annexin V Apoptosis Assay
The Annexin V Apoptosis Assay Development of the Annexin V Apoptosis Assay: 1990 Andree at al. found that a protein, Vascular Anticoagulant α, bound to phospholipid bilayers in a calcium dependent manner.
More informationFigure S1. Detection of FABPs in adipocyte cultures.
Figure S1 Cell lysate WT-Ad KO-Ad CM Cell lysate CM ap2 mal1 Adiponectin Actin Figure S1. Detection of FABPs in adipocyte cultures. For detection of ap2, 1 µg of cell lysate or 2 µl out of total 5 µl conditioned
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
More informationCancer Genetics 204 (2011) 45e52
Cancer Genetics 204 (2011) 45e52 Exon scanning by reverse transcriptaseepolymerase chain reaction for detection of known and novel EML4eALK fusion variants in nonesmall cell lung cancer Heather R. Sanders
More informationMutation analysis of a Chinese family with oculocutaneous albinism
/, 2016, Vol. 7, (No. 51), pp: 84981-84988 Mutation analysis of a Chinese family with oculocutaneous albinism Xiong Wang 1, Yaowu Zhu 1, Na Shen 1, Jing Peng 1, Chunyu Wang 1, Haiyi Liu 2, Yanjun Lu 1
More information