Allele, genotype, and composite genotype effects of IL-1A and IL-1B polymorphisms for chronic periodontitis in an Indian population

Transcription

1 Original Research Allele, genotype, and composite genotype effects of IL-1A and IL-1B polymorphisms for chronic periodontitis in an Indian population R Gayathri, Abdul Vahab Saadi 1, K Mahalinga Bhat, Subraya G Bhat, Kapaettu Satyamoorthy 1 Department of Periodontics, Manipal College of Dental Sciences, 1 Department of Biotechnology, Manipal Life Sciences Centre, Manipal University, Manipal, Karnataka, India Received : Review completed : Accepted : ABSTRACT Introduction: The pro-inflammatory cytokine interleukin-1 (IL-1) is a key modulator of host responses to microbial infection and a major modulator of extracellular matrix catabolism and bone resorption, and polymorphisms in the IL-1 gene cluster have been associated with an increased risk of developing severe adult periodontitis. A case control study was performed to determine the role of IL-1A+4845 and IL-1B+3954 polymorphisms in the predisposition to chronic periodontitis. Materials and Methods: The study was conducted with 103 unrelated participants recruited from Manipal College of Dental Sciences, Manipal, which included 51 chronic periodontitis patients and 52 normal periodontally healthy individuals. Extensive clinical data were collected, bone loss was the major outcome variable and smokers and diabetics were excluded from the study to eliminate the influence of these risk factors. Genomic DNA was isolated from the blood samples of participants for genotyping IL-1A+4845 and IL-1B+3954 polymorphisms by polymerase chain reaction restriction fragment length polymorphism and the data statistically analyzed. Results: Allele 2 of the IL-1A+4845 polymorphism was carried by 38% of all participants; of these only 6 were homozygous for the allele. Allele 2 of the IL-1B+3954 was carried by 21% of the subjects; only 1 was homozygous for allele 2. The composite genotype was carried by 31% of the cases and by 38% of the controls. Overall, 35% participants carried the composite IL-1 genotype. No statistically significant association was found for the distributions. Conclusions: The distribution of the IL-1 positive composite genotype is in concordance with the frequencies reported in the Caucasians. Association was not found for the effect of allele, genotype, composite genotype, and haplotypes of IL-1A+4845 and IL-1B+3954 polymorphisms with periodontitis. Its utility as a risk marker in this population was not borne out by the study. Key words: Chronic periodontitis, composite genotype, IL-1A and IL-1B polymorphisms Interleukin-1 (IL-1) gene cluster polymorphisms have been associated with an increased risk of developing diseases like osteoporosis, diabetic nephropathy, autoimmune disorders, periodontal disease etc. The most frequently occurring form of periodontitis is chronic periodontitis; an infectious Address for correspondence: Dr. Kapaettu Satyamoorthy ksatyamoorthy@manipal.edu Quick Response Code: Access this article online Website: PMID: *** DOI: / disease resulting in inflammation within the supporting tissues of the teeth, progressive attachment and bone loss clinically characterized by pocket formation and/or gingival recession. Although bacteria are the initiators and perpetuators of periodontitis, risk factors including smoking, alcohol consumption, brushing and host genetic factors that include diseases like diabetes, contribute to the exact clinical appearance and severity of periodontitis. [1,2] It has been observed quite often clinically that some patients with minimal plaque have more severe disease and some others with abundance of plaque may not have periodontitis at all. Partial explanation to this intriguing reality is given by the studies on twins. These studies along with epidemiologic investigations on the natural history of periodontitis have suggested that genetic factors, and not just the amount and type of plaque play a major role in determining the actual clinical presentation of adult periodontitis. [3-5] It has

2 been estimated by some investigators that less than 20% of the variability in periodontal disease expression can be explained by the quantity of specific bacteria found in disease associated plaque. [6] Underlying this disease variability and pathogenesis of periodontitis are key role played by inflammatory mediators like prostaglandine 2 (PGE 2 ), Interleukin-1(IL-1), and matrix-metallo proteinases (MMPs). [1] It has been demonstrated that some individuals carry polymorphisms of host response genes that may code for the hyper secretion of certain inflammatory mediators in response to noxious stimuli; mainly the members of the family of the proinflammatory cytokines IL-1α and IL-1β. [7-9] These cytokines are produced by many cells in the body in response to a variety of external stimuli; and their relation with the pathways of periodontal tissue and bone destruction has been well established. Studies have also shown higher levels of IL-1α and IL-1β in gingival crevicular fluid (GCF) in periodontally diseased subjects. [1,10-13] The cluster of 3 IL-1 genes IL-1A, IL-1B and IL-1RN that code for IL-1α, IL-1β and IL-ra (receptor antagonist) have been mapped to a 415-kb region on the long arm of chromosome 2 (2q13). [14,15] Polymorphisms of the IL-1 gene cluster have been implicated as risk or susceptibility factors for a number of diseases including adult periodontitis. [16] This association involves a composite genotype with at least one copy of allele 2 (the rarer allele) of the IL-1A gene at nucleotide -899 located in the promoter region and one copy of allele 2 of the IL-1B gene at nucleotide located in the 5 th exon. Another composite genotype of IL-1A+4845 and IL- 1B+3954 showed a prevalence of 30% to 40% as reported from the several studies for this composite genotype in the Caucasian population whereas in a study of Chinese population the prevalence of the genotype was only 2.3% despite epidemiological data which indicated periodontitis to be widespread among them. [17-23] Similar studies on Thai and Hispanic populations revealed that only 1.6% and 23%, respectively, were positive for the composite genotype. [24,25] The prevalence of these polymorphisms may be race related, and hence the prognostic value of any periodontitis susceptibility test (based on composite genotype) in subjects of various origins needs to be studied and elucidated. Among the Indian populations, association of IL-1B+3954 polymorphism with chronic periodontitis was not found in a study of South Indian population though the variant T allele was more prevalent in the disease group. [26] However, in a Malayalam speaking Dravidian population of India, allele C of IL-1B 3954 polymorphism was found to be a risk factor for chronic periodontits. [27] The composite genotype of IL- 1A+4845 and IL-1B+3954 was found significantly associated with severe chronic periodontitis reported in a study of population with Maharashtrian ethnicity of India. [28] The present study was therefore designed to assess the frequencies of IL-1A+4845 and IL-1B+3954 polymorphisms in a random sample of subjects of Indian origin and to determine whether the IL-1 composite genotype is a risk marker for periodontal disease status in our population. MATERIALS AND METHODS A total of 103 unrelated participants who visited Manipal College of Dental Sciences, Manipal, were recruited for the study, all hailing from the region of Udupi district and adjoining areas in Southern Karnataka, India. The total number of 103 unrelated participants included 51 patients diagnosed with chronic periodontitis (AAP 1999) and 52 individuals who were periodontally healthy. A case control study was performed after all the participants gave written informed consent and the study was approved by the Institutional Ethics Committee of the Manipal University, Manipal. Demographic and personal data were collected, including place of origin, age, gender, medical history and smoking status. Only patients diagnosed with chronic periodontitis who were systemically healthy were included. Smokers and tobacco users, patients diagnosed with aggressive periodontitis, other diseases of oral hard or soft tissue, diabetes, hepatitis, HIV infection, bleeding disorders, patients who were pregnant or lactating and those who had history of chronic use of anti-inflammatory drugs and immunosuppressive therapy were excluded. Age and sex matched control group individuals had no symptom of periodontal disease and had at least 24 teeth. The subjects were examined clinically with a mouth mirror and a University of Michigan O probe with William s markings (Hu-Friedy, USA). Clinical data collection consisted of recording the subjects medical and medication history, and periodontal status by assessing the full mouth probing depths, full mouth clinical attachment level, and intraoral periapical radiographs with grid. The Simplified Oral Hygiene Index was also recorded. Full mouth intraoral periapical radiographs were obtained using paralleling technique with millimeter grid superimposed on the film. Bone loss assessments were made from the most distal tooth in the quadrant to the mesial of the central incisor in each quadrant. Assessment for bone loss was measured at interproximal sites and the distance from the cementoenamel junction to the crest of the alveolar bone was measured and was expressed as a percentage of the total root length. The mean alveolar bone loss for each subject was obtained by averaging the bone loss at each measured site and was the basis of disease classification (AAP 1999). None of the control participants had periodontal pockets or clinical attachment loss. Analysis of blood samples was done in a blinded fashion. Five milliliter venous blood was collected in sterile tubes with a pinch of EDTA to prevent coagulation. Genomic DNA extraction was performed from the peripheral lymphocytes

3 in the blood samples by lymphocyte lysis method and standard phenol/chloroform DNA extraction protocol. The genotyping of each sample for the two polymorphic IL gene loci were determined by the method of polymerase chain reaction followed by restriction fragment length polymorphism (PCR-RFLP). The genomic DNA regions were amplified using PCR primers annealing to positions flanking the polymorphisms. IL-1A+4845 G>T(rs17561), and IL-1BC>T (rs ) with the primer sequences and PCR conditions given in [Table 1], using a Genosys PCR thermocycler (MJ Research Model PTC-200, Genosys, Provo, Utah), and the two Single Nucleotide Polymorphisms (SNPs) were subsequently discriminated with restriction endonuclease digestion experiments. Accuracy of the PCR-RFLP method was confirmed by reanalyzing mutant samples; and representative samples of the genotypes of each polymorphic loci was sequenced to confirm the mutations detected. DNA Sequencing was performed by modified dideoxy mediated chain-termination method, using the ABI Prism (Applied Biosystems, USA) 3130 genetic analyzer automated DNA sequencer and ABI Prism Big Dye Terminator v3.1 cycle sequencing kit. The case and control populations were tested for deviation from Hardy Weinberg Equilibrium by the chi-square test. The frequency distribution of alleles and genotypes of the two polymorphisms was analyzed in periodontitis patients and healthy participants (chi- square test) in a case control format using the statistical software UNPHASED (version 2.404). Allele and genotype effects were tested using the software, which implements maximum likelihood inference on haplotype and genotype effects while allowing for uncertain phase and missing genotypes. The case and control group were further analyzed for composite genotype and haplotype effects of the two loci using UNPHASED version RESULTS The age and gender data of the of study population, both cases and controls is summarized in [Table 2]. The study population of 103 participants consisted of 51 cases including 29 males and 22 females with an average age (SD) of (8.34) years (range 27 60); and 52 controls including 36 males and 16 females with an average age (SD) of (8.55) years (range 25 50). The clinical findings of oral hygiene index-simplified (OHI-S) for cases and controls is presented in [Table 3] and the distribution of sampled population according to the calculated full mouth clinical attachment loss and radiographic measurement is given in [Table 4]. The comparison of OHI-S with clinical attachment loss and radiographic measurement is given in [Table 5] that was statistically significant. The clinical findings pertaining to the distribution of study population according to age and disease category is shown in [Table 6]. The majority of the subjects (62%) were in the years age group. Most cases (86%) had the severe type of disease (localized/ generalized) having 5 mm clinical Table 1: The primer sequences and the genotyping methods for IL-1A and IL-1B polymorphisms Locus Primer sequences Annealing temperature ( 0 C) IL-1A+4845 F: 5 ATGGTTTTAGAAATCATCAAGCCTAGGGCA 3 R: 5 AATGAAAGGAGGGGAGGATGACAGAAATGT 3 IL-1B+3954 F: 5 CTCAGGTGTCCTCGAAGAAATCAA 3 R: 5 GCTTTTTTGCTGTGAGTCCCG 3 Table 2: Age and gender distribution of the groups of participants of the study Group Total number (n=103) Male (n=65) Female (n=38) Age range in years (Average) PCR amplicon size (bp) PCR-RFLP fragment size Fnu4HI 124bp+29bp+76bp (G) 153bp+76bp (T) TaqI 94bp+85bp+12 (C) 182bp+12bp (T) Standard deviation T-test result Cases (40.09) Controls (33.15) 8.55 P=0.001 Table 3: Distribution of sampled population according to OHI-S in case and control groups Participant group Number of participants (N) Mean OHI-S Standard deviation T-test result Case Control P=0.001 Table 4: The distribution of sampled population according to CAL and RM Parameter measured Gender N Mean value Standard deviation T-test result CAL RM M F M F *P-value not significant; CAL - Clinical attachment loss; RM - Radiographic measurement; M - Male; F - Female; N - Number of participants P=0.1* P=2.36*

4 attachment loss. The remaining (14%) had the moderate type of disease with 3 4 mm of clinical attachment loss; none had the mild type of disease. The extent of periodontal destruction was found to be correlating significantly with the increasing age of the subjects. A significant correlation was found between the severity of the disease and higher mean plaque scores as presented in [Table 3] Genetic Analysis The study determined the allele and genotype frequencies of the two IL-1 gene polymorphisms, IL-1A+4845 and IL-1B+3954 in a sample group of 103 individuals. Agarose gel electro phoresis images representative of genotyping experiment results by PCR-RFLP are depicted in [Figure 1]. The control population was tested for any deviation from Hardy Weinberg Equilibrium using the chi-square test and none was found (data not shown). The frequency distribution of allele and genotype frequencies of the two polymorphisms were analyzed in the case and control groups of participants using the statistical software UNPHASED (version 2.404). Allele and genotype effects were tested Table 5: Comparison of OHI-S with CAL and RM in the sampled population CAL RM OHI-S Pearson correlation (r) P value n CAL - Clinical attachment loss; RM - Radiographic measurement with the software which implements maximum likelihood inference on haplotype and genotype effects while allowing for uncertain phase and missing genotypes. The summary of allele and genotype frequencies at the two polymorphic loci with their chi-square test P values for the distribution in cases and controls are presented in [Table 7]. The chisquare test (using UNPHASED) results for the distribution of the combined IL-1A+4845 and IL-1B+3954 genotypes in cases and controls are presented in [Table 8]. Analysis of the haplotypes [Table 9] showed that the G-C haplotype was more prevalent in the disease group (61%) as well as the controls (58%) and the most infrequent one was GT in both groups (1.3% and 5.7%, respectively). However, the test of haplotypes of the (UNPHASED) two loci showed no significant association with the disease. The cases and controls were further analyzed for linkage disequilibrium and haplotype effects of the three loci using UNPHASED. The global D value was 0.87 for cases, whereas for controls it was DISCUSSION Since the first report of a relationship between the IL-1 genotype and adult periodontitis by Kornman et al., (1997), the influence of genetic factor on various forms of periodontal disease has been incorporated into periodontology as a new line of research. In that study, genotype positive non-smokers were found to be 6.8 times Table 6: The distribution of the sampled population according to age and type of disease Age (Years) Controls (n = 52) Count (%) Cases (n=51) and the periodontal disease type count (%) GM GS LM LS Total (52) 6 (85.7) 1 (14.3) 7 (100) (32.6) 13 (48.1) 5 (18.5) 9 (33.3) 27 ( (13.4) 1 (7.7) 8 (61.5) 4 (30.8) 13 (100) >50 1 (2) 1 (25.0) 1 (25.0) 2 (50.0) 4 (100) Total 52 (100) 2 (3.9) 28 (54.9) 5 (9.8) 16 (31.4) 51 (100) GM Generalized moderate; GS Generalized severe; LM Localized moderate; LS Localized severe Figure 1: Images of the two PCR amplicons containing Single Nucleotide Polymorphisms IL-1A+4845 (lanes 1-5) and IL-1B+3954 (lanes 6-10) and their corresponding restriction endonuclease digestion fragments after agarose gel electrophoresis

5 Table 7: Genotype frequencies and allele frequencies of IL-1A+4845 (rs17571) and IL-1B+3954 (rs ) single nucleotide polymorphisms a in chronic periodontitis patients versus healthy controls Locus Genotype counts (Frequency %) Chi-square test P value b Allele counts (Frequency %) Chi-square test P value b IL-1A+4845 GG GT TT G T Periodontitis group 16 (31.4) 31 (60.8) 4 (7.8) (61.8) 39 (38.2) 0.91 Control group 15 (28.8) 35 (67.3) 2 (3.8) 65 (62.5) 39 (37.5) IL-1B+3954 CC CT TT C T Periodontitis group 34 (66.7) 16 (31.4) 1(1.9) (82.4) 18 (17.6) 0.33 Control group 28 (53.8) 24 (44.2) 0 80 (76.9) 24 (23.1) a RefSeq: NG_ and NG_ respectively, based on genomic DNA. b A p-value of <0.05 is considered significant. Table 8: Distribution of combined genotype frequencies of IL-1A+4845 (rs17571) and IL-1B+3954(rs ) single nucleotide polymorphisms a in chronic periodontitis patients versus healthy controls Loci/genotype Genotype counts (Frequency %) Chi-square test result IL-1A+4845 and IL-1B+3954 Periodontitis group Control group P value b GG-CC 15 (29.4) 11 (21.1) 0.33 GG-CT 1 (1.9) 4 (7.7) 0.17 GT-CC 18 (35.2) 16 (30.8) 0.63 GT-CT 13 (25.5) 19 (36.5) 0.23 TT-CC 1 (1.9) 1 (1.9) 0.99 TT-CT 2 (3.9) 1 (1.9) 0.55 TT-TT 1 (1.9) a RefSeq: NG_ and NG_ respectively, based on genomic DNA. b A P value of <0.05 is considered significant Table 9: Analysis of IL1 haplotype spanning IL-1A+4845 (rs17571) and IL-1B+3954 (rs ) single nucleotide polymorphisms a in patients with chronic periodontitis versus healthy controls Loci (1. IL-A IL-1B+3954) Haplotype Periodontitis group (Frequency) Healthy controls (Frequency) Odds ratio P value b 1-2 G-C G-T C-T T-T a RefSeq: NG_ and NG_ respectively, based on genomic DNA. b A p-value of <0.05 is considered significant more likely to have severe chronic periodontitis than individuals who were genotype negative. [16] Studies have shown that monocytes from individuals homozygous for the IL-1B allele 2 produce 4-fold more IL-1β and heterozygous cells produce approximately 2 fold more IL- 1β than cells from individuals homozygous for allele 1. A genetic susceptibility test periodontitis susceptibility test (Interleukin Genetics Inc.) was also made available on the basis of the presence of this composite genotype. The association between the IL-1 genotype and periodontitis has been confirmed in numerous other studies. [9,11,20-22,29,30] The frequency of IL-1B was found to be significantly increased in patients with advanced chronic periodontitis compared to those with early and moderate disease and also the production of IL-1β by PMNLs was seen to be increased in patients with the allele 2 of IL-1B [11] It has also been shown that non-smoking genotype positive subjects had a significantly increased chance of presenting an increased bleeding on probing percentage during SPT. [20] McDevitt et al., (2000) observed that patients who had the positive periodontitis associated genotype (PAG), had a higher risk of suffering from moderate and advanced periodontitis when compared with those having a negative genotype. [21] On the other hand, there are studies that failed to detect a significant relationship between the composite genotype and severe chronic periodontitis. [31] When periodontitis patients harboring Actinobacillus actinomycetemcomitans and /or Porphyromonas gingivalis were treated and followed up with SPT, there were no differences found in survival rates of teeth or probing attachment loss in patients who tested positive or negative for the composite genotype. It has also been observed that there is a marked inter-individual variation in the production of IL-1β by high, low, and intermediate responders, without any correlation to their IL-1 genotype status. [32] The composite genotype showed no association with failure of dental implants; increased GCF volume and bleeding on probing during development of experimental gingivitis; and on the clinical and radiographic regeneration results following guided tissue regeneration (GTR) therapy. [33-35] Various other authors have supported the hypothesis of gene-environmental interaction in the pathogenesis of periodontitis by establishing a relationship of increased severity of chronic periodontitis when the patient is a Periodontitis Associated Genotype positive smoker. [36-38] The frequency of this composite genotype has also been shown to be varied in different populations. While in the Caucasians, a prevalence of 30-40% has been reported, in others it has been shown to be much less. In the Chinese,

6 only 2.3% were positive for the composite genotype; in the Hispanics it was 23%; in a Thai population it was 1.6%. In the present study, 103 participants were recruited to provide information on the frequencies of IL-1A and IL- 1B SNPs and their combinations in an Indian population. Although there are three other reports on the role of IL-1 polymorphisms in the Indian populations, only one examines the composite genotype of IL-1A+4845 and IL- 1B+3954 polymorphisms. [26-28] The principal finding of this study was that the distribution of the IL-1 positive composite genotype (Periodontitis Associated Genotype) among all the subjects was 35%, which is in concordance with the frequencies reported in other studies. But the comparison of the prevalence of this genotype in cases (31.4%) and controls (38.5%) was not significantly different. There was also no statistically significant association between genotype status and periodontal disease presence or its severity. According to the present study, in the case group, IL-1A (1, 2) genotype was the most frequently detected at 60.8%. In the control group, IL-1A (1, 2) genotype was the most frequently detected at 67.3%. Both in cases and controls, IL- 1A (2, 2) was detected at low frequencies of 7.8% and 3.8%, respectively. For both cases and controls, IL-1A (1, 1) was detected at frequencies of 31.4% and 28.8%, respectively. In this study, in the case group, IL-1B (1, 1) genotype was more frequently detected at 66.7%. In the control group, IL-1B (1, 1) genotype was the most frequently detected at 53.8%. For cases and controls, IL-1B (1, 2) was detected at 31.4% and 46.2%, respectively. For cases and controls, IL-1B (2, 2) genotype was detected at very low frequency of 2% and 1%, respectively. The rates of detection of the various genotypes were almost numerically equal in both the cases and controls. Thereby, a correlation between genotype and disease was not obtained. Thus, the presence of a particular genotype could not, in the present study, distinguish between a control population and a group of chronic periodontitis patients. When the PAG was considered, 35% of the total population had the genotype. The PAG was positive in 31.4% of the cases and 38.5% of the controls. Risk estimate provided an odds ratio of The PAG was negative in 68.6% of cases and 61.5% of controls. The composite genotype also failed to act as a differential indicator between chronic periodontitis patients and subjects with healthy periodontium. There may be a few possible explanations for the differences in the results. The subjects may not be representative of the true disease distribution because of recruitment from a dental hospital. This phenomenon is known as the clinicians illusion, where the identified cases among the subjects are likely to be more numerous and severe than cases identified from a general representative population sample. [39] (2) The sample is very small as to provide for any generalized conclusions based on the results, that apply to the whole population. Further, in a country like India with a large number of diverse ethnicities and races, multicentre studies are warranted to solve this problem. (3) Due to the phenomenon of genetic heterogeneity, the periodontal phenotype may be due to several different genotypes. [40] (4) The clinical categorization of periodontitis has been different in different studies due to changes in classification and nomenclature. Since many risk factors contribute to periodontitis, the ideal method of studying genetic relationship would be to start before the disease sets in and following it up through the natural history, i.e., to establish the genotypes required first and then follow it up as the subject is exposed to various predisposing and risk factors. Also, as recommended, further research is needed to validate the biologic basis for genetic susceptibility testing, to evaluate the ability of IL-1 genotypes to predict disease initiation and to evaluate the effectiveness of IL-1 genotyping in making diagnostic or treatment intervention strategies. [41] ACKNOWLEDGMENTS We gratefully acknowledge financial support from ICMR towards MDS thesis work of R. Gayathri, and Technology Information Forecasting and Assessment Council Centre of Relevance and Excellence (TIFAC-CORE) in Pharmacogenomics at Manipal Life Sciences Centre, for the infrastructural support. REFERENCES 1. Offenbacher S. Periodontal diseases: Pathogenesis. Ann Periodontol 1996;1: Grossi SG, Zambon JJ, Ho AW, Koch G, Dunford RG, Machtei EE, et al. Assessment of risk for periodontal disease I. Risk indicators for attachment loss. J Periodontol 1994;65: Michalowicz BS, Aeppli DP, Kuba RK, Bereuter JE, Conry JP, Segal NL, et al. A twin study of genetic variation in proportional radiographic alveolar bone height. J Dent Res 1991;70: Michalowicz BS, Aeppli D, Virag JG, Klump DG, Hinrichs JE, Segal NL, et al. Periodontal findings in adult twins. J Periodontol 1991;62: Michalowicz BS, Diehl SR, Gunsolley JC, Sparks BS, Brooks CN, Koertge TE, et al. Evidence of a substantial genetic basis for risk of adult periodontitis. J Periodontol 2000;71: Hart TC, Kornman KS. Genetic factors in the pathogenesis of periodontitis. Periodontol ;14: Wilson AG, Symons JA, McDowell TL, McDevitt HO, Duff GW. Effects of a polymorphism in the human tumor necrosis factor α promoter on transcriptional activation. Proc Natl Acad Sci USA 1997;94: Lynch EA, Dinarello CA, Cannon JG. Gender differences in IL-1α, IL-1β and IL-1ra secretion from mononuclear cells and urinary secretion. J Immunol 1994;153: Laine ML, Farre MA, Gonzalez G, van Dijk LJ, Ham AJ, Winkel EG, et al. Polymorphisms of the interleukin-1 gene family, oral microbial pathogens, and smoking in adult periodontitis. J Dent Res 2001;80: Tatakis DN. Interleukin 1 and bone metabolism: A review. J Periodontol 1993:64: Gore EA, Sanders JJ, Pandey JP, Palesch Y, Galbraith GM. Interleukin-

7 1beta+3953 allele 2: Association with disease status in adult periodontitis. J Clin Periodontol 1998;25: Stashenko P, Fujiyoshi P, Obernesser MS, Prostak L, Haffajee AD, Socransky SS. Levels of interleukin 1 beta in tissue from sites of active periodontal disease. J Clin Periodontol 1991;18: Stashenko P, Jandinski JJ, Fujiyoshi P, Rynar J, Socransky SS. Tissue levels of bone resorptive cytokines in periodontal disease. J Periodontol 1991;62: Nicklin MJ, Weith A, Duff GW. A physical map of the region encompassing the human interleukin 1a, interleukin-1b and interleukin 1-receptor antagonist genes. Genomics 1994;19: Nothwang HG, Strahm B, Denish D, Kübler M, Schwabe J, Gingrich JC, et al. Molecular cloning of the IL-1 gene cluster: Construction of an integrated YAC/PAC contig and a partial transcriptional map in the region of chromosome 2q13. Genomics 1997;41: Kornman KS, Crane A, Wang HY, di Giovine FS, Newman MG, Pirk FW, et al. The interleukin 1 genotype as a severity factor in adult periodontal disease. J Clin Periodontol 1997;24: McGuire MK, Nunn ME. Prognosis versus actual outcome. IV. The effectiveness of clinical parameters and IL-1 genotype in accurately predicting prognoses and tooth survival. J Periodontol 1999;70: Wilson TG Jr, Nunn M. The relationship between the interleukin-1 periodontal genotype and implant loss. Initial data. J Periodontol 1999;70: De Sanctis M, Zucchelli G. Interleukin-1 gene polymorphisms and long-term stability following guided tissue regeneration therapy. J Periodontol 2000;71: Lang NP, Tonetti MS, Suter J, Sorrell J, Duff GW, Kornman KS. Effect of interleukin-1 gene polymorphisms on gingival inflammation assessed by bleeding on probing in a periodontal maintenance population. J Periodont Res 2000;35: McDevitt MJ, Wang HY, Knobelman C, Newman MG, di Giovine FS, Timms J, et al. Interleukin-1 genetic association with periodontitis in clinical practice. J Periodontol 2000;71: Cullinan MP, Westerman B, Hamlet SM, Palmer JE, Faddy MJ, Lang NP, et al. A longitudinal study of interleukin-1 gene polymorphisms and periodontal disease in a general adult population. J Clin Periodontol 2001;28: Armitage GC, Wu Y, Wang HY, Sorrell J, di Giovine FS, Duff GW. Low prevalence of a periodontitis-associated interleukin-1 composite genotype in individuals of Chinese heritage. J Periodontol 2000;71: Anusaksathien O, Sukboon A, Sitthiphong P, Teanpaisan R. Distribution of interleukin-1beta (+3954) and IL-1alpha (-889) genetic variations in a Thai population group. J Periodontol 2003;74: Caffesse RG, De La Rosa RM, De La Rosa GM, Weltman R. Effect of interleukin-1 gene polymorphism in a periodontally healthy Hispanic population treated with mucogingival surgery. J Clin Periodontol 2002;29: Kaarthikeyan G, Jayakumar ND, Padmalatha O, Sheeja V, Sankari M, Anandan B. Analysis of the association between interleukin-1beta (+3954) gene polymorphism and chronic periodontitis in a sample of the south Indian population. Indian J Dent Res 2009;20: Shete AR, Joseph R, Vijayan NN, Srinivas L, Banerjee M. Association of single nucleotide gene polymorphism at interleukin-1beta +3954, -511, and -31 in chronic periodontitis and aggressive periodontitis in Dravidian ethnicity. J Periodontol 2010;81: Agrawal AA, Kapley A, Yeltiwar RK, Purohit HJ. Assessment of single nucleotide polymorphism at IL-1A+4845 and IL-1B+3954 as genetic susceptibility test for chronic periodontitis in Maharashtrian ethnicity. J Periodontol 2006;77: Galbraith GM, Hendley TM, Sanders JJ, Palesch Y, Pandey JP. Polymorphic cytokine genotypes as markers of disease severity in adult periodontitis J Clin Periodontol 1999;26: Cattabriga M, Rotundo R, Muzzi L, Nieri M, Verrocchi G, Cairo F, et al. Retrospective evaluation of the influence of the interleukin-1 genotype on radiographic bone levels in treated periodontal patients over 10 years. J Periodontol 2001;72: Ehmke B, Kress W, Karch H, Grimm T, Klaiber B, Flemmig TF. Interleukin-1 haplotype and periodontal disease progression following therapy. J Clin Periodontol 1999;26: Mark LL, Haffajee AD, Socransky SS, Kent RL Jr, Guerrero D, Kornman K, et al. Effect of the interleukin-1 genotype on monocyte IL-1beta expression in subjects with adult periodontitis. J Periodont Res 2000;35: Rogers MA, Figliomeni L, Baluchova K, Tan AE, Davies G, Henry PJ, et al. Do interleukin-1 polymorphisms predict the development of periodontitis or the success of dental implants? J Periodont Res 2002;37: Jepsen S, Eberhard J, Fricke D, Hedderich J, Siebert R, Acil Y. Interleukin-1 gene polymorphisms and experimental gingivitis. J Clin Periodontol 2003;30: Christgau M, Aslanidis C, Felden A, Hiller KA, Schmitz G, Schmalz G. Influence of interleukin-1 gene polymorphism on periodontal regeneration in intrabony defects. J Periodont Res 2003;38: Meisel P, Siegemund A, Grimm R, Herrmann FH, John U, Schwahn C, et al. The interleukin-1 polymorphism, smoking, and the risk of periodontal disease in the population-based SHIP study. J Dent Res 2003;82: Meisel P, Siegemund A, Dombrowa S, Sawaf H, Fanghaenel J, Kocher T. Smoking and polymorphisms of the interleukin-1 gene cluster (IL- 1alpha, IL-1beta, and IL-1RN) in patients with periodontal disease. J Periodontol 2002;73: Feloutzis A, Lang NP, Tonetti MS, Bürgin W, Brägger U, Buser D, et al. IL-1 gene polymorphism and smoking as risk factors for peri-implant bone loss in a well-maintained population. Clin Oral Implants Res 2003;14: Cohen P, Cohen J. The clinician s illusion. Arch Gen Psychiatry 1984;41: Risch NJ. Searching for genetic determinants in the new millennium. Nature 2000;405: Greenstein G, Hart TC. A critical assessment of interleukin 1 (IL-1) genotyping when used in a genetic susceptibility test for severe chronic periodontitis. J Periodontol 2002;73: How to cite this article: Gayathri R, Saadi AV, Bhat KM, Bhat SG, Satyamoorthy K. Allele, genotype, and composite genotype effects of IL-1A and IL-1B polymorphisms for chronic periodontitis in an Indian population. Indian J Dent Res 2011;22:612. Source of Support: Technology Information Forecasting and Assessment Council Centre of Relevance and Excellence (TIFAC-CORE), Manipal Life Sciences Centre, Manipal University., Conflict of Interest: None declared.