Marcelo Fernandez Vina Conflict of Interest: Co-Founder Sirona Genomics
|
|
|
- Branden Day
- 6 years ago
- Views:
Transcription
1 Marcelo Fernandez Vina Conflict of Interest: Co-Founder Sirona Genomics
2 Next Generation Sequencing (NGS) and its Role in Transplantation Marcelo A. Fernández Viña, Ph.D. Professor Department of Pathology Stanford School of Medicine Stanford University 2
3 The HLA system High degree of polymorphism at most of the expressed loci (function) Lack of a single predominant allele, high degree of heterozygosity (function) Strong linkage disequilibrium (unknown, function?)
4 HLA-Class I
5
6 Organization of a class II alpha gene
7 HLA Nomenclature 2010 (field delimiters) HLA A * 24 : 02 : 01 : 01 HLA A * 24 : 02 : 01 : 02 L Expression variants Locus * Group of alleles (serotype) AA# Silent Mutations Non-coding regions
8
9 ARS Identical that are Allele Mismatches A*02:01 A*02:09 These alleles differ in regions that are not thought to affect allorecognition (one amino acid replacement at residue 236) The amino acid sequences distinguishing some alleles may be located in segments of the molecule that are not likely to elicit immune responses (cytoplasmic and trans membrane domains) Antigen Recognition Site
10 Probability of Overall Survival by HLA Matching for Early Disease Stage S u r v i v a l /8 HLA Matched (n=835) 7/8 HLA Matched (n=379) 6/8 HLA Matched (n=241) 50% 39% 28% 0.1 Log-rank p-value = < Months after transplant AUD08_14.ppt
11
12 Why not whole-genome sequencing? Inadequate coverage of complex genomic regions, such as HLA. Conventional WGS (30x avg. coverage) provides only sparse coverage of HLA. Complexities due to: Indels GC-rich regions, secondary structure Paralogous genes Repeat regions across HLA loci Cost. Using WGS, to achieve adequate coverage of HLA would require >1,000X avg. coverage
13
14 Coverage HLA coverage over WGS A B C A B C A B C A B C DRB1 DQB1 DQA1 DPB1 DPA1 Sample 1 Sample 2 Sample 3 Sample 4 Average Minimum DRB1 DQB1 DQA1 DPB1 DPA1 Average Minimum DRB1 DQB1 DQA1 DPB1 DPA1 Average Minimum DRB1 DQB1 DQA1 DPB1 DPA1 Average Minimum
15 J.Immunol Jun 15;148(12): HLA-J, a second inactivated class I HLA gene related to HLA-G and HLA-A. Implications for the evolution of the HLA-A-related genes. Messer G, Zemmour J, Orr HT, Parham P, Weiss EH, Girdlestone J. Ragoussis and co-workers described a class I HLA gene that maps to within 50 kb of HLA-A. Comparison of the nucleotide sequences of HLA-J alleles shows this gene is more related to HLA-G, A, and H. All alleles of HLA-J are pseudogenes because of deleterious mutations that produce translation termination either in exon 2 orexon 4. HLA-J appears, like HLA-H, to be an inactivated gene that result from duplication of an Ag-presenting locus related to HLA-A. Evolutionary relationships as assessed by construction of trees suggest the four modern loci: HLA-A, G, H, and J were formed by successive duplications from a common ancestral gene. In this scheme one intermediate locus gave rise to HLA-A and H, the other to HLA-G and J.
16 Alleles at different HLA loci (genes and pseudogenes) share nucleotide sequences HLA_A and HLA-H (pseudogene) AA Codon A*24:02:01:01 GGC TAC GTG GAC GAC ACG CAG TTC GTG CGG TTC GAC AGC GAC GCC GCG AGC CAG AGG ATG GAG CCG CGG GCG CCG A*01:01:01: A A*02:01:01: A*25:01: A*32:01: T H*01:01:01:01 GGC TAC GTG GAC GAT ACG CAG TTC GTG CGG TTC GAC AGC GAC GCC GCG AGC CAG AGG ATG GAG CCG CGG GCG CCG HLA-A, B and HLA-H (pseudogene) AA Codon B*57:01:01 GAG AAC CTG CGG ATC GCG CTC CGC TAC TAC AAC CAG AGC GAG GCC G B*07:02: G A- CT- -G- G B*08:01: G A- CT- -G- G B*15:17:01: B*35:01:01: G A- CT- -G- G B*44:02:01: C -C B*51:01:01: AA Codon H*01:01:01:01 GAG AAC CTG CGG ATC GCG CTC CGC TAC TAC AAC CAG AGC GAG GGC G AA Codon A*24:02:01:01 GAG AAC CTG CGG ATC GCG CTC CGC TAC TAC AAC CAG AGC GAG GCC G A*01:01:01:01 -C G-- -C- CT- -G- G A- - A*02:01:01:01 -T- G G-- -C- CT- -G- G A*25:01: G A- - A*32:01: G
17 Polymorphic nucleotide positions: two hybrid alleles
18 HLA typing using high throughput sequencing technologies. Exon-wise amplification of few exons. Whole-gene amplification. 18
19 HLA Typing by NGS Wang C, Krishnakumar S, Wilhelmy J, Babrzadeh F, Stepanyan L, Su LF, Levinson D, Fernandez-Viña MA, Davis RW, Davis MM, Mindrinos M High-throughput, high-fidelity HLA genotyping with deep sequencing. Proc Natl Acad Sci U S A. 2012May 29;109(22): doi: /pnas Epub 2012 May 15. PubMed PMID: ; PubMed Central PMCID: PMC New methodology that leverages the power of Next Generation Sequencing (NGS) and long range PCR Interrogated the entire sequences of the class I genes and most of the extent Class II genes in more than 9,000 subjects
20 Potential benefits of next-generation sequencing for HLA typing Clonal template amplification in vitro to eliminate problem of sequencing heterozygous DNA Sufficiently long read length (300+ bp) to cover entire exon (or more) in phase Increased sequence coverage of HLA genes Capability to multiplex patient specimens Potential to complete run and data analysis within one week 20
21 Practical Advantages or of Extending Test complete gene No Assumptions made Sequence Coverage Transplantation: Detect mismatches thought to be absent Mapping of Disease Susceptibility Factors
22 NGS HLA TYPING SYSTEM 7. Data analysis 1. Sample Collection 5 UTR UTR HLA-A 5 UTR UTR HLA-B 6. Sequencing 5 UTR UTR 5 UTR UTR 5 UTR UTR HLA-C HLA-DQA1 HLA-DQB1 2. Long-Range PCR Single amplification condition 5 UTR UTR HLA-DPB1 5 UTR UTR HLA-DPA1 5 UTR UTR HLA-DRB1, 3, 4, 5 5. Library preparation 3. Quantification & Pooling 4. Fragmentation
23 Applicatications of NGS in Clinical Histocompatibility Practice Identification of a novel allele that results in one mismatch Detection of null alleles (resulting from mutations in untested/uncovered areas; no a priori assumptions made) Identification of null alleles allows the identification of nonself epitopes that may be recognized as foreign Identification of mismatches: Immediate identification and characterization of novel alleles; interpretation of clinical significance if mismatched Detection of sequence variations that regulate expression levels (permissible and deleterious if alleles are mismatched)
24 Identification of Novel alleles
25 Patient and Donor are Heterozygous in all HLA loci Difference (mismatch) in one allele of HLA-A Molecules encoded in the HLA system PATIENT Molecules encoded in the HLA system DONOR Encoded in HLA-A locus (Class I) Encoded in HLA-A locus (Class I) Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 3 Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 3 The HLA-A mismatched antigen in the Donor can be recognized as foreign by the Patient s Immune System (Host versus Graft; rejection) The HLA-A mismatched antigen in the Patient can be recognized as foreign by the Donor s Immune System (Graft versus Host; GvHD and GvL)
26 S-17 SBT: B*45:01, NGS: B*45:01,B*40:02:01e1_Exon3, C to G, codon 127 ASN TO LYS.
27 S-108 SBT: DQA1*02:01, NGS: DQA1*02:01, DQA1*04:01:01i1_Ex3Var C to A substitution codon 180 His to Gln, IV1_x2_IV3_x1.
28 ARS Identical that are Allele Mismatches A*0201 A*0209 These alleles differ in regions that are not thought to affect allorecognition (one amino acid replacement at residue 236) The amino acid sequences distinguishing some alleles may be located in segments of the molecule that are not likely to elicit immune responses (cytoplasmic and trans membrane domains) Antigen Recognition Site
29 Clinical Implications of null alleles In bone marrow transplantation, assuming that a donor carries an expressed allele when in fact the allele is not expressed results in a mismatch in the graft-versus host direction Patient: A*02:01, 24:02/24:09N Donor A*02:01, 24:02/24:09N 29
30 BS-25 DQA1*05:05:01:01, Exon 3 variant, insertion of T, codon 135 (Null allele)
31 BS-25 DQA1*05:05:01:01, Exon 3 variant, insertion of T, codon 135; frame shift mutation-> PTC (DQA1*05- Null) TGA = PTC
32 Molecules encoded in the HLA system Encoded in HLA-A locus (Class I) Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 72
33 Molecules encoded in the HLA system Encoded in HLA-A locus (Class I) x Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 33
34 Molecules encoded in the HLA system Encoded in HLA-A locus (Class I) x Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 34
35 Clinical Implications of null alleles Null alleles are not expressed: e.g. a subject carrying A*02:01, A*24:09N, has a phenotype of A*02:01, - Assuming that a patient carries an expressed allele when in fact the allele is not expressed results in a mismatch in the rejection direction Patient: Donor A*02:01, 24:02/24:09N A*02:01, 24:02/24:09N 35
36 Identifying a Null allele (formerly Q ) allele and its biological relevance
37 C*16:01 C*03:04 B*08:01 B*45:01 A*02:01 A*23:01 A*24:02 A*24:03 B*15:02 B*15:13 A*68:01 B*15:01 B*15:10 A*34:02 B*51:02 A*68:02 B*15:11 A*33:03 C*07:02 B*57:01 B*35:01 B*53:01 Fluorescence Intensity A B C DRB1 DRB3 DQB DR Normalized MFI Self
38 C*16:01 C*03:04 B*08:01 B*45:01 A*02:01 A*23:01 A*24:02 A*24:03 B*15:02 B*15:13 A*68:01 B*15:01 B*15:10 A*34:02 B*51:02 A*68:02 B*15:11 A*33:03 C*07:02 B*57:01 B*35:01 B*53:01 Fluorescence Intensity A B C DRB1 DRB3 DQB1 02:KRUH DR :KKVU Normalized MFI 23:KKVU = 23:01/23:07N/23:17/23:18/23:19Q/23:20/23:23/23:26/23:30/23: 32/23:33/23:34/23:35 Self
39 C*16:01 C*03:04 B*08:01 B*45:01 A*02:01 A*23:01 A*24:02 A*24:03 B*15:02 B*15:13 A*68:01 B*15:01 B*15:10 A*34:02 B*51:02 A*68:02 B*15:11 A*33:03 C*07:02 B*57:01 B*35:01 B*53:01 Fluorescence Intensity A B C DRB1 DRB3 DQB1 DPB1 02:01 08:01 03:04 13:01 02:02P 02:01 01:01 23:19N 45:01 16:01 08:04 03:19 01: Normalized MFI Self
40 A*01:01:01 GT TCT CAC ACC ATC CAG ATA ATG TAT GGC TGC GAC GTG GGG CCG GAC GGG CGC TTC CTC CGC GGG TAC CGG CAG A*23:01: C G --- -T T AC --- A*23:19Q C G --- -T T AC --- A*01:01:01 GAC GCC TAC GAC GGC AAG GAT TAC ATC GCC CTG AAC GAG GAC CTG CGC TCT TGG ACC GCG GCG GAC ATG GCA GCT A*23:01:01 T A G --- A*23:19Q T A G --- A*01:01:01 CAG ATC ACC AAG CGC AAG TGG GAG GCG GTC CAT GCG GCG GAG CAG CGG AGA GTC TAC CTG GAG GGC CGG TGC GTG A*23:01: C C- -G- -T TT C AC A*23:19Q C C- -G- -T TT C AC A*01:01:01 GAC GGG CTC CGC AGA TAC CTG GAG AAC GGG AAG GAG ACG CTG CAG CGC ACG G A*23:01: A*23:19Q A A*23:01:01 and A*23:19N (Q) differ by one nucleotide replacement at the end of exon-3; replacement alters a splicing site, patient typed as A2, -. This data and previously reported data (13IHWS)indicate that A*23:19Q is null. A*23:19Q is now in the CWD
41 What Mutations affect and abrogate expression of HLA alleles A single nucleotide mutation that introduces a Premature Termination Codon (TAA, TAG, TGA) results in a truncated, often non functional, protein Mutations in sequences of splicing elements (intron-exon junctions) affect or fully abrogate expression of a functional protein Insertion(s)/deletion(s) in exons that change the reading frame for codons result in a non functional and/or truncated protein
42 Splicing modifications that abrogate or diminish HLA expression B* N (STOP : 5) A* L (STOP: 195) A* N (STOP : retained intron 4) B* S (soluble molecule) B* N intron 1 retention A* L use of a cryptic site located 15 nt downstream of the 5' end of exon 3 A* N intron 4 retention B* S exon 5 skipping Exon 1 AG EXON 2 EXON 3 GT G AG AG GGT AG EXON 4 GT AG Exon 5 Enh B A* L (mutation in the promoter CAT box B) B* N (del. 10 nt 17 nt upstream exon 2) A* L (G -> A 7 nt upstream exon 3) A*23N or L (G -> A) A* N (G -> T) B* S (A->G) 42
43 Exonic Insertions and Deletions: change the sequence reading frame that introduce PMT A*2311N (STOP : 60 A*6818N (STOP : 59) B*1579N (STOP : 127) A*2611N (STOP: 190) A*0104N A*2307N A*2411N B*5111N (STOP: 196) A*0243N (STOP: 264) Exon 1 EXON 2 EXON 3 EXON 4 A*2311N ins. 23 nt : 25 A*6818N ins. 20 nt : 48 B*1579N ins. 2nt : 86 A*2611N ins. CC : 150 A*0104N A*2307N A*2411N B*5111N ins. C : A*0243N ins. C :
44 Patient and Donor appear as Heterozygous and Matched at all HLA loci Molecules encoded in the HLA system PATIENT Molecules encoded in the HLA system DONOR Encoded in HLA-A locus (Class I) Encoded in HLA-A locus (Class I) Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 3 Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 3 The HLA-A mismatched antigen in the Donor can be recognized as foreign by the Patient s Immune System (Host versus Graft; rejection) The HLA-A mismatched antigen in the Patient can be recognized as foreign by the Donor s Immune System (Graft versus Host; GvHD and GvL)
45 Patient is Hemzygous in HLA-A and Donor is Heterozygous in HLA-A; One Difference (mismatch) HLA-A in the HvG direction Molecules encoded in the HLA system Encoded in HLA-A locus (Class I) PATIENT Molecules encoded in the HLA system Encoded in HLA-A locus (Class I) DONOR Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 3 Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 3 The HLA-A mismatched antigen in the Donor can be recognized as foreign by the Patient s Immune System (Host versus Graft; rejection) No mismatch in the Graft versus host direction (No Graft versus Host; No GvHD/ No GvL)
46 Typing two DRB5 alleles All reads need to be accounted Correct genotype: DRB5*01:01:01, DRB5*01:08N DRB5*01:02, 0108N DRB5*01:01:01, 01:02 DRB5*01:01:01, 01:08N DRB5*01:02/01:08N identical in exon 2, differ by 19 nt indel in exon 3 DRB5*01:01:01/01:02 identical in exon 3, differ by 3 nt substitutions in exon 2
47 Many allele groups in HLA-A show one allele with an insertion of an extra C after seven C A* AC CCC CCC.AAG ACA CAT ATG ACC CAC CAC A*0104N C A* G A --G T A* A*0321N C A* G T A*3114N C--- --G T C A* AAAACGCATATGACTCACCAC A*0321N CAAGACACATATGACCCACCA MAARMSMMWWWK A* AAGACACATATGACCCACCAC A*02null CAAAACGCATATGACTCACCA MARAMMSMWWWK
48 Resolution of common and well documented null- alleles ( clinically relevant) Locus Allele related allele Difference Change Resolution Alternative A 0104N EXON 4 ins 1 routine SBT A 0253N EXON 2 PTC routine SBT A 2409N EXON 4 PTC routine SBT A 2411N EXON 4 ins 1 routine SBT A 6811N EXON 1 del 1 ad hoc SSP B N INTRON 1 del 10 ad hoc SSP extend reading by SBT B 4022N EXON 3 PTC routine SBT B 4423N EXON 3 PTC routine SBT B 5111N EXON 4 ins 1 routine SBT Cw 0409N EXON 7 del 1 ad hoc SSP Cw 0507N EXON 3 del 2 routine SBT DRB N INTRON 1 splicing site ad hoc SSP extend reading by SBT DRB5 0108N 0102 EXON 3 del 19 ad hoc SSP DRB5 0110N 0102 EXON 2 del 2 routine SBT del = nuc. deletion ins = nuc. insertion PTC = premature termination codon Cw*0401/Cw*0409N if B*4403 is present DRB5*0102/0108N if possible haplotype is DRB1*1502-DQB1*0501
49 Detection of C*04:09N (common) and A*31:14N(rare) allele in single pass A*31:01:02 (red line) shows interrupted coverage at the beginning of Exon 4, while A*31:14N (blue line), which differs from A*31:01:02 with one base insertion, show continuous coverage. C*04:01:01:01 (red line) shows interrupted coverage at the end of Exon 7, while C*04:09N(blue line), which differs from C*04:01:01:01 with one base deletion, show continuous coverage.
50 Advantages of NGS Detecting Null Alleles is Clinically Important Current methods assume that most alleles are expressed even when only partial gene region are tested For some well-known and common null alleles, additional specialized testing is required when potentially present No ad hoc testing for rare or new null alleles. Assumptions may be wrong The NGS comprehensive approach described here can detect null alleles routinely in single pass
51 The application of NGS for Optimal Donor Selection (unrelated donors) Criteria for donor selection: Minimal number of mismatches GvH HvG Equally mismatched donors: Quality of the mismatch Permissible (C*03:03?C*03:04) DPB1 TCE-Permissive Low expression GvH target (C, DPB1)
52 Nature Genetics 41, (2009) A genome-wide association study identifies variants in the HLA-DP locus associated with chronic hepatitis B in Asians Yoichiro Kamatani, Sukanya Wattanapokayakit, Hidenori Ochi, Takahisa Kawaguchi, Atsushi Takahashi, Naoya Hosono, Michiaki Kubo, Tatsuhiko Tsunoda, Naoyuki Kamatani, Hiromitsu Kumada, Aekkachai Puseenam, Thanyachai Sura, Yataro Daigo 1, Kazuaki Chayama, Wasun Chantratita, Yusuke Nakamura & Koichi Matsuda
53 A Novel Variant Marking HLA-DP Expression Levels Predicts Recovery from Hepatitis B Virus Infection Rasmi Thomasa, Chloe L. Thio, Richard Apps,Ying Qa, Xiaojiang Gao, Darlene Marti, Judy L. Stein, Kelly A. Soderberg, M. Anthony Moody, James J. Goedert, Gregory D. Kirk, W. Keith Hoots, Steven Wolinsky and Mary Carrington Variation in the 3 untranslated region of HLA-DPB1 is associated with spontaneous clearance of hepatitis B virus in both Japanese and U.S. populations. The mechanism facilitating viral clearance may be related to the A G single-nucleotide polymorphism rs , which marks HLA-DP cellsurface expression. The rs g allele is associated with high expression of HLA-DP, and the rs a allele is associated with low expression. The 496GG genotype, which confers recessive susceptibility to HBV persistence, also associates in a recessive manner with significantly higher levels of HLA-DP surface protein and transcript level expression in healthy donors, suggesting that differences in expression of HLA-DP may increase the risk of persistent HBV infection.
54 HLA-DP surface protein levels correlate with the 496A/G genotype in the 3 UTR region of HLA- DPB1. Rasmi Thomas et al. J. Virol. 2012;86:
55 HLA-DPB1 mrna levels correlate significantly with the 496A/G variant in the 3 UTR region of HLA- DPB1. Rasmi Thomas et al. J. Virol. 2012;86:
56 DPB1 Genomic Structure, Associated DPB1 Single-Nucleotide- Polymorphism Haplotypes, and Resulting HLA-DP Expression. Fleischhauer K. N Engl J Med 2015;373:
57 High HLA-DP Expression and Graft-versus-Host Disease Effie W. Petersdorf, M.D., Mari Malkki, Ph.D., Colm O huigin, Ph.D., Mary Carrington, Ph.D., Ted Gooley, Ph.D., Michael D. Haagenson, M.S., Mary M. Horowitz, M.D., Stephen R. Spellman, M.B.S., Tao Wang, Ph.D., and Philip Stevenson, M.S. N Engl J Med 2015; 373: August 13, 2015DOI: /NEJMoa
58 The linkage of HLA-DPB1 and rs was used to assign the rs allele to the mismatched HLA-DPB1 allele in recipients and donors. rs is included in the haplotype to show that rs a haplotypes can encode either rs a or G.
59 Multivariable Models of Transplant Outcomes for rs g-linked HLA-DPB1 Mismatches Relative to rs a-linked HLA-DPB1 Mismatches in Recipients. N = 744 rs a recipients; 693 rs g recipients.
60 Hazard Ratios for Outcomes of HLA-DPB1 Mismatches in Transplant Recipients, According to the rs Allele Linked to the Mismatch. Petersdorf EW et al. N Engl J Med 2015;373:
61 Probability of Grade II, III, or IV Acute Graft-versus-Host Disease. Petersdorf EW et al. N Engl J Med 2015;373:
62 Our Work in Characterization of DP variation Cloning and Sequencing: 16 DPA1 52 DPB1
63 DPB1*02:01:04e1 L_AA DPB1*02:01:02v5 L_AA DPB1*02:01:02v6 L_AA 42 DPB1*02:01:02 L_AA DPB1*02:01:02v3 L_AA DPB1*02:01:02v7 L_AA 32 DPB1*02:02 L_AA DPB1*02:01:02v2 L_AA 49 DPB1*02:01:02v1 L_AA 68 DPB1*02:01:02v4 L_AA DPB1*04:02:01:01 L_AA 86 DPB1*04:02:01:02 L_AA DPB1*04:01:01:01v1 L_AA DPB1*04:01:31 L_AA 54 DPB1*04:01:31 L_AA DPB1*04:01:01:01v4 L_AA DPB1*04:01:01:01v5 L_AA DPB1*04:01:01:01 L_AA DPB1*04:01:01:01v3 L_AA DPB1*464:01 DPB1*04:01:01:02 L_AA DPB1*398:01 97 DPB1*30:01 DPB1*58:01e1 100 DPB1*17:01e1 L_AA 99 DPB1*17:01x1 DPB1*19:01e1 H_GA DPB1*39:01x1 DPB1*11:01:01e1 H_GA 69 DPB1*27:01e1 96 DPB1*13:01:01/DPB1*107:01e1 H_GA 94 DPB1*85:01e1 H_GA 40 DPB1*01:01:01e1 H_GA DPB1*296:01e1 98 DPB1*15:01:01e1 H_GA 99 DPB1*18:01e1 H_GA DPB1*05:01:01e1 H_GA DPB1*414:01e1 48 DPB1*463:01 DPB1*16:01:01 H_GG 64 DPB1*21:01e1 68 DPB1*06:01e1 H_GG 76 DPB1*09:01:01e1 H_GG 91 DPB1*104:01e1 74 DPB1*03:01:01 H_GG 55 DPB1*14:01:01e1 H_GG exon 2 to exon4 phylogenetic analysis rs rs HLA-DP Expression levels A A Low A G High G G High
64 42 DPB1*02:01:04e1 L_AA DPB1*02:01:02v5 L_AA DPB1*02:01:02v6 L_AA DPB1*02:01:02 L_AA Intron 2 Deletion Low DPB1*02:01:02v3 L_AA DPB1*02:01:02v7 L_AA DPB1*02:02 L_AA DPB1*02:01:02v2 L_AA DPB1*02:01:02v1 L_AA 68 DPB1*02:01:02v4 L_AA DPB1*04:02:01:01 L_AA 86 DPB1*04:02:01:02 L_AA DPB1*04:01:01:01v1 L_AA 54 DPB1*04:01:31 L_AA DPB1*04:01:31 L_AA DPB1*04:01:01:01v4 L_AA DPB1*04:01:01:01v5 L_AA 74 DPB1*04:01:01:01 L_AA DPB1*04:01:01:01v3 L_AA DPB1*464: DPB1*04:01:01:02 L_AA DPB1*398:01 97 DPB1*30:01 DPB1*58:01e1 100 DPB1*17:01e1 L_AA 99 DPB1*17:01x1 DPB1*19:01e1 H_GA DPB1*39:01x DPB1*11:01:01e1 H_GA DPB1*27:01e1 DPB1*13:01:01/DPB1*107:01e1 H_GA DPB1*85:01e1 H_GA DPB1*01:01:01e1 H_GA DPB1*296:01e DPB1*15:01:01e1 H_GA 99 DPB1*18:01e1 H_GA DPB1*05:01:01e1 H_GA DPB1*414:01e1 High 48 DPB1*463:01 DPB1*16:01:01 H_GG 64 DPB1*21:01e1 68 DPB1*06:01e1 H_GG 76 DPB1*09:01:01e1 H_GG 91 DPB1*104:01e1 74 DPB1*03:01:01 H_GG 55 DPB1*14:01:01e1 H_GG
65 Low High DPB1*02:01:04e1 L_AA DPB1*02:01:02v5 L_AA DPB1*02:01:02v6 L_AA 42 DPB1*02:01:02 L_AA DPB1*02:01:02v3 L_AA DPB1*02:01:02v7 L_AA 32 DPB1*02:02 L_AA DPB1*02:01:02v2 L_AA 49 DPB1*02:01:02v1 L_AA 68 DPB1*02:01:02v4 L_AA DPB1*04:02:01:01 L_AA 86 DPB1*04:02:01:02 L_AA DPB1*04:01:01:01v1 L_AA DPB1*04:01:31 L_AA 54 DPB1*04:01:31 L_AA DPB1*04:01:01:01v4 L_AA DPB1*04:01:01:01v5 L_AA DPB1*04:01:01:01 L_AA DPB1*04:01:01:01v3 L_AA DPB1*464:01 DPB1*04:01:01:02 L_AA DPB1*398:01 97 DPB1*30:01 DPB1*58:01e1 100 DPB1*17:01e1 L_AA 99 DPB1*17:01x1 DPB1*19:01e1 H_GA DPB1*39:01x1 DPB1*11:01:01e1 H_GA 69 DPB1*27:01e1 96 DPB1*13:01:01/DPB1*107:01e1 H_GA 94 DPB1*85:01e1 H_GA 40 DPB1*01:01:01e1 H_GA DPB1*296:01e1 98 DPB1*15:01:01e1 H_GA 99 DPB1*18:01e1 H_GA DPB1*05:01:01e1 H_GA DPB1*414:01e1 48 DPB1*463:01 DPB1*16:01:01 H_GG 64 DPB1*21:01e1 68 DPB1*06:01e1 H_GG 76 DPB1*09:01:01e1 H_GG 91 DPB1*104:01e1 74 DPB1*03:01:01 H_GG 55 DPB1*14:01:01e1 H_GG
66 E2 264 X(AAGG) E3 282 E4 111 I bp I3 F_DPB1 DPB1 Fragment E2/E4 (5.1kb) R_DPB1 Figure 1: Schematic illustration of DPB1*04:01:01:01 allele. Exons are represented by black boxes. E2 E4 Exons 2 4. I2 I3 introns 2 3 and STRs location. The numbers represent the exon length in base pairs. primers F_DPB1 and R_DPB1 were used to amplify the DPB1 fragment E2/E4.
67 STR Analysis : Short - Short DPB1* 01:01:01e1, 05:01:01e1
68 STR Analysis : Short - Long DPB1* 02:01:02, 13:01:01e1
69 STR Analysis : Long - Long DPB1* 02:01:02, 02:01:02v3
70 Clinical HLA Typing by NGS in Transplantation Extended gene sequence coverage Identification of functional variants (known and novel) Self and non-self alleles (proteins) Evaluation of antibody reactivity in light of self and non-self antigens Accurate assessment of patient-donor compatibility (match grade) Identification of expression determinants and expression variants Optimization of donor selection (Hematopoietic and Solid Organ Transplantation) Bone Marrow Registry: all loci typed at full or extended coverage Immediate identification of eligible donors or indication that no donor is available Shortened Donor Search Process Early Decisions about treatment options and alternative therapies
71 Acknowledgements Lisa Creary Konstantinos Barsakis Kalyan Mallemapati, Sridevi Gangavarapu Dolly Tyan Michael Mindrinos, Sujatha Krishnakumar, Chunlin Wang, Ming Li, Mark Davis, Ronald Davis Stanford HIDPL Sirona Genomics Immucor
Handouts. Handouts 2/11/ Thank you for joining us today
2/11/2016 Thank you for joining us today Agenda: Applications of NGS in Transplantation Marcelo A. Fernández-Viña, Ph.D. Director Histocompatibility, Immunogenetics, and Disease Profiling Laboratory Stanford
Supplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
Evaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
Supplementary Table 3. 3 UTR primer sequences. Primer sequences used to amplify and clone the 3 UTR of each indicated gene are listed.
Supplemental Figure 1. DLKI-DIO3 mirna/mrna complementarity. Complementarity between the indicated DLK1-DIO3 cluster mirnas and the UTR of SOX2, SOX9, HIF1A, ZEB1, ZEB2, STAT3 and CDH1with mirsvr and PhastCons
c Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
The Human Major Histocompatibility Complex
The Human Major Histocompatibility Complex 1 Location and Organization of the HLA Complex on Chromosome 6 NEJM 343(10):702-9 2 Inheritance of the HLA Complex Haplotype Inheritance (Family Study) 3 Structure
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 U1 inhibition causes a shift of RNA-seq reads from exons to introns. (a) Evidence for the high purity of 4-shU-labeled RNAs used for RNA-seq. HeLa cells transfected with control
Beta Thalassemia Case Study Introduction to Bioinformatics
Beta Thalassemia Case Study Sami Khuri Department of Computer Science San José State University San José, California, USA sami.khuri@sjsu.edu www.cs.sjsu.edu/faculty/khuri Outline v Hemoglobin v Alpha
Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany
HLA ISSN 2059-2302 BRIEF COMMUNICATION Detection of 549 new HLA alleles in potential stem cell donors from the United States, Poland and Germany C. J. Hernández-Frederick 1, N. Cereb 2,A.S.Giani 1, J.
a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
Supplemental Data. Shin et al. Plant Cell. (2012) /tpc YFP N
MYC YFP N PIF5 YFP C N-TIC TIC Supplemental Data. Shin et al. Plant Cell. ()..5/tpc..95 Supplemental Figure. TIC interacts with MYC in the nucleus. Bimolecular fluorescence complementation assay using
Supplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
Table S1. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9. Assay (s) Target Name Sequence (5 3 ) Comments
SUPPLEMENTAL INFORMATION 2 3 Table S. Oligonucleotides used for the in-house RT-PCR assays targeting the M, H7 or N9 genes. Assay (s) Target Name Sequence (5 3 ) Comments CDC M InfA Forward (NS), CDC M
HLA and new technologies. Vicky Van Sandt
HLA and new technologies. Vicky Van Sandt Life-threatning malignant and non malignant blood disorders can be cured by hematopoetic stem cell transplantation (HSCT). GVHD is the 2nd most prevalent cause
Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
Beta Thalassemia Sami Khuri Department of Computer Science San José State University Spring 2015
Bioinformatics in Medical Product Development SMPD 287 Three Beta Thalassemia Sami Khuri Department of Computer Science San José State University Hemoglobin Outline Anatomy of a gene Hemoglobinopathies
BIOLOGY 621 Identification of the Snorks
Name: Date: Block: BIOLOGY 621 Identification of the Snorks INTRODUCTION: In this simulation activity, you will examine the DNA sequence of a fictitious organism - the Snork. Snorks were discovered on
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at
Supplementary Figure 1. ROS induces rapid Sod1 nuclear localization in a dosagedependent manner. WT yeast cells (SZy1051) were treated with 4NQO at different concentrations for 30 min and analyzed for
Histocompatibility Evaluations for HSCT at JHMI. M. Sue Leffell, PhD. Professor of Medicine Laboratory Director
Histocompatibility Evaluations for HSCT at JHMI M. Sue Leffell, PhD Professor of Medicine Laboratory Director JHMI Patient Population Adults Peds NMDP data >20,000 HSCT JHMI HSCT Protocols Bone marrow
Completing the CIBMTR Confirmation of HLA Typing Form (Form 2005)
Completing the CIBMTR Confirmation of HLA Typing Form (Form 2005) Stephen Spellman Research Manager NMDP Scientific Services Maria Brown Scientific Services Specialist Data Management Conference 2007 1
Supplementary Figure 1 a
Supplementary Figure a Normalized expression/tbp (A.U.).6... Trip-br transcripts Trans Trans Trans b..5. Trip-br Ctrl LPS Normalized expression/tbp (A.U.) c Trip-br transcripts. adipocytes.... Trans Trans
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most
Supplementary Figure 1 MicroRNA expression in human synovial fibroblasts from different locations. MicroRNA, which were identified by RNAseq as most differentially expressed between human synovial fibroblasts
Supplementary Table 2. Conserved regulatory elements in the promoters of CD36.
Supplementary Table 1. RT-qPCR primers for CD3, PPARg and CEBP. Assay Forward Primer Reverse Primer 1A CAT TTG TGG CCT TGT GCT CTT TGA TGA GTC ACA GAA AGA ATC AAT TC 1B AGG AAA TGA ACT GAT GAG TCA CAG
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards
Toluidin-Staining of mast cells Ear tissue was fixed with Carnoy (60% ethanol, 30% chloroform, 10% acetic acid) overnight at 4 C, afterwards incubated in 100 % ethanol overnight at 4 C and embedded in
Citation for published version (APA): Oosterveer, M. H. (2009). Control of metabolic flux by nutrient sensors Groningen: s.n.
University of Groningen Control of metabolic flux by nutrient sensors Oosterveer, Maaike IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite from it.
Validation of the MIA FORA NGS FLEX Assay Using Buccal Swabs as the Sample Source
S. Krishnakumar, M. Li, C. Wang, M, Osada, R. Kuehn, M. Fukushima and Y. Thorstenson Immucor, Inc. S. Krishnakumar, M. Li, C. Wang, M, Osada, R. Kuehn, M. Fukushima and Y. Thorstenson Immucor, Inc. Introduction
Figure S1. Analysis of genomic and cdna sequences of the targeted regions in WT-KI and
Figure S1. Analysis of genomic and sequences of the targeted regions in and indicated mutant KI cells, with WT and corresponding mutant sequences underlined. (A) cells; (B) K21E-KI cells; (C) D33A-KI cells;
Integration Solutions
Integration Solutions (1) a) With no active glycosyltransferase of either type, an ii individual would not be able to add any sugars to the O form of the lipopolysaccharide. Thus, the only lipopolysaccharide
*To whom correspondence should be addressed. This PDF file includes:
www.sciencemag.org/cgi/content/full/science.1212182/dc1 Supporting Online Material for Partial Retraction to Detection of an Infectious Retrovirus, XMRV, in Blood Cells of Patients with Chronic Fatigue
The Major Histocompatibility Complex of Genes
The Major Histocompatibility Complex of Genes Topic 4 The Major Histocompatibility Complex Outline of Lectures The immunological reasons for transplant rejection How the MHC was discovered using inbred
Characterizing intra-host influenza virus populations to predict emergence
Characterizing intra-host influenza virus populations to predict emergence June 12, 2012 Forum on Microbial Threats Washington, DC Elodie Ghedin Center for Vaccine Research Dept. Computational & Systems
Supplementary Materials
Supplementary Materials 1 Supplementary Table 1. List of primers used for quantitative PCR analysis. Gene name Gene symbol Accession IDs Sequence range Product Primer sequences size (bp) β-actin Actb gi
www.lessonplansinc.com Topic: Protein Synthesis - Sentence Activity Summary: Students will simulate transcription and translation by building a sentence/polypeptide from words/amino acids. Goals & Objectives:
Bacterial Gene Finding CMSC 423
Bacterial Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would
HLA Mismatches. Professor Steven GE Marsh. Anthony Nolan Research Institute EBMT Anthony Nolan Research Institute
HLA Mismatches Professor Steven GE Marsh HLA Mismatches HLA Genes, Structure, Polymorphism HLA Nomenclature HLA Mismatches in HSCT Defining a mismatch HLA Mismatches HLA Genes, Structure, Polymorphism
CD31 5'-AGA GAC GGT CTT GTC GCA GT-3' 5 ' -TAC TGG GCT TCG AGA GCA GT-3'
Table S1. The primer sets used for real-time RT-PCR analysis. Gene Forward Reverse VEGF PDGFB TGF-β MCP-1 5'-GTT GCA GCA TGA ATC TGA GG-3' 5'-GGA GAC TCT TCG AGG AGC ACT T-3' 5'-GAA TCA GGC ATC GAG AGA
Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients
Mutation Screening and Association Studies of the Human UCP 3 Gene in Normoglycemic and NIDDM Morbidly Obese Patients Shuichi OTABE, Karine CLEMENT, Séverine DUBOIS, Frederic LEPRETRE, Veronique PELLOUX,
What do you think of when you here the word genome?
What do you think of when you here the word genome? What do you think of when you here the word genome? Personal Genomics Outline Review of pre-lab work Genomics and Medicine Case Overview & Assignment
Culture Density (OD600) 0.1. Culture Density (OD600) Culture Density (OD600) Culture Density (OD600) Culture Density (OD600)
A. B. C. D. E. PA JSRI JSRI 2 PA DSAM DSAM 2 DSAM 3 PA LNAP LNAP 2 LNAP 3 PAO Fcor Fcor 2 Fcor 3 PAO Wtho Wtho 2 Wtho 3 Wtho 4 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB Low Iron 2 4 6 8 2 4 6 8 2 22 DTSB
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature05883 SUPPLEMENTARY INFORMATION Supplemental Figure 1 Prostaglandin agonists and antagonists alter runx1/cmyb expression. a-e, Embryos were exposed to (b) PGE2 and (c) PGI2 (20μM) and
Supplementary Figures
Supplementary Figures Supplementary Figure 1. H3F3B expression in lung cancer. a. Comparison of H3F3B expression in relapsed and non-relapsed lung cancer patients. b. Prognosis of two groups of lung cancer
21/05/2018. Continuing Education. Presentation Recording. learn.immucor.com
Transplant Webinar Series: Ep. 6 Donor Selection for Haematopoietic Stem Cell Transplantation Future Webinars The Role of NGS in the Transplant Setting Featuring Dr Sujatha Krishnakumar Sirona Genomics,
Nature Immunology: doi: /ni.3836
Supplementary Figure 1 Recombinant LIGHT-VTP induces pericyte contractility and endothelial cell activation. (a) Western blot showing purification steps for full length murine LIGHT-VTP (CGKRK) protein:
Relationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia
elationship of the APOA5/A4/C3/A1 gene cluster and APOB gene polymorphisms with dyslipidemia H.J. Ou 1, G. Huang 2, W. Liu 3, X.L. Ma 2, Y. Wei 4, T. Zhou 5 and Z.M. Pan 3 1 Department of Neurology, The
A smart acid nanosystem for ultrasensitive. live cell mrna imaging by the target-triggered intracellular self-assembly
Electronic Supplementary Material (ESI) for Chemical Science. This journal is The Royal Society of Chemistry 2017 A smart ZnO@polydopamine-nucleic acid nanosystem for ultrasensitive live cell mrna imaging
Astaxanthin prevents and reverses diet-induced insulin resistance and. steatohepatitis in mice: A comparison with vitamin E
Supplementary Information Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with vitamin E Yinhua Ni, 1,2 Mayumi Nagashimada, 1 Fen Zhuge, 1 Lili
New trends in donor selection in Europe: "best match" versus haploidentical. Prof Jakob R Passweg
New trends in donor selection in Europe: "best match" versus haploidentical Prof Jakob R Passweg HSCT change in donor type: 1990-2015 9000 H S C T 8000 7000 6000 5000 4000 HLA identical sibling/twin Haplo-identical
Nucleotide diversity of the TNF gene region in an African village
(2001) 2, 343 348 2001 Nature Publishing Group All rights reserved 1466-4879/01 $15.00 www.nature.com/gene Nucleotide diversity of the TNF gene region in an African village A Richardson 1, F Sisay-Joof
Inge H.M. van Loo Kees J. Heuvelman Audrey J. King Frits R. Mooi. Journal of Clinical Microbiology accepted
Multi-locus sequence typing of Bordetella pertussis based on surface proteins: Identification of epidemic types? Inge H.M. van Loo Kees J. Heuvelman Audrey J. King Frits R. Mooi Journal of Clinical Microbiology
Supplementary Figure 1a
Supplementary Figure 1a Hours: E-cadherin TGF-β On TGF-β Off 0 12 24 36 48 24 48 72 Vimentin βactin Fig. S1a. Treatment of AML12 cells with TGF-β induces EMT. Treatment of AML12 cells with TGF-β results
DEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS
DEFINITIONS OF HISTOCOMPATIBILITY TYPING TERMS The definitions below are intended as general concepts. There will be exceptions to these general definitions. These definitions do not imply any specific
Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10
J. gen. Virol. (1988), 69, 945-949. Printed in Great Britain 945 Key words: BTV/genome segment lo/nucleotide sequence Nucleotide Sequence of the Australian Bluetongue Virus Serotype 1 RNA Segment 10 By
The Major Histocompatibility Complex (MHC)
Advanced molecular immunology-2011 The Major Histocompatibility Complex (MHC) Youmin Kang 2011.04.06 Activation IFN-g IL-4 IL-2 YYYYYY YYYYY B cells MHC class II pathway Discovery of MHC MHC Class I pathway
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1. Lats1/2 deleted ihbs and ihps showed decreased transcripts of hepatocyte related genes (a and b) Western blots (a) and recombination PCR (b) of control and
Lezione 10. Sommario. Bioinformatica. Lezione 10: Sintesi proteica Synthesis of proteins Central dogma: DNA makes RNA makes proteins Genetic code
Lezione 10 Bioinformatica Mauro Ceccanti e Alberto Paoluzzi Lezione 10: Sintesi proteica Synthesis of proteins Dip. Informatica e Automazione Università Roma Tre Dip. Medicina Clinica Università La Sapienza
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Cryopreservation alters CD62L expression by CD4 T cells. Freshly isolated (left) or cryopreserved PBMCs (right) were stained with the mix of antibodies described
Significance of the MHC
CHAPTER 7 Major Histocompatibility Complex (MHC) What is is MHC? HLA H-2 Minor histocompatibility antigens Peter Gorer & George Sneell (1940) Significance of the MHC role in immune response role in organ
Supplemental Information. Cancer-Associated Fibroblasts Neutralize. the Anti-tumor Effect of CSF1 Receptor Blockade
Cancer Cell, Volume 32 Supplemental Information Cancer-Associated Fibroblasts Neutralize the Anti-tumor Effect of CSF1 Receptor Blockade by Inducing PMN-MDSC Infiltration of Tumors Vinit Kumar, Laxminarasimha
Cross-talk between mineralocorticoid and angiotensin II signaling for cardiac
ONLINE SUPPLEMENT TO Crosstalk between mineralocorticoid and angiotensin II signaling for cardiac remodeling An Di ZHANG,,3, Aurelie NGUYEN DINH CAT*,,3, Christelle SOUKASEUM *,,3, Brigitte ESCOUBET, 4,
FONS Nové sekvenační technologie vklinickédiagnostice?
FONS 2010 Nové sekvenační technologie vklinickédiagnostice? Sekvenování amplikonů Sequence capture Celogenomové sekvenování FONS 2010 Sekvenování amplikonů Amplicon sequencing - amplicon sequencing enables
Supplementary Figure 1
Metastatic melanoma Primary melanoma Healthy human skin Supplementary Figure 1 CD22 IgG4 Supplementary Figure 1: Immunohisochemical analysis of CD22+ (left) and IgG4 (right), cells (shown in red and indicated
Frequency of mosaicism points towards mutation prone early cleavage cell divisions.
Frequency of mosaicism points towards mutation prone early cleavage cell divisions. Chad Harland, Wouter Coppieters, Latifa Karim, Carole Charlier, Michel Georges Germ-line de novo mutations Definition:
TRANSLATION: 3 Stages to translation, can you guess what they are?
TRANSLATION: Translation: is the process by which a ribosome interprets a genetic message on mrna to place amino acids in a specific sequence in order to synthesize polypeptide. 3 Stages to translation,
SUPPORTING INFORMATION
SUPPORTING INFORMATION Biology is different in small volumes: endogenous signals shape phenotype of primary hepatocytes cultured in microfluidic channels Amranul Haque, Pantea Gheibi, Yandong Gao, Elena
Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast
Supplemental Figures, Tables and Results Single-Molecule Analysis of Gene Expression Using Two-Color RNA- Labeling in Live Yeast Sami Hocine 1, Pascal Raymond 2, Daniel Zenklusen 2, Jeffrey A. Chao 1 &
Cancer Genetics 204 (2011) 45e52
Cancer Genetics 204 (2011) 45e52 Exon scanning by reverse transcriptaseepolymerase chain reaction for detection of known and novel EML4eALK fusion variants in nonesmall cell lung cancer Heather R. Sanders
Supplementary Figure 1
Supplementary Figure 1 3 3 3 1 1 Bregma -1.6mm 3 : Bregma Ref) Http://www.mbl.org/atlas165/atlas165_start.html Bregma -.18mm Supplementary Figure 1 Schematic representation of the utilized brain slice
Supporting Information
Supporting Information Malapeira et al. 10.1073/pnas.1217022110 SI Materials and Methods Plant Material and Growth Conditions. A. thaliana seedlings were stratified at 4 C in the dark for 3 d on Murashige
Basel - 6 September J.-M. Tiercy National Reference Laboratory for Histocompatibility (LNRH) University Hospital Geneva
Basel - 6 eptember 2012 J.-M. Tiercy National Reference Laboratory for Histocompatibility (LNRH) University Hospital Geneva Outline the HLA system is (a) complex anti-hla immunisation and alloreactivity
Documentation of Changes to EFI Standards: v 5.6.1
Modified Standard B - PERSONNEL QUALIFICATIONS B1.000 The laboratory must employ one or more individuals who meet the qualifications and fulfil the responsibilities of the Director/Co-Director, Technical
Human Leukocyte Antigens and donor selection
Human Leukocyte Antigens and donor selection Duangtawan Thammanichanond, MD. PhD. Histocompatibility and Immunogenetics Laboratory, Faculty of Medicine Ramathibodi Hospital, Mahidol University Outline
Baseline clinical characteristics for the 81 CMML patients Routine diagnostic testing and statistical analyses... 3
Next-Generation Sequencing Technology Reveals a Characteristic Pattern of Molecular Mutations in 72.8% of Chronic Myelomonocytic Leukemia (CMML) by Detecting Frequent Alterations in TET2, CBL, RAS, and
MATCHMAKER, MATCHMAKER, MAKE ME A MATCH, FIND ME A MISMATCHED TRANSPLANT TO CATCH
MATCHMAKER, MATCHMAKER, MAKE ME A MATCH, FIND ME A MISMATCHED TRANSPLANT TO CATCH TEJASWINI M. DHAWALE, M.D. HEME FELLOWS CONFERENCE NOVEMBER 08, 2013 CASE PRESENTATION 51 yo M with history of MDS (unilinear
TetR repressor-based bioreporters for the detection of doxycycline using Escherichia
Supplementary materials TetR repressor-based bioreporters for the detection of doxycycline using Escherichia coli and Acinetobacter oleivorans Hyerim Hong and Woojun Park * Department of Environmental
Patterns of hemagglutinin evolution and the epidemiology of influenza
2 8 US Annual Mortality Rate All causes Infectious Disease Patterns of hemagglutinin evolution and the epidemiology of influenza DIMACS Working Group on Genetics and Evolution of Pathogens, 25 Nov 3 Deaths
Supplemental Information. Th17 Lymphocytes Induce Neuronal. Cell Death in a Human ipsc-based. Model of Parkinson's Disease
Cell Stem Cell, Volume 23 Supplemental Information Th17 Lymphocytes Induce Neuronal Cell Death in a Human ipsc-based Model of Parkinson's Disease Annika Sommer, Franz Maxreiter, Florian Krach, Tanja Fadler,
SUPPLEMENTAL FIGURE 1
SUPPLEMENTL FIGURE 1 C Supplemental Figure 1. pproach for removal of snorns from Rpl13a gene. () Wild type Rpl13a exonintron structure is shown, with exo in black and intronic snorns in red rectangles.
HLA-A * L
What is Nomenclature? HLA Nomenclature 3.0 Signifies DNA Subtype Differences outside the coding region (introns) HLA-A * 4 0 01 0 L Steve Spellman Sr. Manager, NMDP Asst. Scientific Director, CIBMTR Locus
Mina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia
Mina John Institute for Immunology and Infectious Diseases Royal Perth Hospital & Murdoch University Perth, Australia AIDSvaccine conference, 14 th September 2011 IMGT HLA database July 2011 >5000 class
Mechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis SUPPLEMENTARY INFORMATION
Mechanistic and functional insights into fatty acid activation in Mycobacterium tuberculosis Pooja Arora 1, Aneesh Goyal 2, Vivek T atarajan 1, Eerappa Rajakumara 2, Priyanka Verma 1, Radhika Gupta 3,
Loyer, et al. microrna-21 contributes to NASH Suppl 1/15
Loyer, et al. microrna-21 contributes to NASH Suppl 1/15 SUPPLEMENTARY MATERIAL: Liver MicroRNA-21 is Overexpressed in Non Alcoholic Steatohepatitis and Contributes to the Disease in Experimental Models
HLA and more. Ilias I.N. Doxiadis. Geneva 03/04/2012.
www.ebmt.org HLA and more Ilias I.N. Doxiadis Geneva 03/04/2012 HLA and more HLA and more / Doxiadis 2 Topic of the day Compatibility testing is a type of testing used to ensure compatibility of the system/application/website
Mutation analysis of a Chinese family with oculocutaneous albinism
/, 2016, Vol. 7, (No. 51), pp: 84981-84988 Mutation analysis of a Chinese family with oculocutaneous albinism Xiong Wang 1, Yaowu Zhu 1, Na Shen 1, Jing Peng 1, Chunyu Wang 1, Haiyi Liu 2, Yanjun Lu 1
Chapter 12-4 DNA Mutations Notes
Chapter 12-4 DNA Mutations Notes I. Mutations Introduction A. Definition: Changes in the DNA sequence that affect genetic information B. Mutagen= physical or chemical agent that interacts with DNA to cause
A basic helix loop helix transcription factor controls cell growth
A basic helix loop helix transcription factor controls cell growth and size in root hairs Keke Yi 1,2, Benoît Menand 1,3, Elizabeth Bell 1, Liam Dolan 1,4 Supplementary note Low soil phosphate availability
Supplementary Information. Bamboo shoot fiber prevents obesity in mice by. modulating the gut microbiota
Supplementary Information Bamboo shoot fiber prevents obesity in mice by modulating the gut microbiota Xiufen Li 1,2, Juan Guo 1, Kailong Ji 1,2, and Ping Zhang 1,* 1 Key Laboratory of Tropical Plant Resources
SUPPLEMENTARY INFORMATION
BASELINE ISCHAEMIA a b Phd2 +/- c d Collateral growth and maintenance SMC recruitment SMC proliferation Phd2 +/- NF- B off NF- B on NF- B on NF- B on Endothelial cell Smooth muscle cell Pro-arteriogenic
CIRCRESAHA/2004/098145/R1 - ONLINE 1. Validation by Semi-quantitative Real-Time Reverse Transcription PCR
CIRCRESAHA/2004/098145/R1 - ONLINE 1 Expanded Materials and Methods Validation by Semi-quantitative Real-Time Reverse Transcription PCR Expression patterns of 13 genes (Online Table 2), selected with respect
Cover Page. The handle holds various files of this Leiden University dissertation.
Cover Page The handle http://hdl.handle.net/1887/20898 holds various files of this Leiden University dissertation. Author: Jöris, Monique Maria Title: Challenges in unrelated hematopoietic stem cell transplantation.
Role of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT
Role of NMDP Repository in the Evolution of HLA Matching and Typing for Unrelated Donor HCT Stephen Spellman, MBS Director, Immunobiology and Observational Research Assistant Scientific Director CIBMTR,
Impatto clinico nel trapianto allogenico da donatori non familiari dei mismatch al locus HLA-DPB1
Impatto clinico nel trapianto allogenico da donatori non familiari dei mismatch al locus HLA-DPB1 Gruppo Italiano Trapianto Midollo Osseo Italian Bone Marrow Donor Registry Immunogenetics and HSCT Units
Advanced Subsidiary Unit 1: Lifestyle, Transport, Genes and Health
Write your name here Surname Other names Edexcel GCE Centre Number Candidate Number Biology Advanced Subsidiary Unit 1: Lifestyle, Transport, Genes and Health Thursday 8 January 2009 Morning Time: 1 hour
EBMT2008_1_21:EBMT :06 Pagina 46 * CHAPTER 3. Immunogenetics of allogeneic HSCT * 3.1. The role of HLA in HSCT. J.M.
EBMT2008_1_21:EBMT2008 6-11-2008 9:06 Pagina 46 * CHAPTER 3 Immunogenetics of allogeneic HSCT * 3.1 The role of HLA in HSCT J.M. Tiercy EBMT2008_1_21:EBMT2008 6-11-2008 9:06 Pagina 47 CHAPTER 3.1 HLA and
RESEARCH COMMUNICATION. Genotype Frequencies of Cyclooxygenease 2 (COX2) Rare Polymorphisms for Japanese with and without Colorectal Cancer
COX2 Rare Polymorphisms and Colorectal Cancer RESEARCH COMMUNICATION Genotype Frequencies of Cyclooxygenease 2 (COX2) Rare Polymorphisms for Japanese with and without Colorectal Cancer Nobuyuki Hamajima
Variant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
Nomenclature What is in a name? My name Joseˊ Jimenez = Bill Dana John L.C. Savony = Frank Fontaine
Nomenclature What is in a name? My name Joseˊ Jimenez = Bill Dana John L.C. Savony = Frank Fontaine Three categories of Amyloid Terms 1. Amyloidologists, Amyloid Centers, Researchers official nomenclature
The MHC and Transplantation Brendan Clark. Transplant Immunology, St James s University Hospital, Leeds, UK
The MHC and Transplantation Brendan Clark Transplant Immunology, St James s University Hospital, Leeds, UK Blood Groups Immunofluorescent staining has revealed blood group substance in the cell membranes
25/10/2017. Clinical Relevance of the HLA System in Blood Transfusion. Outline of talk. Major Histocompatibility Complex
Clinical Relevance of the HLA System in Blood Transfusion Dr Colin J Brown PhD FRCPath. October 2017 Outline of talk HLA genes, structure and function HLA and immune complications of transfusion TA-GVHD