3. Blood Cell Histograms:
|
|
- Barnard Shaw
- 6 years ago
- Views:
Transcription
1 LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative number or frequency 2) distributions given for Plts., WBCs, and RBCs b. Distributions are plotted as histograms on a x- y plotter or matrix printer c. Cells in the WBC counting baths larger than 45 fl are counted and plotted as WBCs 1) The WBC histogram results in 3 distribution peaks - a) The 1st peak (45 to 90 fl) represents the lymphocytes b) The 2nd peak from 90 to 160 fl represents the mononuclear cell population i. this a minor population and normally represents the monocytes, but can also represent abnormal cell types such as the immature precursor cell types found in leukemia c) The major population and peak begins at 160 and ends about 450 fl. This population is more spread out an represents normal mature types of granulocytes 1
2 2) The percent of each cell type is calculated combining the distribution values and the total WBC distribution spread 3) The latest models can give a five part differential; %Lymphs, %Monos, %Gran %Eos %Baso 4) An absolute count of each cell fraction is also given: % cells X total WBC count 5) These estimations are often useful as a screening test or as a check on WBC differentials - instruments are surprisingly accurate when compared with the slide diff d. Cells in the RBC counting baths in the size range of 36 to 360 fl are counted and frequency is plotted on the histogram RBC scale 1) normal single peak between fl 2) peak should coincide with the MCV e. Cells in the RBC counting baths in the size range between 2 to 20 fl are counted and frequency is plotted on the histogram platelet scale 9. Explain the principle of blood cell histograms and the individual populations of blood cells reported. 2
3 Normal Blood cell Histogram 10. Diagram a normal blood cell histogram. f. Abnormal WBC Histogram patterns: 1) The lower threshold is 45 fl, but the histogram will extend lower to pick up abnormalities 2) Error Flags: a) "R" ags signal irregularities in the WBC distribution, and will next to the differential parameters. The "R" stands for the region, and the following numeral indicates the location in which the interference was detected i. R1: interference in the valley to the left of the lymphocyte peak ( 35 fl) - CAUSES - Sickled RBCs, nucleated RBCs, or clumped or giant platelets will appear in this area and artificially raise the WBC ct. 3
4 R1 WBC 75.2 LY% 75.2 MO% 9.6 GR% 15.2 LY# 2.9 MO# 0.4 GR# 0.6 * Normal Abnormal ii. R2: excessive overlap of cell populations at the lymphocyte/mononuclear cell boundary ( 90fL) CAUSES- presence of abnormal cell types such as atypical lymphs, blasts, or plasma cells R2 * Normal Abnormal iii. R3: excessive overlap of cell populations at the mononuclear/ granulocyte boundary ( 160 fl) CAUSES; increased presence of more immature granulocytes (bands), referred to as a maturation SHIFT TO THE LEFT R3 * Normal Abnormal 4
5 iv. R4: extension of the cell distribution at the upper end of the WBC threshold ( 450 fl) CAUSE; most commonly when the granulocyte population is very high R4 * Normal Abnormal b) Other signal ags: i. H: value is greater than the present high normal limit ii. L: value is lower than the present low normal limit 11. Compare and contrast the different WBC channel R" signal ags and the meaning of each. g. Abnormal RBC Histograms: 1) The normal RBC histogram reects normal MCV as-well-as normal RDW a) A normal distribution begins above 50 fl and will peak between fl 5
6 NORMAL RBC HISTOGRAM Toe b) The extended distribution called the toe is normal, and represents duplicates, triplicates, agglutinated RBCs, aperture artifacts, and a occasional WBC 2) An increased MCV will shift the curve to the right, and a decreased MCV will shift the curve to the left. An increase in RDW will be reected by an increase in the "width" of the area beneath the curve. NORMAL ABNORMAL MCV: 105 RDW: ) In some disorders there may be two size populations of RBCs, i.e.. a microcytic population and a macrocytic population of cells. The RBC histogram will reect this abnormality. NORMAL ABNORMAL
7 h. Atypical Platelet Histograms: 1) Can result in some disorders due to the presence of large platelets Examine a RBC channel histogram and a platelet histogram and judge weather the histogram pattern is normal or abnormal. 4. X-BAR B (X B ) STATISTICAL ANALYSIS: a. BACKGROUND: Research has shown that RBC indices (MCV, MCH, and MCHC) of patient populations are stable over time. - This stability is the basis of a hematology Q.C. technique known as X B analysis. b. FUNCTION: To quickly determine the direction and amount of change, daily, due to the instrument, the reagents, or sample handling. c. HOW IT WORKS: 1) "Target" values of MCV, MCH, and MCHC are determined by calculating the mean of 250 to 1000 samples for each parameter. 2) Once target values are determined, the analysis can be applied using small sample "batches" of 20 samples. 3) The mean and standard deviation of each batch is compared to the target value of each parameter, and averaged in with the mean and standard deviation of the previous batches. 7
8 d. The hematology system is considered "in control" when the batch means are within established standard deviation limits of the target values. e. The %-difference between each batch mean and its corresponding preset target value can be calculated and displayed on a Levy-Jennings graph. Formula for X-Bar-B THE END 8
DR SUDHIR MEHTA MD,MNAMS,FICP. Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur
DR SUDHIR MEHTA MD,MNAMS,FICP Senior Professor & Head Medical Unit SMS Medical College & Hospital Jaipur s.smehta@hotmail.com CBC..What is the Utility of performing this basic Hematology Test? 10/31/2010
More informationFull Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa
Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory
More informationCELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented M.A.P.S.S. Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
More informationHematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist
Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationCELL-DYN 3700 Strength in Technology, Proven Reliability
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
More informationDetection of important abnormalities of the differential
J Clin Pathol 1989;42:772-776 Detection of important abnormalities of the differential count using the Coulter STKR blood counter D F BARNARD, S A BARNARD, A B CARTER, S J MACHN, K G PATTERSON, A YARDUMAN
More informationA Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL
More informationInterpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired
Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make
More informationGuide to the 1-3 Minute Blood Film Microscopic Review: Why and How?
Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary
More information10/30/2015. XN Case Studies: Every Picture Tells a Story
XN Case Studies: Every Picture Tells a Story Jill Crist MT(ASCP)Field Product Specialist OBJECTIVES Explain how scattergrams and histogram pictures can provide great insight into abnormal hematology samples
More informationThe LaboratoryMatters
Laboratory Medicine Newsletter for clinicians, pathologists & clinical laboratory technologists. A Initiative. Complete Blood Count This issue highlights: CBC, while ubiquitous, is an excellent diagnostic
More informationInterpreting Hematology Scatter-Plots; One Cancer Center s Keys to Seeing the BIG Picture
Interpreting Hematology Scatter-Plots; One Cancer Center s Keys to Seeing the BIG Picture Barbara L. Burch, MHA MT (ASCP) Laboratory Manager New York University Clinical Cancer Center Disclosure Ms Burch
More informationNOTE: This table will be discontinued after this lot.
AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationEvaluation of Coulter S-Plus Three-part Differential in Population with a High Prevalence of Abnormalities
Evaluation of Coulter S-Plus Three-part Differential in Population with a High Prevalence of Abnormalities JOANNE CORNBLEET, M.D. AND SALLY KESSINGER, MT(ASCP)SH The authors evaluated the Coulter 15 S-Plus
More informationXN-SERIES. XN Technology and Case Studies
XN Technology and Case Studies Karen Hoffman MT(ASCP) Clinical Applications Specialist OBJECTIVES Explain how scattergrams and histogram pictures can provide great insight into abnormal hematology samples
More informationComplete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
More informationEDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION
EDUCATIONAL COMMENTARY BLOOD CELL IDENTIFICATION Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE credits click
More informationDifferential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2015-4 MQ, Institut für
More informationNEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016
NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016 Results from this proficiency test event are available at: http://www.wadsworth.org/regulatory/clep/pt/summaries SLIDE
More informationBeyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure
Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure I am receiving an honorarium from Sysmex for today s presentation. 1 Determining the Etiology for
More informationKathleen Finnegan MS MT(ASCP)SHCM
Kathleen Finnegan MS MT(ASCP)SHCM Discuss the history of hematology automation and digital differentials. Discuss the HemoFAXS Hematology Analysis System by Tissue Gnostics. Review automated microscopy
More informationEvaluation of the Abbott CELL-DYN 4000 Hematology Analyzer
Hematopathology / EVALUATION OF THE ABBOTT CELL-DYN 4 HEMATOLOGY ANALYZER Evaluation of the Abbott CELL-DYN 4 Hematology Analyzer Ernesto Grimaldi, MD, and Francesco Scopacasa, PhD Key Words: Abbott CD
More informationBrief Communication Diagnostic Hematology
Brief Communication Diagnostic Hematology Ann Lab Med 2016;36:244-249 http://dx.doi.org/10.3343/alm.2016.36.3.244 ISSN 2234-3806 eissn 2234-3814 Establishment of Age- and Gender-Specific Reference Ranges
More informationProper Slide Preparation
Hematology Essentials: A Foundation for WBC Review Using Case Studies Christine Hinz, MS, MLS(ASCP) CM Proper Slide Preparation smooth, homogenous film 1/2 to 3/4 the slide length straight feather edge
More informationContinuing Education Questions
FOCUS: INTERPRETING THE COMPLETE BLOOD COUNT Continuing Education Questions SUMMER 2017 1. A methodical approach to CBC interpretation that is aimed at medical laboratory professionals differs from one
More informationClinical use of flow cytometry
Clinical use of flow cytometry Diagnosis of leukemia Combined use of intracellular staining and a cell surface marker Detection of stem cells CD34+ stem cells Monitoring of stem cell count following
More informationAutomated Hematology Analyzer. Differentiate with the XT-4000i
XT-4000i Automated Hematology Analyzer Differentiate with the XT-4000i Advanced Technology Solutions to Meet Your Lab s Needs Even with these challenges, the need for hematology testing has remained steady
More informationXN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016
XN series Case interpretation Gebruikersdag Vlaanderen- 6 oktober 2016 Fluorescence flow cytometry RET channel PLT-F channel WDF channel WPC channel WNR channel Case 1 Case 1: Initial measurement Patient
More informationStudy of RBC histograms in various anemias: A six months prospective study
Original Article Study of RBC histograms in various anemias: A six months prospective study Shifa Maqsood 1, A Sharadrutha 2 1 Second year Postgraduate student, 2 Professor, Department of Pathology, Prathima
More informationScoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens
Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated
More informationPrecision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100
Precision and Accuracy of the Leukocyte Differential on the Sysmex XE-2100 R. HERKLOTZ and A. R. HUBER Zentrum für Labormedizin, Kantonsspital Aarau, 5001 Aarau, Switzerland. The automated leukocyte(wbc)
More informationSysmex Journal International Vol.9 No.2 (1999)
Sysmex Journal International Vol.9 No. (999) Evaluation and Clinical Usefulness of the Automated Hematology Analyzer, Sysmex XE- TM Kazuto TSURUDA, Tomohiro TSUJI, Tetsuya USUI, Sachiko KITAJIMA, Atsuko
More informationXN-SERIES. Hematology Case Studies: Every Picture Tells a Story
Hematology Case Studies: Every Picture Tells a Story Jill Crist MT(ASCP)Field Product Specialist OBJECTIVES Explain how scattergrams and histogram pictures can provide great insight into abnormal hematology
More informationLavender Top Management SUCCESS BEYOND FINANCES
Lavender Top Management Alfonso Ziccardi Ass.Lab.Operation Manager for AP/CP/Safety Officer New York Hospital Medical Center of Queens SUCCESS BEYOND FINANCES 1 . VISION Mission/ Vision To successfully
More informationJKMU. Introduction. Original article. Oxidative stress Total antioxidant capacity Hematological parameters Diabetes Rosa canina Mice
JKMU Journal of Kerman University of Medical Sciences, 2017; 24(2): 132-140 The Effects of Fruit Hydro alcoholic Extract on Oxidative Stress, Total Antioxidant Capacity and Haematological Parameters in
More informationHematopathology Case Study
www.medfusionservices.com Hematopathology Case Study CV3515-14 JUNE Clinical Presentation: Clinical Information: A 42 year old male with history of chronic myelogenous leukemia (CML) presents with an elevated
More informationINFECTION/ INFLAMMATION
HAEMATOLOGY OCTOBER 2017* WHITE PAPER INFECTION/ INFLAMMATION Novel haematological parameters for rapidly monitoring the immune system response Patients with inflammatory disease are common on hospital
More informationBlood Cell Identification Graded
BCP-21 Blood Cell Identification Graded Case History The patient is a 37-year-old female with a history of multiple sickle cell crises. She now presents with avascular necrosis of the left hip. Laboratory
More informationADx Bone Marrow Report. Patient Information Referring Physician Specimen Information
ADx Bone Marrow Report Patient Information Referring Physician Specimen Information Patient Name: Specimen: Bone Marrow Site: Left iliac Physician: Accession #: ID#: Reported: 08/19/2014 - CHRONIC MYELOGENOUS
More informationStandard Operating Procedure
Subject Differential: Counting and Morphology Index Number Lab-5074 Section Laboratory Subsection Hematology Automated Laboratory Category Departmental Contact Moldenhauer, Emily C Last Revised 11/28/2017
More informationThe Complete Blood Count
The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count
More informationChanges in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature
Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;
More informationMECHANISMS OF HUMAN DISEASE: LABORATORY SESSIONS LYMPHOMA. April 16, 2008
MECHANISMS OF HUMAN DISEASE: LABORATORY SESSIONS LYMPHOMA April 16, 2008 FACULTY COPY GOAL: Learn the appearance of normal peripheral blood elements and lymph nodes. Recognize abnormal peripheral blood
More information5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN
DISCUSSION POINTS Importance of hematological immature cell indices Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN Investigate the evidence for clinical utility:
More informationLavender Top Management SUCCESS BEYOND FINANCES. Mission/ Vision
Lavender Top Management Alfonso Ziccardi Lab.Operation Manager for AP/CP/Safety Officer New York Hospital Medical Center of Queens SUCCESS BEYOND FINANCES Mission/ Vision. VISION To successfully develop
More informationLaboratory for diagnosis of THALASSEMIA
SCBM343 CLINICAL PATHOLOGY 2(1-2-3) Laboratory for diagnosis of THALASSEMIA PORNTHIP CHAICHOMPOO pornthip.chh@mahidol.ac.th Acknowledgements Dr. Pranee Winichagoon Fucharoen Ms. Pornnapa Khampan Thalassemia
More informationRequirements: Glass slides Leishman stain Microscopes Disposable needles Vials containing anticoagulants Methylated-spirit Staining rack
Aim: To make a blood smear and to count the different types of leucocytes present in a stained blood smear and express their relative counts in percentage Principle - The blood contains various types of
More informationPaper ID: ART
analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in
More informationCASE STUDIES PERIPHERAL BLOOD AND BODY FLUIDS
CASE STUDIES PERIPHERAL BLOOD AND BODY FLUIDS WHERE TO START anemias hemoglobinopathies new and old parameters uncommon things fluids.benign and malignant.yuk! really annoying stuff and maybe some entertainment
More informationRBC Histogram as Supplementary Diagnostic Tool with Peripheral Smear Examination in Evaluating Anaemia
Original Article DOI: 10.21276/APALM.1468 RBC Histogram as Supplementary Diagnostic Tool with Peripheral Smear Examination in Evaluating Anaemia Byna Syam Sundara Rao*, Vissa Shanthi, Nandam Mohan Rao,
More informationDifferential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2018-1 MQ, Institut für
More information3/31/2017 OBJECTIVES CASE STUDY #1 MANUAL REVIEW. Hematology Case Studies: Every Picture Tells a Story
OBJECTIVES Hematology Case Studies: Every Picture Tells a Story Jason Anderson, MPH, MT(ASCP) Field Product Specialist Discuss how scattergram and histogram pictures can provide insight into abnormal hematology
More informationSue Jung Kim, MD, MS; Yoonjung Kim, MD; Saeam Shin, MD; Jaewoo Song, MD, MS; Jong Rak Choi, MD, PhD
Comparison Study of the Rates of Manual Peripheral Blood Smear Review From 3 Automated Hematology Analyzers, Unicel DxH 800, ADVIA 2120i, and XE 2100, Using International Consensus Group Guidelines Sue
More informationClinical implications for decreased lymphocytes (lymphopenia) o Corticosteroid therapy, adrenocortical hyperfunction, stress, shock
Learning Objectives At the completion of this program, the participants will be able to: 1. Identify the components of the CBC and Differential and their clinical implications. 2. Identify normal pediatric
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationValidation of Criteria for Smear Review Following Automated Blood Cell Analysis in Ain Shams University Laboratory
Validation of Criteria for Smear Review Following Automated Blood Cell Analysis in Ain Shams University Laboratory Azza S Eldanasoury 1, Noha H Boshnak 2, Raghda E Abd El Monem 3 1 MD, Professor of Clinical
More informationHAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore
HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia
More informationHM5. Hematology Analyzer BETTER. ACTUALLY.
HM5 Hematology Analyzer BETTER. ACTUALLY. Advanced Hematology Five-Part Differential The VetScan HM5 is a fully automated five-part differential hematology analyzer displaying a comprehensive 24-parameter
More informationBLOOD IS COMPLEX ANALYZING IT SHOULDN T BE DxH 500 * *Not available for sale in the U.S.
BLOOD IS COMPLEX ANALYZING IT SHOULDN T BE DxH 500 * *Not available for sale in the U.S. Introducing the DxH 500, an Open-vial Hematology System *. Quality 5-part Differential in a Compact Design The first
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationEvaluation of the Abbott Cell-DYN 3500 Hematology Analyzer in a University Hospital
HEMATOPATHOLOGY Evaluation of the Abbott Cell-DYN 3500 Hematology Analyzer in a University Hospital JOAN-LLUIS VIVES-CORRONS, MD, ISABEL BESSON, PHD, JOSEP MARIA JOU, MD, AND GABRIELA GUTIERREZ, MB The
More informationDeconstructing the CBC
Deconstructing the CBC Dr. Ann M. Wexler Solano Hematology Oncology September 10, 2017 What Are the Major Components of Blood? Red Blood Cells (also called erythrocytes) White Blood Cells (also called
More informationInterpreting Blood Tests Part 1. Dr Andrew Smith
Interpreting Blood Tests Part 1 Dr Andrew Smith Outline Part 1 (This Week) Introduction Which Tube!?! FBCs U+Es Part 2 (Next Week): More Electrolytes LFTs Clotting Extras Introduction Bloods are a core
More information9/23/2018. Hematology Case Studies Jason Anderson, MPH, MT(ASCP) Field Product Specialist OBJECTIVES FLUORESCENT FLOW CYTOMETRY
Hematology Case Studies Jason Anderson, MPH, MT(ASCP) Field Product Specialist OBJECTIVES Discuss how scattergram and histogram pictures can provide insight into abnormal hematology samples Utilize case
More informationCustomer Information Literature List White Blood Cells
Customer Information Literature List White Blood Cells Date: September 2015 Subject: Literature List White Blood Cells Issued by: Scientific Customer Services Number: 150901 Note: Whether references are
More informationPerformance evaluation of Celltac G: a new automated hematology analyzer
Original Article Performance evaluation of Celltac G: a new automated hematology analyzer Masaaki Sugiyama 1, Tsukasa Kobayashi 1, Yuki Jisyage 2, Shigeko Yamamoto 2, Yutaka Nagai 2,3 and Hiroshi Kondo
More informationColor: Gray/Yellow. 5/7/2018 L Hematology results from IDEXX VetLab In-clinic Laboratory Requisition ID: 0 Posted Final Test Result Reference Range
5/7/2018 L LD AA-Urinalysis results from IDEXX VetLab In-clinic COLLECTION = free catch COLOR = yellow CLARITY = clear SP GR = 1.020 GLUCOSE = neg BILIRUBIN = neg KETONE = neg BLOOD = neg PH = 6.0 PROTEIN
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationCalifornia Association for Medical Laboratory Technology
California Association for Medical Laboratory Technology HEMATOLOGY CASE STUDIES: PLATELETS Distance Learning Program Course # DL-985 Helen M. Sowers, MA, CLS, Dept of Biological Science (retired) CSU,
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationCombining. and New Diagnostic. to Help Clinicians Achieve. Patient Outcomes at. per Healthcare Encounter
Combining and New Diagnostic to Help Clinicians Achieve Patient Outcomes at per Healthcare Encounter Holly McDaniel, MD hmcdaniel@clinpath.com Holly.mcdaniel@bannerhealth.com Holly McDaniel, MD AP/CP and
More informationHEAMATOLOGICAL INDICES AND BONE MARROW BIOPSY
HEAMATOLOGICAL INDICES AND BONE MARROW BIOPSY HEMATOCRIT Hematocrit is a measure of the percentage of the total blood volume that is made up by the red blood cells The hematocrit can be determined directly
More informationCHAPTER 4 ANAEMIA IN EAST AFRICAN SHORT-HORN ZEBU CALVES: THE HAEMATOLOGICAL PROFILE FROM NEONATE TO 51 WEEKS
CHAPTER 4 ANAEMIA IN EAST AFRICAN SHORT-HORN ZEBU CALVES: THE HAEMATOLOGICAL PROFILE FROM NEONATE TO 51 WEEKS 1. INTRODUCTION Most reference ranges for the haematological parameters for cattle found in
More informationHematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD
Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,
More informationTwo Important Statistics
Two Important Statistics 70% 40% 0 Quality Control & YOU David Plaut Fall, 2012 davidplaut@yahoo.com 1 11 Why do physicians order laboratory tests? 2 2 Why do Physicians Order Laboratory Tests? 1. Patients
More informationTube 1 : FLAER/CD24/CD16/CD15/CD45
Gating procedure for white blood cells (WBC) on FC500 The French PNH diagnosis working group has developed an optimized gating strategy adapted to a two-tubes diagnostic test (PMN, MO), evaluated in a
More informationStep 2. Common Blood Tests, and the Coulter Counter Readout
Step 2. Common Blood Tests, and the Coulter Counter Readout We will be learning about some common blood tests. We will not be preforming most of them in lab. The student should know their names, their
More information+ Bloodsmear exam 1/12/2014. Goals. Instrument Technologies
In house hematology laboratories: pros and cons of bench-top analyzers and the essentials of a blood film exam. NCSU-CVM Clinical Pathology January 22, 2014 Jaime Tarigo, DVM, PhD, DACVP Goals Understand
More informationDifferential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2014-2 MQ, Institut für
More informationKoostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev
Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte
More informationEvaluation of haematology analyzer CELL-DYN 3700 SL
Evaluation of haematology analyzer CELL-DYN 3700 SL Enver Suljevi}, Muhamed Fazli}, Jozo ]ori} i Emina Kiseljakovi} Institute for Clinical Chemistry and Biochemistry, Clinical Centre of University of Sarajevo
More informationAnalytic Inaccuracy Resulting from Hematology Specimen Characteristics
Analytic Inaccuracy Resulting from Hematology Specimen Characteristics Three Cases of Clinically Misleading Artifacts Affecting White Blood Cell and Platelet Counts Sporadically, hematology analyzers generate
More informationCase Presentation. Attilio Orazi, MD
Case Presentation Attilio Orazi, MD Weill Cornell Medical College/ NYP Hospital Department of Pathology and Laboratory Medicine New York, NY United States History 60 year old man presented with anemia
More informationLYDIA NELSON, M.S., MT(ASCP), SH, SAMUEL CHARACHE, M.D., SANDRA WINGRELD, MT(ASCP), AND EDWARD KEYSER, MT(ASCP)
Laboratory Evaluation of Differential White Blood Cell Count nformation from the S-Plus V and H-1 in Patient Populations Requiring Rapid "Turnaround" Time LYDA NELSON, M.S., MT(ASCP), SH, SAMUEL CHARACHE,
More informationq,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9
etiee INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti PhD 7234136-01 Kit# 1 Kit ID: Kit Mailed:
More informationEDUCATIONAL COMMENTARY MORPHOLOGIC ABNORMALITIES IN LEUKOCYTES
EDUCATIONAL COMMENTARY MORPHOLOGIC ABNORMALITIES IN LEUKOCYTES Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE
More informationHematology & Coagulation Practicum Objectives CLS - 647
Hematology & Coagulation Practicum Objectives CLS - 647 The following objectives are to be completed by the student for successful completion of this clinical rotation. The objectives within the psychomotor
More informationAbnormal blood counts in children Dr Tina Biss Consultant Paediatric Haematologist Newcastle upon Tyne Hospitals NHS Foundation Trust
Abnormal blood counts in children Dr Tina Biss Consultant Paediatric Haematologist Newcastle upon Tyne Hospitals NHS Foundation Trust Regional Paediatric Specialty Trainees teaching 4 th July 2017 Scope
More information2013/11/29 Version 2
1 2013/11/29 Version 2 2 3 4 5 6 7 8 9 99 1 2 3 4 5 6 7 8 9 10 10 99 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/201305061037065219 /99.pdf 99 1 2 3 4 5 6 7 8 9 10 11 99 wew.bhp.doh.gov.tw/bhpnet/portal/file/statisticsfile/201305061037065219
More informationCase Presentation No. 075
Case Presentation No. 075 Session 4. Myelodysplastic Syndrome Cristina Montalvo, MD Baylor College of Medicine Houston, Texas 2007 Workshop of Society for Hematopathology and European Association for Haematopathology
More informationIcd code for cbc with differential/ platelet
Icd code for cbc with differential/ platelet Code. Description. Test. Code. dialysis status. Medically Supportive ICD Codes are listed. The complete blood count (CBC) includes a CBC (includes Differential
More informationM. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia
50, 48, 2012, 3, ADVIA 2120.,.., ANALYSIS OF DIAGNOSTIC RED CELL CYTOGRAMS, GENERATED BY THE ADVIA 2120 HEMATOLOGY ANALYZER M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and
More informationLeukocytosis. dr. Erdélyi, Dániel 2 nd Department of Paediatrics Semmelweis University
Leukocytosis dr. Erdélyi, Dániel 2 nd Department of Paediatrics Semmelweis University My first day at work in 1997 3y with fever, cough Is this bronchitis, pneumonia, pharyngitis, sinusitis, else? Is this
More informationYear 2003 Paper two: Questions supplied by Tricia
QUESTION 65 A 36-year-old man presents in a post-ictal state after an observed generalised seizure. Full blood investigation shows: haemoglobin 0 g/l [128-175] mean corpuscular volume (MCV) 106 fl [80-7]
More informationAdvanced Hematology Five-Part Differential. Simple Operation
HematologyAnalyzer Advanced Hematology Five-Part Differential analyzer displaying a comprehensive 22-parameter complete blood count (CBC) with cellular histograms on an easy-to-read touch-screen. Its superior
More informationHEMATOLOGIC MORPHOLOGY- AECOM HEMATOLOGY COURSE
Log Out Help current login :lcytryn@montefiore.org HEMATOLOGIC MORPHOLOGY- AECOM HEMATOLOGY COURSE Lawrence Cytryn, M.D. - Course Director 1998 Edward Burns, M.D. Images used by permission within AECOM
More informationPNH Glossary of Terms
AA Absolute neutrophil count Alendronate Allergen ALT Anemia Antibodies Anticoagulant Anticoagulation Antigen Antithymocyte globulin (ATG) Aplastic Aplastic anemia Band Bilirubin Blast cells Bone marrow
More information