q,a;e Fc ) ORIGINAL EVALUATION. FH9-B 2017 Hematology Auto Differentials, FH9
|
|
- Roy Stevens
- 6 years ago
- Views:
Transcription
1 etiee INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE Volker El-Samalouti PhD Kit# 1 Kit ID: Kit Mailed: Original Evaluation: /8/2017 6/13/2017 CAP Next Mailing Date: 9/25/2017 LEGEND: Exception Reason Codes appearing in this evaluation: = Educational challenge. Reviewed By q,a;e Fc ) The College of American Pathologists recomrnends that the result of this interlaboratory comparison not be used as a sole criterion for judging the performance of any individual clinical laboratory Page 1 of 9
2 Specimen FH9-B 2017 Hernatology Auto Differentials, FH9 - No. of Limits of Acceptability your Result Mean S.D. Labs S.D.I Lower Upper Grade Plot of the Relative Distance of Results from MCV FH Acceptable --,,,,- fl, FH Acceptable FH9-B 2017 SYSMEX XE-2100,2100D/L FH Acceptable I FH Acceptable FH Acceptable X: Result is outside the acceptable limits MCH FH Acceptable Pg FH Acceptable FH9-B 2017 SYSMEX XE-2100,2100D /L FH Acceptable FH Acceptable FH Acceptable MCHC FH Acceptable g/dl FH Acceptable FH9-B 2017 SYSMEX XE-2100,2100D/L FH Acceptable FH Acceptable._._. FH Acceptable - Platelet Count FH Acceptable x 10E9/L FH Acceptable FH9-B 2017 'M=. SYSMEX XE-2100,2100D/L FH Acceptable FH Acceptable.e.., FH Acceptable -. The College of American Pathologists recommends that the result of this interlaboratory comparison not be used as a sole criterion for judging the performance of any individual clinical laboratory Page 3 of 9
3 I _ No. of Limits of Acceptability Specimen Result Mean S.D. Labs S.D.I Lower Upper Grade Plot of the Relative Distance of Results from Lymphs FH Acceptable % FH Acceptable FH9-B 2017, SYSMEX XE-2100,2100D/L FH Acceptable FH Acceptable...,,, FH Acceptable Lymphs Absolute FH Acceptable x 10E9/L FH Acceptable FH9-B 2017,...L..., SYSMEX XE-2100,2100D/L FH Acceptable I - - FH Acceptable I FH Acceptable Monocytes FH Acceptable `)/0 FH Acceptable FH9-B 2017 SYSMEX XE-2100,2100D/L FH Acceptable FH Acceptable FH Acceptable Monocytes Absolute FH Acceptable. x 10E9/L FH Acceptable FH9-B 2017 '. SYSMEX XE-2100,2100D/L FH M Acceptable.. FH Acceptable FH Acceptable The College of American Pathologists recomrnends that the result of this interlaboratory comparison not be used as a sole criterion for judging the performance of any individual clinical laboratory Page 5 of 9
4 I.* , 0. **041.4,45, eige4,11.1,0** Specimen Result Mean S.D. No. of Labs Limits of Acceptability S.D.I Lower Upper IG FH % FH SYSMEX XE-2100,2100D/L FH FH FH yo ur Grade Plot of the Relative Distance of Results from IG Absolute FH x 10E9/L FH SYSMEX XE-2100,2100D/L FH FH FH nrbc% FH FH SYSMEX XE-2100,2100D/L FH echeck XE CONTROL FH FH nrbc Absolute FH x 10E3/uL FH SYSMEX XE-2100,2100D/L FH echeck XE CONTROL FH FH Method Specimen Result Good Response Acceptable Response Grade Blood Cell ID BCP-11 OVALOCYTE OVALOCYTE Good BCP-12 LYMPHOCYTE LYMPHOCYTE Good BCP-13 MONOCYTE MONOCYTE Good The College of American Pathologists recommends that the result of this interlaboratory comparison not be used as a sole criterion for judging the performance of any individual clinical laboratory Page 7 of 9
5 im* e..feeefb* tem* e fbio e.06 et fbe CAP CAP #: Subspecialty : Hematology Proficiency Event Proficiency Event Proficiency Event Current Event Performance Cumulative CLIA '88 Performance Regulated Analyte Event Score A Event Score % Event Score % Interpretation Interpretation Cell ID/Flow Differential FH9-C 5/5 100 FH9-A 5/5 100 FH9-B 5/5 100 Satisfactory Successful Erythrocyte Count (RBC) H-19-C 5/5 100 FF19-A 5/5 100 F1-19-B 5/5 100 Satisfactory Successful Hematocrit FH9-C 5 / FH9-A 5/5 100 FH9-B 5/5 100 Satisfactory Successful Hemoglobin FH9-C 5/5 100 FH9-A 5/5 100 FH9-B 5/5 100 Satisfactory Successful Leukocyte Count (WBC) 1+19-C 5/5 100 FH9-A 5/5 100 FH9-B 5/5 100 Satisfactory Successful Platelet Count FH9-C 5/5 100 FH9-A 5/5 100 FH9-B 5/5 100 Satisfactory Successful Fibrinogen CGL-C 5/5 100 CGL-A 5/5 100 Pending Successful <4> PTT CGL-C 5/5 100 CGL-A 5/5 100 Pending Successful <4> Prothrombin Time CGL-C 5 / CGL-A 5/5 100 Pending Successful <4> Hematology 45/ / / Satisfactory Successful <4> Scorecard performance pending future evaluation or may not be applicable due to discontinued testing or use of a waived method. The College of American Pathologists recomrnends that the result of this interlaboratory comparison not be used as a sole criterion for judging the performance of ani, individual clinical laboratoit Page 9 of 9
6 444, Method Specimen Result Good Response Acceptable Response Grade BCP-14 PLATELET, NORMAL PLATELET, NORMAL Good BCP-15 BASOPHIL, ANY STAGE BASOPHIL, ANY STAGE Good Blood Cell ID Ungraded BCP-16 LYMPHOCYTE BCP-17 POLYCHROMATOPHILIC RBC BCP-18 MONOCYTE BCP-19 NEUTROPHIL, SEG/BAND BCP-20 SPHEROCYTE The College of American Pathologists recommends that the result of this interlaboratory comparison not be used as a sole criterion for judging the performance of any individual clinical laboratory Page 8
7 Specimen City / State: Schwendnental GE No. of Limits of Acceptability your Resuh Mean S.D. Labs S.D.I Lower Upper Grade Eosinophils FH Acceptable A) FH Acceptable FH9-B 2017 SYSMEX XE-2100,2100D/L FH Acceptable FH Acceptable FH Acceptable -100 Plot of the Relative Distance of Results from 4. _ ' _ Eosinophils Absolute FH Acceptable x 10E9/L FH Acceptable FH9-B 2017 SYSMEX XE-2100,2100D/L FH Acceptable FH Acceptable FH Acceptable Basophils FH Acceptable w A) FH Acceptable FH9-B 2017 SYSMEX XE-2100,2100D /L FH M Acceptable FH Acceptable FH Acceptable Basophils Absolute FH Acceptable x 10E9/L FH Acceptable FH9-B , SYSMEX XE-2100,2100D/L FH , t Acceptable ' FH Acceptable FH Acceptable The College of American Pathologists recornmends that the result of this interlaboratory comparison not be used as a sole criterion for judging the performance of any individual clinical laboratory Page 6
8 Specimen Result Mean S.D. No. o f Limits of Acceptability Labs S.D.I Lower Upper Grade Plot of the Relative Distance of Results from MPV FH Acceptable fl FH Acceptable FH9-B 2017 SYSMEX XE-2100,2100D/L FH Acceptable FH Acceptable FH Acceptable RDW FH Acceptable FH Acceptable FH9-B SYSMEX XE-2100,2100D/L FH9-08 ' Acceptable._. fl FH Acceptable FH Acceptable Neut/Gran 'FH Acceptable % FH Acceptable FH9-B 2017 SYSMEX XE-2100,2100D /L FH Acceptable FH Acceptable FH Acceptable Neut/Gran Absolute FH Acceptable x 10E9/L FH Acceptable FH9-B 2017 I SYSMEX XE-2100,2100D/L FH Acceptable., F1-19-C2016 FH Acceptable., E.: FH Acceptable The College of Arnerican Pathologists recommends that the result of this interlaboratory comparison not be used as a sole criterion for judging the performance of any individual clinical laboratory Page 4
9 325 Waukegan Road, NorthfieEd, Illinois cap.org Specimen No. of Limits of Acceptability your Result Mean S.D. Labs S.D.I Lower Upper Grade Plot of the Relative Distance of Results from White Blood Cell Count FH Acceptable x 10E9/L FH Acceptable FH9-B 2017 SYSMEX XE-2100,2100D/L FH t Acceptable FH Acceptable FH Acceptable Red Blood Cell Count FH Acceptable x 10E12/L FH Acceptable FH9-B 2017 SYSMEX XE-2100,2100D/L FH Acceptable FH Acceptable FH Acceptable _ I t Hemoglobin FH Acceptable g/dl FH Acceptable FH9-B 2017 I I SYSMEX XE-2100,2100D/L FH Acceptable I i FH Acceptable FH Acceptable Hematocrit FH Acceptable % FH Acceptable FH9-B 2017 SYSMEX XE-2100,2100D/L FH M Acceptable FH FH Acceptable Acceptable The College of American Pathologists recommends that the result of this interlaboratory comparison not be used as a sole criterion for judging the performance of any indiyidual clinical laboratory Page 2
ORIGINAL EVALUATION. FH9-C 2017 Hematology Auto Differentials, FH9
ft Cit e * 4> ee e e e *111» * * PAT H 0 LO GI STS INSTITUTION: ATTENTION: CAP NUMBER: KIT INFORMATION: COPIED TO: LKF Laboratorium fur Klinische Forschung GmbH Schwentinental GE 24223 Volker El-Samalouti
More informationDifferential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2015-4 MQ, Institut für
More informationDifferential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2018-1 MQ, Institut für
More informationLaboratory for diagnosis of THALASSEMIA
SCBM343 CLINICAL PATHOLOGY 2(1-2-3) Laboratory for diagnosis of THALASSEMIA PORNTHIP CHAICHOMPOO pornthip.chh@mahidol.ac.th Acknowledgements Dr. Pranee Winichagoon Fucharoen Ms. Pornnapa Khampan Thalassemia
More informationCollect and label sample according to standard protocols. Gently invert tube 8-10 times immediately after draw. DO NOT SHAKE. Do not centrifuge.
Complete Blood Count CPT Code: CBC with Differential: 85025 CBC without Differential: 85027 Order Code: CBC with Differential: C915 Includes: White blood cell, Red blood cell, Hematocrit, Hemoglobin, MCV,
More informationHaematology Comparability Document
South Island Quality Assurance Group for Haematology Haematology Comparability Document Version Number: 1_4 Author: John Moodie/Alison Doorey Implementation Date: 21/05/2012 Revision Date: On-going Document
More informationDifferential Blood Smear H3
Verein für Association pour le Associazione per il medizinische Qualitätskontrolle contrôle de qualité médical controllo di qualità medico Report Differential Blood Smear H3 MQ 2014-2 MQ, Institut für
More informationNEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016
NEW YORK STATE CYTOHEMATOLOGY PROFICIENCY TEST PROGRAM Glass Slide - November 2016 Results from this proficiency test event are available at: http://www.wadsworth.org/regulatory/clep/pt/summaries SLIDE
More informationA Look Into the Determination of Cell Morphology in Hematology in the 21 st Century. Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter
A Look Into the Determination of Cell Morphology in Hematology in the 21 st Century Ramon Simon-Lopez, MD Global Scientific Director Beckman Coulter Is cell morphology important? AML M7 CLL CD5 CD19 NHL
More informationComplete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ
Complete Blood Count (CBC) Assist.Prof. Filiz BAKAR ATEŞ The complete blood count (CBC) is one of the most common blood test used. It analyzes the three major types of cells in blood 1. red blood cells,
More informationDAT-B 2015 Direct Antiglobulin Test
EVALUATION DAT-B 2015 Direct Antiglobulin Test INSTITUTION: ATTENTION: CAP NUMBER: 7181660-01 Kit# 1 KIT INFORMATION: Kit ID: 28002258 10/12/2015 11/16/2015 Next Mailing Date: 2/22/2016 COPIED TO: LAP
More informationInterpreting the CBC. Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired
Interpreting the CBC Robert Miller PA Assistant Professor of Clinical Pediatrics and Family Medicine USC Keck School of Medicine Retired The CBC 3 Cell Lines RBCs WBCs Platelets Assess general health Make
More informationContinuing Education Questions
FOCUS: INTERPRETING THE COMPLETE BLOOD COUNT Continuing Education Questions SUMMER 2017 1. A methodical approach to CBC interpretation that is aimed at medical laboratory professionals differs from one
More informationGuide to the 1-3 Minute Blood Film Microscopic Review: Why and How?
Guide to the 1-3 Minute Blood Film Microscopic Review: Why and How? Dennis B. DeNicola, DVM, PhD, DACVP Chief Veterinary Educator IDEXX Laboratories, Inc. Westbrook, ME USA Adjunct Professor of Veterinary
More informationChanges in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature
Changes in Automated Complete Blood Cell Count and Differential Leukocyte Count Results Induced by Storage of Blood at Room Temperature Gene L. Gulati, PhD; Lawrence J. Hyland, MD; William Kocher, MD;
More informationFH9-A 2016 Kit Instructions CAP 2016
FH9-A 2016 Kit Instructions CAP 2016 Comprehensive Hematology Survey Automated Differential FH9 FH9P Table of Contents Kit Contents Kit Contents... 1 Important: Before You Begin... 1 Detailed Testing Instructions...
More informationThe Complete Blood Count
The Complete Blood Count (Cartesian Thinking at Its Best) A SEM Image of Normal Human Blood Laurie Larsson February 22, 2010 Anatomy and Philology II Dr. Danil Hammoudi Introduction A complete blood count
More informationHematology 101. Cindy Rogers, MT(ASCP) Diagnostics System Specialist
Hematology 101 Cindy Rogers, MT(ASCP) Diagnostics System Specialist More Acronyms...» CBC» RBC» HGB» HCT» WBC» MPV» PLT» RDW» DIFF» H&H» Complete Blood Count» Red Blood Cell» Hemoglobin» Hematocrit» White
More informationScoring System for Detecting Spurious Hemolysis in Anticoagulated Blood Specimens
Original Article Laboratory Informatics Ann Lab Med 2015;35:341-347 http://dx.doi.org/10.3343/alm.2015.35.3.341 ISSN 2234-3806 eissn 2234-3814 Scoring System for Detecting Spurious Hemolysis in Anticoagulated
More informationBrief Communication Diagnostic Hematology
Brief Communication Diagnostic Hematology Ann Lab Med 2016;36:244-249 http://dx.doi.org/10.3343/alm.2016.36.3.244 ISSN 2234-3806 eissn 2234-3814 Establishment of Age- and Gender-Specific Reference Ranges
More informationInspector's Accreditation Unit Activity Menu
01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,
More informationEDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS
EDUCATIONAL COMMENTARY MORPHOLOGIC CHANGES IN PERIPHERAL BLOOD CELLS Educational commentary is provided through our affiliation with the American Society for Clinical Pathology (ASCP). To obtain FREE CME/CMLE
More informationKoostas: Anneli Aus Laboriarst Allkiri Ees- ja perekonnanimi Ametikoht kuupäev
Kinnitas: Elektroonselt Katrin Reimand Osakonnajuhataja 05.07.2017 kinnitatud Koostas: Anneli Aus Laboriarst 05.07.2017 Allkiri Ees- ja perekonnanimi Ametikoht kuupäev Haematology reference values Analyte
More informationIcd code for cbc with differential/ platelet
Icd code for cbc with differential/ platelet Code. Description. Test. Code. dialysis status. Medically Supportive ICD Codes are listed. The complete blood count (CBC) includes a CBC (includes Differential
More informationCOMPANY OR UNIVERSITY
CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota
More informationNOTE: This table will be discontinued after this lot.
AS037-011 Rev. 11/14 ASSAY VALUES AND EXPECTED RANGES QCP DATA MONTHS: DEC, JAN, FEB Beckman Coulter STKS / MAXM / HMX LEVEL 1 + Lot No.: Exp. Date: LOT 871086 Parameter Mean Range WBC 10 3 /µl 4.0 ± 0.6
More informationFull Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa
Full Blood Count analysis Is a 3 part-diff good enough? Dr Marion Münster, Sysmex South Africa The Role of the FBC in clinical decision making History Examination Investigations Decision 70% FBC Laboratory
More informationChanges of hematological references depends on storage period and temperature conditions in rats and dogs
ISSN 1738-6055 (Print) ISSN 2233-7660 (Online) Lab Anim Res 2016: 32(4), 241-248 https://doi.org/10.5625/lar.2016.32.4.241 Changes of hematological references depends on storage period and temperature
More informationINFECTION/ INFLAMMATION
HAEMATOLOGY OCTOBER 2017* WHITE PAPER INFECTION/ INFLAMMATION Novel haematological parameters for rapidly monitoring the immune system response Patients with inflammatory disease are common on hospital
More informationGRADING CRITERIA for CMS Regulated Analytes
CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers
More informationProficiency Testing Evaluation
Facility/Contact Phone: (573)265-8840 PCRMC Medical Group - Forest C Fax: (573)265-8884 1000 N Jefferson St Email (primary): odean@pcrmc.com; Email (secondary): (Please add pt@aafp.org to your electronic
More information3. Blood Cell Histograms:
LECTURE MODULE 6c: ELECTRONIC CELL COUNTING PART III 3. Blood Cell Histograms: a. The Coulter cell counters today provides size distributions of the cellular content: 1) volume given in µm 3 or fl vs relative
More informationör-jei/t COLLEGE of AMERICAN PATHOLOGISTS 325 Waukegan Road. Northfleld.118nola cap.org ORIGINAL EVALUATION
**** COLLEGE of AMERICAN PATHOLOGISTS 325 Waukegan Road. Northfleld.118nola 60093-2750 800-323-4040 cap.org General Chernistry/Therapeutic Drugs INSTITUTION: ATTENTION: CAP NU1MBER: KIT INFORMATION: COPIED
More informationTest Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 135091667 Age 37 Years Gender Male 29/8/2017 120000AM 29/8/2017 100129AM 29/8/2017 113851AM Ref By Final COAGULATION ROFILE 1 ARTIAL THROMBOLASTIN TIME, ACTIVATED; ATT
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationBlood Cell Identification Graded
Blood Cell Identification Graded Case History The patient is a 20-year-old female with sickle cell disease who presents with bilateral leg pain for 3 days. She is scheduled to have bilateral hip and leg
More informationXN series. Case interpretation. Gebruikersdag Vlaanderen- 6 oktober 2016
XN series Case interpretation Gebruikersdag Vlaanderen- 6 oktober 2016 Fluorescence flow cytometry RET channel PLT-F channel WDF channel WPC channel WNR channel Case 1 Case 1: Initial measurement Patient
More informationClinical use of flow cytometry
Clinical use of flow cytometry Diagnosis of leukemia Combined use of intracellular staining and a cell surface marker Detection of stem cells CD34+ stem cells Monitoring of stem cell count following
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationTwo Important Statistics
Two Important Statistics 70% 40% 0 Quality Control & YOU David Plaut Fall, 2012 davidplaut@yahoo.com 1 11 Why do physicians order laboratory tests? 2 2 Why do Physicians Order Laboratory Tests? 1. Patients
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informatione-figure 1. The design of the study.
e-figure 1. The design of the study. NDM, no diabetes; DM, diabetes; TB, tuberculosis; SN, sputum smear negative; SP, sputum smear positive; AFB, acid fast bacilli. e-figure 2. Representative H&E (A) and
More information8.2 Principles of Quantitative Hematologic Determinations (1)
3 8. FIELD CENTER HEMATOLOGY SERVICES 8.1 Clinical Significance Quantitation of the formed elements of the blood (erythrocytes -RBCs, leukocytes - WBCs, and platelets) is important in the ARIC study primarily
More informationBlood Cells Med Terms Quiz
Blood Cells Med Terms Quiz Question Prompt: 1 Mononuclear white blood cells (agranulocyte) formed in lymph tissue, also a phagocyte and a precursor of macrophages are leukocytes. True False Question Prompt:
More informationAVCPT FORMULA GUIDE HEMATOLOGY. Test Formula Example Mean Corpuscular Volume (MCV) Mean Corpuscular Hemoglobin Concentration (MCHC)
AVCPT FMULA GUIDE HEMATOLOGY Test Formula Example Mean Corpuscular Volume (MCV) PCV x RBC = MCV (fl) Patient Information: RBC = 7.50 x 6 /µl 45 x 7.50 = 60.0 fl MCV = 60.0 fl Mean Corpuscular Hemoglobin
More informationM. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and Clinical Immunology, MU Sofia
50, 48, 2012, 3, ADVIA 2120.,.., ANALYSIS OF DIAGNOSTIC RED CELL CYTOGRAMS, GENERATED BY THE ADVIA 2120 HEMATOLOGY ANALYZER M. Velizarova, T. Yacheva and K. Tzatchev Department of Clinical Laboratory and
More informationPaper ID: ART
analytical process. Delayed sample analysi changes of measured parameters co interpretation of results. Pre-analytical variables, such as stor temperature affect the measurement parameters collected in
More informationStep 2. Common Blood Tests, and the Coulter Counter Readout
Step 2. Common Blood Tests, and the Coulter Counter Readout We will be learning about some common blood tests. We will not be preforming most of them in lab. The student should know their names, their
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationAmerican University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program
P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program () Fall Semester 2016-2017 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF: 10:00
More informationAmerican University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program
P 1 of 5 American University of Beirut Faculty of Health Sciences Medical Laboratory Sciences Program MLSP 201 () Fall Semester 2017-2018 Name Rolla Al-Khatib Course Credits: 3 credits Office Hours: TWRF:
More informationPatient Information Specimen Information Client Information. Specimen: EN255254W. Requisition:
Patient Information Specimen Information Client Information MAIL000 Requisition: 0014895 DIRECT TO PATIENT- WEST HILLS Lab Ref #: PRO76199 8401 FALLBROOK AVE WEST HILLS, CA 91304-3226 Phone: 530.347.6380
More informationSenior Executive Wellness Profile
Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,
More informationUse of the XE-2100 in a Patient with Cold Auto-immune Hemolytic Anemia
Use of the XE-21 in a Patient with Cold Auto-immune Hemolytic Anemia Gudrun STAMMINGER and Lothar BEIER Klinikum Chemnitz ggmbh, Institut für Laboratoriumsmedizin, Flemmingstraße 2, Chemnitz, Germany.
More informationCombining. and New Diagnostic. to Help Clinicians Achieve. Patient Outcomes at. per Healthcare Encounter
Combining and New Diagnostic to Help Clinicians Achieve Patient Outcomes at per Healthcare Encounter Holly McDaniel, MD hmcdaniel@clinpath.com Holly.mcdaniel@bannerhealth.com Holly McDaniel, MD AP/CP and
More informationPatient Information Specimen Information Client Information. Specimen: EN255254W. Requisition: TSENG, JUSTINA J DOB: 10/26/1955 AGE: 59
Report Status: Final Patient Information Specimen Information Client Information Specimen: EN255254W Client #: 44123510 MAIL001 Requisition: 0014895 Lab Ref #: PRO76199 GREENVILLE RANCHERIA 1425 MONTGOMERY
More informationSue Jung Kim, MD, MS; Yoonjung Kim, MD; Saeam Shin, MD; Jaewoo Song, MD, MS; Jong Rak Choi, MD, PhD
Comparison Study of the Rates of Manual Peripheral Blood Smear Review From 3 Automated Hematology Analyzers, Unicel DxH 800, ADVIA 2120i, and XE 2100, Using International Consensus Group Guidelines Sue
More information5/1/2017 DISCUSSION POINTS. Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN
DISCUSSION POINTS Importance of hematological immature cell indices Clinical Utility of Immature Cell Indices Beyond the Routine CBC John E. Donnelly BSN, RN Investigate the evidence for clinical utility:
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationCELL-DYN Strength in Technology, Proven Reliability. Optical WBC Technology. Patented M.A.P.S.S. Differential. Multiple Technologies
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented M.A.P.S.S. Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
More informationChanges in Hematologic Parameters Induced by Thermal Treatment of Human Blood
Annals of Clinical & Laboratory Science, vol. 32, no. 4, 2002 393 Changes in Hematologic Parameters Induced by Thermal Treatment of Human Blood Jong Weon Choi and Soo Hwan Pai Department of Clinical Pathology,
More informationBeyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure
Beyond the CBC Report: Extended Laboratory Testing in the Evaluation for Hematologic Neoplasia Disclosure I am receiving an honorarium from Sysmex for today s presentation. 1 Determining the Etiology for
More informationHamilton Regional Laboratory Medicine Program
Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;
More informationBIOCHEMISTRY of BLOOD
BIOCHEMISTRY of BLOOD BCH 471 [Practical] Course Outline Title of the Experiments 1 Separation of plasma and serum from whole blood 2 Separation of main proteins in plasma and serum 3 Determination of
More information15/9/2017 4:23:00PM 15/9/2017 4:26:06PM 20/9/2017 4:58:24PM A/c Status. Test Name Results Units Bio. Ref. Interval < >40.00 mg/dl <150.
Lab No 135091258 Age 30 Years Gender Male 15/9/2017 42300M 15/9/2017 42606M 20/9/2017 45824M Ref By UNKNWON Final Test Results Units Bio Ref Interval SWASTH LUS HEALTH ADVANCE ANEL LIID ROFILE, BASIC,
More informationMyelodysplastic Syndrome Case 158
Myelodysplastic Syndrome Case 158 Dong Chen MD PhD Division of Hematopathology Mayo Clinic Clinical History 86 year old man Persistent borderline anemia and thrombocytopenia. His past medical history was
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationThe LaboratoryMatters
Laboratory Medicine Newsletter for clinicians, pathologists & clinical laboratory technologists. A Initiative. Complete Blood Count This issue highlights: CBC, while ubiquitous, is an excellent diagnostic
More informationValidation of Criteria for Smear Review Following Automated Blood Cell Analysis in Ain Shams University Laboratory
Validation of Criteria for Smear Review Following Automated Blood Cell Analysis in Ain Shams University Laboratory Azza S Eldanasoury 1, Noha H Boshnak 2, Raghda E Abd El Monem 3 1 MD, Professor of Clinical
More informationLaboratory Results Summary
Laboratory Results Summary Laboratory CO1033AI Test event 2 of 3 CAP LAP Number 7181660 Page Print Date 9 / 10 2008/Jul/04 Program Syphilis (SYPH435) Results Deadline 2008/Jun/24 Subscription ID Analyte
More informationTest Result Reference Range Flag
Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec
More informationHAEMATOLOGICAL EVALUATION OF ANEMIA. Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore
HAEMATOLOGICAL EVALUATION OF ANEMIA Sitalakshmi S Professor and Head Department of Clinical Pathology St John s medical College, Bangalore Learning Objectives Laboratory tests for the evaluation of anemia
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More informationTest Name Results Units Bio. Ref. Interval
LL - LL-ROHINI (NATIONAL REFERENCE 135091668 Age 40 Years Gender Male 29/8/2017 120000AM 29/8/2017 100156AM 29/8/2017 120820M Ref By Final COAGULATION ROFILE 2 FACTOR VIII FUNCTIONAL /ACTIVITY (Electromechanical
More information1/9/ :00:00AM 1/9/ :39:34AM 6/9/2017 9:08:54AM A/c Status. Test Name Results Units Bio. Ref. Interval 70.00
Lab No 135091545 Age 31 Years Gender Female 1/9/2017 120000AM 1/9/2017 103934AM 6/9/2017 90854AM Ref By Dr UNKNWON Final Test Results Units Bio Ref Interval ANTENATAL ANEL 1 SUGAR CHOICE (Hexokinase) 7000
More informationHematology 101. Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD
Hematology 101 Blanche P Alter, MD, MPH, FAAP Clinical Genetics Branch Division of Cancer Epidemiology and Genetics Bethesda, MD Hematocrits Plasma White cells Red cells Normal, Hemorrhage, IDA, Leukemia,
More informationCELL-DYN 3700 Strength in Technology, Proven Reliability
CELL-DYN 3700 Strength in Technology, Proven Reliability Optical WBC Technology Patented MAPSS Differential Multiple Technologies CELL-DYN 3700 Multiple Technologies One Superior Result Multiple Technologies
More information* * : : : Final. (Automated Strip Test, Microscopy) Colour Specific Gravity Nil
LL - LL-ROHINI (NATIONAL REFERENCE 136235212 Age Unknown Gender Unknown 5/6/2017 103400AM 5/6/2017 105702AM 5/6/2017 35028M Ref By Final Swasth lus Health Basic anel URINE EXAMINATION, ROUTINE; URINE,
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationJKMU. Introduction. Original article. Oxidative stress Total antioxidant capacity Hematological parameters Diabetes Rosa canina Mice
JKMU Journal of Kerman University of Medical Sciences, 2017; 24(2): 132-140 The Effects of Fruit Hydro alcoholic Extract on Oxidative Stress, Total Antioxidant Capacity and Haematological Parameters in
More information6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.
LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,
More information1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.
1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61
More informationMorphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital
Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:
More informationENROLLMENT CONFIRMATION
Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationSchedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK
2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com
More informationVOICE Screening Part 1 Visit. Operational Walkthrough Johannesburg, South Africa November 2008
VOICE Screening Part 1 Visit Operational Walkthrough Johannesburg, South Africa November 2008 Protocol Requirements Administrative, Behavioral, and Regulatory Procedures Informed consent for screening
More informationQuality control in the hematology laboratory for the sake of the patient. Dr Marion Münster Manager Medical & Scientific Affairs Sysmex South Africa
Quality control in the hematology laboratory for the sake of the patient Dr Marion Münster Manager Medical & Scientific Affairs Sysmex South Africa The FBC. Most frequently requested lab test Usually delegated
More informationProper Slide Preparation
Hematology Essentials: A Foundation for WBC Review Using Case Studies Christine Hinz, MS, MLS(ASCP) CM Proper Slide Preparation smooth, homogenous film 1/2 to 3/4 the slide length straight feather edge
More informationDetection of important abnormalities of the differential
J Clin Pathol 1989;42:772-776 Detection of important abnormalities of the differential count using the Coulter STKR blood counter D F BARNARD, S A BARNARD, A B CARTER, S J MACHN, K G PATTERSON, A YARDUMAN
More informationBlood Cell Identification Graded
BCP-21 Blood Cell Identification Graded Case History The patient is a 37-year-old female with a history of multiple sickle cell crises. She now presents with avascular necrosis of the left hip. Laboratory
More information1 BIO 212: ANATOMY & PHYSIOLOGY II PLATELETS. Mature Stage: No nucleus. Only 2-3 µm in diameter: significantly smaller than RBCs
1 BIO 212: ANATOMY & PHYSIOLOGY II LAB BLOOD PLATES EOSINOPHIL Contains large red-staining granules Usually 2 lobes 12-17 µm: about the size of neutrophils (2X erythrocytes) regulation/reduction of Histamine.
More informationLabDriver Audit Trail Example
LabDriver Audit Trail Example Sample details:= (SampleDId=82051) Lab no: 0902168 Centre: CR Centre (CentreId=1079) (BatchSId=1317) Status: Checked Blood date: 13/05/2009 time: 11:31:00 lab received: 13/05/2009
More information2014 Continuing Compliance Master Series Best Practices in Alternative Assessment of Performance
2014 Continuing Compliance Master Series Best Practices in Alternative Assessment of Performance Brad S. Karon, MD, PhD, FCAP November 19, 2014 www.cap.org Today s Presenter Brad S. Karon, MD, PhD, FCAP
More informationReduction of metastatic and angiogenic potency of malignant cancer by Eupatorium. fortunei via suppression of MMP-9 activity and VEGF production
Supplementary Information Reduction of metastatic and angiogenic potency of malignant cancer by Eupatorium fortunei via suppression of MMP-9 activity and VEGF production Aeyung Kim, Minju Im, Nam-Hui Yim
More informationA Study on the Relationship between CBC and EEG for Epilepsy Patients
ORIGINAL ARTICLE Korean J Clin Lab Sci. 2015, 47(4):225-229 http://dx.doi.org/10.15324/kjcls.2015.47.4.225 pissn 1738-3544 eissn 2288-1662 Korean J Clin Lab Sci. Vol. 47, No. 4, Dec. 2015 225 A Study on
More informationStudy. Human Tolerance of Low Molecular Weight. Polyethylene Markers. Prof. Dr. Dr. Ruprecht Keller. Krankenhaus Merheim Zentrallabor
Study Human Tolerance of Low Molecular Weight Polyethylene Markers Prof. Dr. Dr. Ruprecht Keller Krankenhaus Merheim Zentrallabor Ostmerheimerstr. 00 509 Köln Human Tolerance of Low Molecular Weight Polyethylene
More informationEfficacy of the AGRO-JET MIT-II NEEDLE-LESS JET INJECTOR for Iron Dextran Administration in Piglets
Almond, Page 1 Efficacy of the AGRO-JET MIT-II NEEDLE-LESS JET INJECTOR for Iron Dextran Administration in Piglets Final Report to Karim Menassa Medical International Technologies 2281 Guenette St-Laurent,
More informationCbc with differential
Cbc with differential Other tests might be necessary based on the results of the differential test and follow-up tests. Your doctor has many ways of determining and treating causes of abnormal blood cell
More information