Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Transcription

1 Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC tubulin (rat, mouse) reverse GGCAGCAAGCCATGTATTTA PGC-1α (rat, mouse) forward ACTGAGCTACCCTTGGGATG PGC-1α (rat, mouse) reverse TAAGAATTTCGGTGGTGACA Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG Cytochrome-C (rat, mouse) reverse TCCATCAGGGTATCCTCTCC G6Pase (rat, mouse) forward ACACCGACTACTACAGCAACAG G6Pase (rat, mouse) reverse CCTCGAAAGATAGCAAGAGTAG PEPCK (rat, mouse) forward CATATGCTGATCCTGGGCATAAC PEPCK (rat, mouse) reverse CAAACTTCATCCAGGCAATGTC ERRα (rat, mouse) forward ATCTGCTGGTGGTTGAACCTG ERRα (rat, mouse) reverse AGAAGCCTGGGATGCTCTTG mouse cox5b forward GCTGCATCTGTGAAGAGGACAAC mouse cox5b reverse CAGCTTGTAATGGGTTCCACAGT rat cox5b forward GGAGATCATGATAGCAGCACAG rat cox5b reverse CTCTTCACAGATGCAGCCCAC mouse glut4 forward GTGACTGGAACACTGGTCCTA mouse glut4 reverse CCAGCCACGTTGCATTGTAG rat glut4 forward CTCATGGGCCTAGCCAATG rat glut4 reverse GGGCGATTTCTCCCACATAC mouse AOX forward GCTCAGCAGGAGAAATGGATGC mouse AOX reverse AATGAACTCTTGGGTCTTGGGG rat AOX forward CCAATCACGCAATAGTTCTGG rat AOX reverse CGCTGTATCGTATGGCGAT mouse NRF1 forward TGGAGGAGCACGGAGTGA mouse NRF2 reverse CAGCCAGATGGGCAGTTA rat NRF1 forward GTATGCTAAGTGCTGATGAA rat NRF2 reverse GGGTTTGGAGGGTGAGAT mouse UCP-3 forward TGGCCTCTACGACTCTGTCAAGCA mouse UCP-3 reverse CTCCTTCCTCCCTGGCGATGGTTC mouse ATPase-F1α forward TCTCCATGCCTCTAACACTCG mouse ATPase-F1α reverse CCAGGTCAACAGACGTGTCAG mouse CPT-1 forward ATGACGGCTATGGTGTTTCC mouse CPT-1 reverse TGTCCATCATGGCTTGTCTC mouse MCAD forward AGCTGCTAGTGGAGCACCAAG mouse MCAD reverse TCGCCATTTCTGCGAGC mouse LCAD forward TCACCAACCGTGAAGCTCGA mouse LCAD reverse CCAAAAAGAGGCTAATGCCATG mouse 16S rrna mtdna forward CCGCAAGGGAAAGATGAAAGAC mouse 16S rrna mtdna reverse TCGTTTGGTTTCGGGGTTTC mouse hexokinase 2 gene, intron 9 forward GCCAGCCTCTCCTGATTTTAGTGT mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

2 Supplementary Table 2. Body weight of SD rats gavaged with ZLN005 for 14 days. D:day. Sex Time(day) vehicle 75 mg/kg (g) (g) D ± ±8.35 Female D ± ±10.78 D ± ±16.38 D ± ±2.99 D ± ±8.73 Male D ± ±9.83 D ± ±15.26 D ± ±25.91 D ± ±8.18 D ± ±18.82

3 Supplementary Table 3. Blood routine examination of SD rats gavaged with ZLN005 for 14 days. Sex Variable vehicle 75 mg/kg Female Male WBC(10 9 /L) 4.860± ±0.72 RBC(10 12 /L) 6.91± ±0.19 HGB (g/l) 12.93± ±0.31 HCT(%) 38.18± ±0.93 MCV(fL) 55.25± ±1.79 MCH(pg) 18.75± ±0.48 MCHC (g/l) 33.90± ±0.29 RDW(fL) 11.70± ±1.13** HDW(g/dL) 2.15± ±0.39** PLT(10 3 /μl) ± ±84.65 MPV (fl) 8.10± ±0.29 %NEUT 16.15± ±6.22 %LYM 79.35± ±7.22 %MONO 1.68± ±0.75 %EOS 1.78± ±0.17 %BASO 0.18± ±0.13 %LUC 0.85± ±0.13 PT(sec) 8.43± ±0.14 WBC(10 9 /L) 5.28± ±1.62 RBC(10 12 /L) 7.68± ±0.29 HGB (g/l) 14.48± ±0.51 HCT(%) 43.10± ±1.64 MCV(fL) 56.13± ±1.33 MCH(pg) 18.85± ±0.48 MCHC (g/l) 33.60± ±0.21 RDW(fL) 11.75± ±0.58 HDW(g/dL) 2.18± ±0.12 PLT(10 3 /μl) ± ±69.81 MPV (fl) 7.78± ±0.17 %NEUT 15.18± ±6.46 %LYM 81.45± ±7.53 %MONO 1.65± ±0.87 %EOS 0.90± ±0.22 %BASO 0.15± ±0.08 %LUC 0.70± ±0.49 PT(sec) 8.90± ±0.13 *, p < 0.05, **, p < 0.01 compared with vehicle group. WBC: white blood cell; RBC: red blood cell; HGB: hemoglobin; HCT: hematocrit; MCV: mean corpuscular volume; MCH: mean cell haemoglobin; MCHC: mean cell haemoglobin concentration; RDW: blood cell distribution width; HDW: hemoglobin distribution width; PLT: platelets; MPV: mean platelet volume; NEUT: neutrophilic granulocyte; LYM: lymphocyte; MONO: monocyte; EOS: eosinophilic granulocyte; BASO: basophile granulocyte; LUC: large unstained cells; PT: prothrombin time.

4 Supplementary Table 4. Plasma metabolites of SD rats gavaged with ZLN005 for 14 days. Sex Variable vehicle 75 mg/kg ALT (U/L) 39.50± ±5.56 AST (U/L) 98.50± ±4.24* ALP (U/L) ± ±34.22 BUN (mmol/l) 7.04± ±1.00 CREA (µmol/l) 27.75± ±1.29* GLU (mmol/l) 7.14± ±0.32 TBIL (µmol/l) 2.08± ±0.50 Female CHOL (mmol/l) ALB (g/l) 1.64± ± ± ±1.00 TP (g/l) CK (U/L) 54.50± ± ± ±81.06** TG (mmol/l) 0.31± ±0.06 GGT(U/L) 0.94± ±0.11 DBIL (µmol/l) 1.31± ±0.34 A/G 3.26± ±0.36 GLO (g/l) 13.00± ±1.91 Na (mmol/l) ± ±0.88 K (mmol/l) 4.65± ±0.08 Cl (mmol/l) ± ±1.41 ALT (U/L) ± ±23.08 AST (U/L) ± ±24.23 ALP (U/L) ± ±19.72 BUN (mmol/l) 6.43± ±0.77 CREA (µmol/l) ± ±1.26 GLU (mmol/l) 7.52 ± ±0.56 TBIL (µmol/l) 1.27 ± ±0.56 Male CHOL (mmol/l) ALB (g/l) 0.91 ± ± ± ±1.50 TP (g/l) CK (U/L) ± ± ± ±73.76 TG (mmol/l) 0.31 ± ±0.07 GGT(U/L) 0.69 ± ±0.10 DBIL (µmol/l) 0.99 ± ±0.51 A/G 2.76 ± ±0.24 GLO (g/l) ± ±0.96* Na (mmol/l) ± ±0.99 K (mmol/l) 4.40 ± ±0.19 Cl (mmol/l) ± ±2.81 *, p < 0.05, **, p < 0.01 compared with vehicle group. ALT: alanine aminotransferase; AST: aspartate aminotransferase; ALP: alkaline phosphatase; BUN: blood urea nitrogen; CREA: creatinine;glu: glucose; TBIL: total bilirubin; CHOL: total cholesterol; TP: total protein; ALB: albumin; CK: creatine phosphokinase; TG: triglycerides; GTT: gamma-glutamyl transpeptidase; DBIL: direct bilirubin; A/G: albumin-globulin ratio; GLO: globulin.

5 Supplementary Figure 1. Identification of ZLN027 and ZLN005 by HTS in HEK293 cells. A: Compound structure of ZLN027. B: Effect of ZLN027 and ZLN005 in HEK293 PGC-1α-luc stable cells. FSK (5 µm) and DEX (100 nm) as positive control. Luciferin signal was normalized by cell survival of the cells. C: Effect of ZLN027 and ZLN005 in luciferase enzyme, black circles, = ZLN005, white squares, = ZLN027. D-E: 24 h SRB results of ZLN027 and ZLN005 on HEK293 PGC-1α-luc stable cells and L6 myotubes.*, p < 0.05, **, p < 0.01 compared with DMSO.

6 Supplementary Figure 2. ZLN005 has no effect on AMPK pathway in primary hepatocytes. A: Effect of ZLN005 on the AMPK, CREB and p38 phosphorylation by western blots for 24 h. B: Effect of ZLN005 on the AMPK and ACC phosphorylation by western blots for 3 h. C: Effect of ZLN005 and CCCP on the rat liver tissue mitochondria respiration. D: Effect of ZLN005 and CCCP on ADP/ATP ratio AMPK in rat primary hepatocytes for 3 h.

7 Supplementary Figure 3. AMPK and ACC phosphorylation from the abdominal muscle (A) and liver tissue (B) of lean mice. The ratio of the phosphorylation level to the protein level of AMPK and ACC was determined.