3-D culture of BRAF- and KRAS-mutated Erdheim-Chester. disease tissues: impact of kinase inhibitors
|
|
|
- Sybil Banks
- 5 years ago
- Views:
Transcription
1 3-D culture of BRAF- and KRAS-mutated Erdheim-Chester disease tissues: impact of kinase inhibitors Marina Ferrarini, MD Division of Experimental Oncology San Raffaele Scientific Institute, Milano 5 th Annual ECD Medical Symposium New York, NY October 26, 216
2 A unifying disease model for ECD BRAF V6E p16 Ink4a Cavalli et al, 214 C. Doglioni
3 vemurafenib treatment in Erdheim-Chester disease
4 vemurafenib in Erdheim-Chester disease: unsolved issues BRAF V6E is a targetable oncogene in ECD, however: not all ECD patients bear the BRAF V6E mutation or known targetable mutations vemurafenib treatment mostly results in partial clinical responses in ECD patients vemurafenib treatment is often associated with severe side effects and relapses upon treatment discontinuation
5 RCCS TM bioreactor preserves architecture of normal and cancer tissues Dynamic condition D2-4 Skin Bone Marrow RCC D2-4 vwb/dapi Static condition 2 weeks Ferrarini et al, 213
6 Effects of vemurafenib on BRAF-mutated melanoma cells cells x day 3 LM16 vem (6 µμ) % PI LM16 LM16R % PI day 6 LM16R vem (µm) tr (nm) perk Ki-67 p16 LM16 Vem pg/ml pg/ml Vem LM16R 3 IL-1β IL-6 TNF-α CCL2 CCL4 4 CXCL8 TGF-β
7 Cytokine- and BRAF-inhibitors affect cytokine release from ECD tissues ECD 1 M/46-year-old xanthelasma ECD 2 F/5-year-old xanthelasma ECD 3 F/69-year-old pleural lesion TNF-α VEM IFX IL-8 IL-6 IL-1β stnf-rii stnf-ri pg/ml ng/ml pg/ml pg/ml ng/ml pg/ml pg/ml ng/ml pg/ml CCL4 CCL pg/ml pg/ml pg/ml VEM in vivo
8 Vemurafenib affects cytokine production but not histiocyte viability CD68 CD68 perk TNF-α Caspase 3 vem
9 BRAF-mutation and metabolism in ECD histiocytes ECD ECD HepG2
10 Effects of vemurafenib on BRAF-mutated ECD histiocytes: metabolism lactate (mm/l) TCM Skin ECD1 ECD1 Vem ECD2 ECD2 Vem ECD3 ECD3 Vem vem
11 trametinib inhibits cyto-chemokine release by KRAS-mutated histiocytes in vitro and ex-vivo Patient 4 BRAFwt, KRAS G12V xanthelasma IL-1β (pg/ml) TNF-α (pg/ml) tr days 6 3 ECD histiocytes ,6% 26,48% ECD monocytes CCL-2 (pg/ml) 4 2 CCL-4 (pg/ml) 2 1 tr CD14 FL5 Log CD days ,7%,76% FL1 Log perk ECD HM trametinib - + perk Erk perk/erk.46.6 pakt Akt pakt/akt perk ECD HM Red Oil IL-1β, TNF-α (pg/ml) IL-6 (ng/ml) IL-1 IL-6 TNF CCL2 (ng/ml) CCL4 (pg/ml) CCL2 CCL4 Tr
12 trametinib CD perk 12 lactate (mm/l) 8 4 TCM skin tr Glucose (mg/dl) ph 3 TCM skin tr 6 tr trametinib ECD - + βactin /βactin.37.7
13 Conclusions 3-D dynamic culture in bioreactor of ECD tissues is suitable for drug testing vemurafenib and trametinib affect cytokine and chemokine production but not viability of ECD histiocytes in short-term culture kinase inhibitors counteract the up-regulated aerobic glycolysis in BRAFmutated and KRAS-mutated ECD histiocytes The technology can be further exploited as a novel tool to investigate ECD pathophysiology and also to identify mechanisms of action of BRAF/MEK inhibitors on ECD histiocytes for future combination therapies
14 Acknowledgements Daniela Belloni Silvia Heltai Elisabetta Ferrero Marina Ferrarini Division of Experimental Oncology San Raffaele Scientific Institute, Milano Giulia Cangi Claudio Doglioni Pathology Unit San Raffaele Scientific Institute, Milano Giulio Cavalli Alvise Berti Corrado Campochiaro Lorenzo Dagna Unit of Medicine and Clinical Immunology San Raffaele Scientific Institute, Milano Cristina Colarossi Antonella Stoppacciaro University La Sapienza, Rome Monica Rodolfo Licia Rivoltini Istituto Nazionale Tumori, Milano Barbara Vergani Antonello Villa Consorzio MIA University of Milano-Bicocca Riccardo Biavasco Eugenio Montini SR-Tiget San Raffaele Scientific Institute, Milano Kathy Brewer ECD Global Alliance, DeRidder, LA
15
16
17 Vemurafenib affects cytokine production but not histiocyte viability CD68 Caspase 3 p16 Ink4a perk TNF-α vem
18 Effects of vemurafenib on BRAF-mutated ECD histiocytes: metabolism 25 2 Glucose (mg/dl) vem lactate (mm/l) TCM Skin ECD1 ECD1 Vem ECD2 ECD2 Vem ECD3 ECD3 Vem TCM LM16 LM16 Vem
19 trametinib CD68 perk lactate (mm/l) 8 4 Glucose (mg/dl) ph TCM skin tr TCM skin tr tr trametinib ECD - + βactin Casp-3 /βactin.37.7
20 CD68 Caspase 3 TNF-α p16 Ink4a β-galactosidase vem ECD3 Glucose (mg/dl) HepG2 8 6 vem lactate (mm/l) 4 2 TCM Skin ECD ECD Vem
21 Patient 4 BRAFwt, KRAS G12V xanthelasma IL-1β (pg/ml) TNF-α (pg/ml) tr days ,6% 26,48% trametinib perk ECD - + HM vem LM CCL-2 (pg/ml) CCL-4 (pg/ml) tr days CD14 FL5 Log ,7%,76% FL1 Log perk Erk perk/erk.46.6 pakt Akt pakt/akt IL-1β, TNF-α (pg/ml) IL-6 (ng/ml) IL-1 IL-6 TNF CCL2 (ng/ml) CCL4 (pg/ml) CCL2 CCL4 Tr
22 Effects of vemurafenib on BRAF-mutated ECD histiocytes: metabolism 25 Glucose (mg/dl) vem lactate (mm/l) TCM Skin ECD1 ECD1 Vem ECD2 ECD2 Vem ECD3 ECD3 Vem
23 BRAF-mutation and metabolism in ECD histiocytes ECD ECD3 1 5 CD HepG2
ECD Global Alliance Synopsis of the 2014 International Erdheim-Chester Disease Medical Symposium
September 18, 2014 NIH, Bethesda, Maryland ECD Global Alliance Synopsis of the 2014 International Erdheim-Chester Disease Medical Symposium On September 18 th 2014, the second International ECD Global
ECD Global Alliance Synopsis of 2013 Erdheim-Chester Medical Symposium (October 31, 2013)
ECD Global Alliance Synopsis of 2013 Erdheim-Chester Medical Symposium (October 31, 2013) The following information was compiled by non-medically qualified volunteers, and has not been reviewed by medical
NGR-TNF selectively binds to tumor blood vessels via CD13, inducing the activation of caspases and promoting apoptotic endothelial cell death in vivo
AACR 100 th Annual Meeting 2009 Denver NGR-TNF selectively binds to tumor blood vessels via CD13, inducing the activation of caspases and promoting apoptotic endothelial cell death in vivo The NGR-hTNF
perk/erk STAT5B
pakt/akt relative to saline (fold).5.5.5 control perk/erk relative to saline (fold).6.4..8.6.4. p=.6 control db/+ Hsp6 VDAC Hsp6/VDAC (relative to db/+) 8 6 4 db/+ C db/+ Hsp6 Hsp6/actin (relative to db/+)
ADULT-ONSET (INFRATENTORIAL) LEUKOENCEPHALOPATHY as PRESENTING MANIFESTATION of ERDHEIM-CHESTER DISEASE
ADULT-ONSET (INFRATENTORIAL) LEUKOENCEPHALOPATHY as PRESENTING MANIFESTATION of ERDHEIM-CHESTER SEASE GIULIO CAVALLI, M.D. INTERNAL MECINE AND CLINICAL IMMUNOLOGY IRCCS SAN RAFFAELE HOSPITAL VITA-SALUTE
Histology independent indications in oncology. The BRAF Story. Yibing Yan PhD Roche / Genentech
Histology independent indications in oncology The BRAF Story Yibing Yan PhD Roche / Genentech 1 Introduction the discovery Case study in BRAF mutant melanoma heterogeneity within the tumour variability
Immunohistochemical Evidence of a Cytokine and Chemokine Network in Three Patients With Erdheim-Chester Disease
ARTHRITIS & RHEUMATISM Vol. 54, No. 12, December 2006, pp 4018 4022 DOI 10.1002/art.22280 2006, American College of Rheumatology Immunohistochemical Evidence of a Cytokine and Chemokine Network in Three
Page 39 of 44. 8h LTA & AT h PepG & AT h LTA
Page 39 of 44 Fig. S1 A: B: C: D: 8h LTA 8h LTA & AT7519 E: F: 8h PepG G: 8h PepG & AT7519 Fig. S1. AT7519 overrides the survival effects of lipoteichoic acid (LTA) and peptidoglycan (PepG). (A) Human
Pre-clinical PK/PD modelling of combination therapies in oncology: abemaciclib and vemurafenib
Pre-clinical PK/PD modelling of combination therapies in oncology: abemaciclib and vemurafenib Combination Therapies in Oncology Combination therapies in oncology have been explored and used for many decades
Erdheim Chester Disease Mark Heaney MD PhD
Erdheim Chester Disease 2017 Mark Heaney MD PhD Erdheim-Chester Disease Described as Lipid Granulomatosis by Jakob Erdheim and William Chester in 1930 Lipid-laden macrophages and Touton giant cells CD
BRAF: dal melanoma alla HCL
ISTITUTO NAZIONALE PER LO STUDIO E LA CURA DEI TUMORI FONDAZIONE G. Pascale NAPOLI SC Biologia Cellulare e Bioterapie CENTRO RICERCHE ONCOLOGICHE MERCOGLIANO (AV) Laboratorio di Farmacogenomica BRAF: dal
Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies
Complexity of intra- and inter-pathway loops in colon cancer and melanoma: implications for targeted therapies René Bernards The Netherlands Cancer Institute Amsterdam The Netherlands Molecular versus
Clinical and positron emission tomography responses to long-term high-dose interferon-α treatment among patients with Erdheim Chester disease
Cao et al. Orphanet Journal of Rare Diseases (2019) 14:11 https://doi.org/10.1186/s13023-018-0988-y RESEARCH Open Access Clinical and positron emission tomography responses to long-term high-dose interferon-α
2013 Erdheim-Chester Disease
2013 Erdheim-Chester Disease International Medical Symposium Hosted by the ECD Global Alliance SUPPORT/OUTREACH RESEARCH AWARENESS COLLABORATION TRIALS/STUDIES TREATMENT DIAGNOSIS/PROGNOSIS www.erdheim-chester.org
P-Akt Thr308. T-Akt *** *** Anti-α3 IgG Ctrl
P-Akt Thr38 P-Akt Thr38 Relative pakt (Thr38) expression (normalized to total Akt) Anti-α3 IgG Anti-α3 IgG V Fig. 1. 3 or 1 integrin blockade effects on Akt Thr38 phosphorylation. Western blotting analysis
ABSTRACT INTRODUCTION
/, Vol. 6, No. 28 Combination of antibodies directed against different ErbB3 surface epitopes prevents the establishment of resistance to BRAF/MEK inhibitors in melanoma Luigi Fattore 1,2, Debora Malpicci
Personalized medicine - cancer immunotherapy
Personalized medicine - cancer immunotherapy Özcan Met, PhD Senior Staff Scientist, Cell Therapy Director Center for Cancer Immune Therapy Department of Hematology Department of Oncology University Hospital
Erdheim-Chester disease and Skin issues
Erdheim-Chester disease and Skin issues STÉPHANE BARETE, MD, PHD UNIT OF DERMATOLOGY PITIÉ -SALPÊTRIÈRE HOSPITAL PARIS stephane.barete@aphp.fr Introduction Erdheim-Chester (ECD) is an orphan disease included
Supplementary Figure 1. a. b. Relative cell viability. Nature Genetics: doi: /ng SCR shyap1-1 shyap
Supplementary Figure 1. a. b. p-value for depletion in vehicle (DMSO) 1e-05 1e-03 1e-01 1 0 1000 2000 3000 4000 5000 Genes log2 normalized shrna counts in T0 0 2 4 6 8 sh1 shluc 0 2 4 6 8 log2 normalized
Clinical molecular profiling to detect targetable alterations in archival tumor tissue and cell-free DNA from patients with Erdheim-Chester disease
ECD International Medical Symposium Paris, France September 15, 2016 Clinical molecular profiling to detect targetable alterations in archival tumor tissue and cell-free DNA from patients with Erdheim-Chester
Erdheim-Chester disease and knee pain in a dialysis patient
Repository of the Max Delbrück Center for Molecular Medicine (MDC) Berlin (Germany) http://edoc.mdc-berlin.de/14296/ Erdheim-Chester disease and knee pain in a dialysis patient Rademacher, S., Anagnostopoulos,
ERDHEIM-CHESTER DISEASE LUNG & HEART ISSUES
ERDHEIM-CHESTER DISEASE LUNG & HEART ISSUES GIULIO CAVALLI, M.D. INTERNAL MEDICINE AND CLINICAL IMMUNOLOGY IRCCS SAN RAFFAELE HOSPITAL VITA-SALUTE SAN RAFFAELE UNIVERSITY MILAN, ITALY cavalli.giulio@hsr.it
Response and resistance to BRAF inhibitors in melanoma
Response and resistance to BRAF inhibitors in melanoma Keith T. Flaherty, M.D. Massachusetts General Hospital Cancer Center Disclosures Roche/Genentech: consultant GlaxoSmithKline: consultant BRAF mutations
Normal RAS-RAF (MAPK) pathway signaling
BRAF-Mutations in Melanomas L. Mazzucchelli Istituto Cantonale di Patologia, Locarno 77. Annual Meeting Swiss Society of Pathology, Lucerne 2011 Sponsored by Roche Pharma Switzerland Melanoma has increased
Black is the New Black or How I learned to stop worrying and love melanoma (with apologies to Dr. Strangelove)
Black is the New Black or How I learned to stop worrying and love melanoma (with apologies to Dr. Strangelove) Provincial Cancer Care Conference 2018 Ralph P.W. Wong MD FRCPC St Boniface Site Director
Role of endogenous ROS in pancreatic β-cell dysfunction
Role of endogenous ROS in pancreatic β-cell dysfunction Chiba University Graduate School of Medicine Eri Mukai The effect of endogenous ROS on metabolismsecretion coupling Glucose β-cell H O O - Metabolism
Rationale and results from. BRAFi and immunotherapy
Rationale and results from emerging combinations of BRAFi and immunotherapy Antoni Ribas, M.D. rofessor of Medicine rofessor of Surgery rofessor of Molecular and Medical harmacology Director, Tumor Immunology
Cytokines. Luděk Šefc. Cytokines Protein regulators of cellular communication. Cytokines x hormones
Cytokines Luděk Šefc Cytokines Protein regulators of cellular communication Cytokines x hormones Hormones Cytokines Production sites few many Cell targets few many Presence in blood yes rarely Biological
AACR 101st Annual Meeting 2010, Washington D.C. Experimental and Molecular Therapeutics Section 29; Abstract #3855
Investigation of the Growth Inhibitory Activity of the MEK Inhibitor ARRY-162 in Combination with Everolimus in a Variety of KRas and PI3K Pathway Mutant Cancers Brian Tunquist, Tyler Risom, Debbie Anderson,
Supplemental Figure 1.
antifas CD40L 0 15 30 60 0 15 30 60 min piκbα IκBα p38 Supplemental Figure 1. CD40L and antifas stimulation induces NFkB activation. BMDM were stimulated with CD40L (1ug/ml) or antifas (10ug/ml). Cell
SUPPLEMENTARY INFORMATION
doi:10.1038/nature23291 Supplementary discussion part 1 Our model suggests that, in tumours that express Class 3 BRAF mutants and activated RAS, both BRAF MUT /RAF WT heterodimers and WT RAF dimers are
New paradigms for treating metastatic melanoma
New paradigms for treating metastatic melanoma Paul B. Chapman, MD Melanoma Clinical Director Melanoma and Immunotherapeutics Service Memorial Sloan Kettering Cancer Center, New York 20 th Century Overall
Insights into the Cell-of-Origin of the Histiocytoses Using Patient-Derived Xenograft Models
Insights into the Cell-of-Origin of the Histiocytoses Using Patient-Derived Xenograft Models 4 th Annual International Erdheim-Chester Disease Medical Symposium Paris, France September 15, 2016 Benjamin
1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance. 13/10/2017 Sara Redaelli
Dott.ssa Sara Redaelli 13/10/2017 1.Basis of resistance 2.Mechanisms of resistance 3.How to overcome resistance Tumor Heterogeneity: Oncogenic Drivers in NSCLC The Promise of Genotype-Directed Therapy
a. b. c. d. e. f. g. h. i. j. k. l. m. n. o. p.
a. b. c. d. e. f. g. h. i. j. k. l. 2.5 2 1.5 1.5 IL-1β 12 8 6 4 2 IL-1β 9 8 7 6 4 3 3 2.9 IL-1β m. n. o. p. 1.8 1.6 1.4 1.2 1.8.6.4.2 6h LPS 2 15 1 5 6h LPS 2 6h LPS 6 4 3 6h LPS Supplementary Figure
Clinical molecular profiling of archival tumor tissue and cell-free DNA from patients with Erdheim-Chester disease
ECD International Medical Symposium New York City October 26, 2017 Clinical molecular profiling of archival tumor tissue and cell-free DNA from patients with Erdheim-Chester disease Filip Janku, Eli Diamond,
Translating Research into Clinical Practice: Strategies Against Hepatocellular Cancer
Translating Research into Clinical Practice: Strategies Against Hepatocellular Cancer Kevin Staveley-O Carroll, PhD, MD, FACS Professor and Chair, Department of Surgery Director of the Ellis Fischel Cancer
Immunotherapy in Unresectable or Metastatic Melanoma: Where Do We Stand? Sanjiv S. Agarwala, MD St. Luke s Cancer Center Bethlehem, Pennsylvania
Immunotherapy in Unresectable or Metastatic Melanoma: Where Do We Stand? Sanjiv S. Agarwala, MD St. Luke s Cancer Center Bethlehem, Pennsylvania Overview Background Immunotherapy clinical decision questions
39th Annual ESDR Meeting, Budapest, Hungary
39th Annual ESDR Meeting, Budapest, Hungary Inhibition of Apoptosis-Driven Regression of Hair Bulb Giuliani G1, Benedusi A1, Marzani B1, Carelli S2, Traversa M2, Di Giulio A2, Gorio A2 1 Giuliani SPA,
Differential AKT dependency displayed by mouse models of BRAF V600E -initiated melanoma
Research article Differential AKT dependency displayed by mouse models of BRAF V600E -initiated melanoma Victoria Marsh Durban, 1 Marian M. Deuker, 1 Marcus W. Bosenberg, 2 Wayne Phillips, 3 and Martin
Update on Targeted Therapy in Melanoma
Update on Targeted Therapy in Melanoma Seville June 2013 James Larkin FRCP PhD London UK Overview What are the targets in melanoma? BRAF / KIT / NRAS / GNAQ / MEK DNA / microtubules CTLA4 / PD1 / PDL1
Adenovirus engineered human dendritic cell vaccine induces natural killer cell chemotaxis
Adenovirus engineered human dendritic cell vaccine induces natural killer cell chemotaxis via CXCL8/IL 8 and CXCL10/IP 10 chemokines Lazar Vujanović, Ph.D. Research Instructor P.I. Lisa H. Butterfield,
Nature Medicine: doi: /nm.4078
Supplementary Figure 1. Cetuximab induces ER stress response in DiFi cells. (a) Scheme of SILAC proteome. (b) MS-base read out of SILAC experiment. The histogram of log 2 -transformed normalized H/L ratios
Is there a Cookbook for Oncology Clinical Trials?
Masterclass for Masters See beyond : An Oncology Brainstorm Ghent, 16th of September 2016 Is there a Cookbook for Oncology Clinical Trials? Dimitrios Zardavas MD Associate Scientific Director, Breast International
Supplementary Figure 1
Supplementary Figure 1 Supplementary Figure 1: Generation of cetuximab-resistant cells and analysis of singlecell clones. Cetuximab-sensitive cells (LIM1215 and OXCO-2) were chronically treated with cetuximab
4. Th1-related gene expression in infected versus mock-infected controls from Fig. 2 with gene annotation.
List of supplemental information 1. Graph of mouse weight loss during course of infection- Line graphs showing mouse weight data during course of infection days 1 to 10 post-infections (p.i.). 2. Graph
Supplementary Figure 1
Supplementary Figure 1 60 HRAS G12V 40 * 55 35 Percent BRDU Positive 50 45 40 30 20 NS Percent BRDU Positive 30 25 20 15 10 NS 10 5 0 -dox dox doxkt5720 -doxkt5720 Treatment TSHKT5720 0 -dox dox doxkt5720
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and
Supplementary Figure 1. SA-β-Gal positive senescent cells in various cancer tissues. Representative frozen sections of breast, thyroid, colon and stomach cancer were stained with SA-β-Gal and nuclear fast
Supplementary Materials
Supplementary Materials Figure S1. MTT Cell viability assay. To measure the cytotoxic potential of the oxidative treatment, the MTT [3-(4,5-dimethylthiazol- 2-yl)-2,5-diphenyl tetrazolium bromide] assay
RAS and RAF Signalling in Melanoma: Biology and Therapies Professor Richard Marais
RAS and RAF Signalling in Melanoma: Molecular Oncology, The Institute of Cancer Research, UK 1 Melanoma Melanocytes are specialised pigment cells - Skin, eyes, ear, brain, heart - Skin/hair tone - Protection
Characterization of TRK fusions and therapeutic response to TRK inhibition in hematologic malignancies
Characterization of TRK fusions and therapeutic response to TRK inhibition in hematologic malignancies Taylor J, 1 Yoshimi A 1, Marcelus C 1, Pavlick D 2, Benayed R 1, Cocco E 1, Durham BH 1, Hechtman
Diffuse reduction of cerebral grey matter volumes in Erdheim-Chester disease
Diamond et al. Orphanet Journal of Rare Diseases (2016) 11:109 DOI 10.1186/s13023-016-0490-3 LETTER TO THE EDITOR Open Access Diffuse reduction of cerebral grey matter volumes in Erdheim-Chester disease
Identification of MET and SRC Activation in Melanoma Cell Lines Showing Primary Resistance to PLX4032 1,2
Volume 13 Number 12 December 2011 pp. 1132 1142 1132 www.neoplasia.com Identification of MET and SRC Activation in Melanoma Cell Lines Showing Primary Resistance to PLX4032 1,2 Elisabetta Vergani*, Viviana
Tumor associated macrophages in endocrine-related cancers. Sun Wook Cho, M.D, Ph.D Seoul National University Hospital
Tumor associated macrophages in endocrine-related cancers Sun Wook Cho, M.D, Ph.D Seoul National University Hospital Tumor Microenvironment Fibroblasts Immune cells Angiogenesis Tumor microenvironment=cancer
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
6/7/16. Melanoma. Updates on immune checkpoint therapies. Molecularly targeted therapies. FDA approval for talimogene laherparepvec (T- VEC)
Melanoma John A Thompson MD July 17, 2016 Featuring: Updates on immune checkpoint therapies Molecularly targeted therapies FDA approval for talimogene laherparepvec (T- VEC) 1 Mechanism of ac-on of Ipilimumab
Nature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 EGFR inhibition activates signaling pathways (a-b) EGFR inhibition activates signaling pathways (a) U251EGFR cells were treated with erlotinib (1µM) for the indicated times followed
Targeting the PI3K-Akt-mTOR pathway with GDC-0068, a novel selective ATP competitive Akt inhibitor
Targeting the PI3K-Akt-mTOR pathway with GDC-0068, a novel selective ATP competitive Akt inhibitor Josep Tabernero, Andrés Cervantes, Cristina Saura, Desamparados Roda, Yibing Yan, Kui Lin, Sumati Murli,
Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer
S1 of S6 Supplementary Methods: IGFBP7 Drives Resistance to Epidermal Growth Factor Receptor Tyrosine Kinase Inhibition in Lung Cancer Shang-Gin Wu, Tzu-Hua Chang, Meng-Feng Tsai, Yi-Nan Liu, Chia-Lang
are associated with sickle cell disease and carriers: a study of patients from the southeastregion of Iran
CXC chemokines CXCL1, CXCL9, CXCL10 and CXCL12 are associated with sickle cell disease and carriers: a study of patients from the southeastregion of Iran Mojgan Noroozi Karimabad Molecular Medicine Research
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
Nori Rabbit IL-2 ELISA Kit DataSheet
Nori Rabbit IL-2 ELISA Kit DataSheet IL-2 is an interleukin, a type of cytokine immune system signaling molecule. IL-2 is a T cell stimulatory cytokine best known for inducing T cell proliferation, the
Locally Advanced and Metastatic Melanoma. Relevant disclosures 6/23/2018. What is the median survival of metastatic melanoma? Abel D.
Locally Advanced and Metastatic Melanoma Abel D. Jarell, MD, FAAD Adjunct Dartmouth School of Medicine, Hanover, NH Northeast Dermatology Associates, Portsmouth, NH Relevant disclosures What is the median
Targeting tumour associated macrophages in anti-cancer therapies. Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018
Targeting tumour associated macrophages in anti-cancer therapies Annamaria Gal Seminar Series on Drug Discovery Budapest 5 January 2018 Macrophages: Professional phagocytes of the myeloid lineage APC,
Identification of BRAF mutations in melanoma lesions with the Roche z480 instrument
Identification of BRAF mutations in melanoma lesions with the Roche z480 instrument Márta Széll IAP, Siófok May 14, 2012 Multifactorial skin diseses: much more frequent then genodermatoses exhibit familial
Melanoma. Il parere dell esperto. V. Ferraresi. Divisione di Oncologia Medica 1
Melanoma Il parere dell esperto V. Ferraresi Divisione di Oncologia Medica 1 MELANOMA and ESMO 2017.what happens? New data and updates ADJUVANT THERAPY with CHECKPOINT INHIBITORS (CA209-238 trial) AND
Melanoma: From Chemotherapy to Targeted Therapy and Immunotherapy. What every patient needs to know. James Larkin
Melanoma: From Chemotherapy to Targeted Therapy and Immunotherapy What every patient needs to know James Larkin Melanoma Therapy 1846-2017 Surgery 1846 Cytotoxic Chemotherapy 1946 Checkpoint Inhibitors
Overexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma
Overexpression of Mcl-1 confers resistance to BRAFV600E inhibitors alone and in combination with MEK1/2 inhibitors in melanoma The Harvard community has made this article openly available. Please share
Erdheim-Chester Disease Involving Lymph Nodes and Liver Clinically Mimicking Lymphoma: A Case Report
Journal of Pathology and Translational Medicine 2018; 52: 183-190 CASE STUDY Erdheim-Chester Disease Involving Lymph Nodes and Liver Clinically Mimicking Lymphoma: A Case Report Yeoun Eun Sung 1 * Yoon
MELANOMA: THE BEST OF THE YEAR Dott.ssa Silvia Quadrini UOC Oncologia ASL Frosinone
MELANOMA: THE BEST OF THE YEAR 2018 Dott.ssa Silvia Quadrini UOC Oncologia ASL Frosinone The Best of the Year 2018: MELANOMA CHIRURGIA TERAPIA ADIUVANTE TERAPIA PER MALATTIA AVANZATA The Best of the Year
Antitumor activity of the ERK inhibitor SCH against BRAF mutant, NRAS mutant and wild-type melanoma
Wong et al. Molecular Cancer 2014, 13:194 RESEARCH Open Access Antitumor activity of the ERK inhibitor SCH722984 against BRAF mutant, NRAS mutant and wild-type melanoma Deborah JL Wong 1, Lidia Robert
Convergent and Divergent Mechanisms in Aging and Cancer
Convergent and Divergent Mechanisms in Aging and Cancer Mariana S. De Lorenzo, PhD Department of Cell Biology & Molecular Medicine delorems@umdnj.edu LEARNING OBJECTIVES 1. To identify convergent and divergent
BRAF/MEK inhibitors in the systemic treatment of advanced skin melanoma
QUALITY OF LIFE IN ONCOLOGY Review article BRAF/MEK inhibitors in the systemic treatment of advanced skin melanoma Maksymilian Kruczała, Aleksandra Grela-Wojewoda, Marek Ziobro Clinic of Systemic and Metastatic
Disclosure Information. Mary L. Disis
Disclosure Information Mary L. Disis I have the following financial relationships to disclose: Consultant for: VentiRx, Celgene, Emergent, EMD Serono Speaker s Bureau for: N/A Grant/Research support from:
Innovations in Immunotherapy - Melanoma. Systemic Therapies October 27, 2018 Charles L. Bane, MD
Innovations in Immunotherapy - Melanoma Systemic Therapies October 27, 2018 Charles L. Bane, MD Melanoma Prognosis Survival at 10 years Stage I: 90% Stage II: 60% Stage III: 40% Stage IV: 10% 2 Indications
INTRODUCTION DIAGNOSIS IMAGING MANAGEMENT CONCLUSIONS
Aitor Lasarte 1, MD; Teodoro Martín 2, MD; Patricia Novas 3, MD; Mª Ángeles Sala 3, MD; Mikel Beristain 4 MD; Enrique Marco de Lucas 5 MD; Silvia Bagué 6 MD; Raúl Pellón 5 MD. 1. Department of Radiology,
Data Package. Multiplex Oncology I 96 96
Data Package Multiplex Oncology I 96 96 Table of contents 1. Introduction 3 1.1 Technology 3 1.2 Data analysis 3 2. Performance characteristics 4 2.1 Sample types 4 2.2 Analytical Measurement 4 Detection
KEY CONCEPT QUESTIONS IN SIGNAL TRANSDUCTION
Signal Transduction - Part 2 Key Concepts - Receptor tyrosine kinases control cell metabolism and proliferation Growth factor signaling through Ras Mutated cell signaling genes in cancer cells are called
Subject: Cobimetinib (Cotellic ) Tablet
09-J2000-53 Original Effective Date: 03/15/16 Reviewed: 11/14/18 Revised: 12/15/18 Subject: Cobimetinib (Cotellic ) Tablet THIS MEDICAL COVERAGE GUIDELINE IS NOT AN AUTHORIZATION, CERTIFICATION, EXPLANATION
Disclosure of conflicts of interest
A-908-0015-00412 Disclosure of conflicts of interest 1. Employment or Leadership Position None 2. Advisory Role or Expert Testimony None 3. Stock Ownership None 4. Patent, Copyright, Licensing None 5.
Nature Immunology: doi: /ni.3866
Nature Immunology: doi:10.1038/ni.3866 Supplementary Figure 1 The effect of TIPE2 on chemotaxis. a, The expression of TIPE2 in dhl-60c, dhl-60t, TIPE2-expressing and 15/16Q-expressing dhl-60t neutrophils
Phase 1 Study Combining Anti-PD-L1 (MEDI4736) With BRAF (Dabrafenib) and/or MEK (Trametinib) Inhibitors in Advanced Melanoma
Phase 1 Study Combining Anti-PD-L1 (MEDI4736) With BRAF (Dabrafenib) and/or MEK (Trametinib) Inhibitors in Advanced Melanoma Abstract #3003 Ribas A, Butler M, Lutzky J, Lawrence D, Robert C, Miller W,
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth.
Supplementary Information Supplementary Fig. 1. Elevated Usp9x in melanoma and NRAS mutant melanoma cells are dependent on NRAS for 3D growth. a. Immunoblot for Usp9x protein in NRAS mutant melanoma cells
Emerging Targets in Immunotherapy
Emerging Targets in Immunotherapy So Jin Shin, M.D. Department of Obstetrics and Gynecology, Keimyung University, School of Medicine, Daegu, Korea no-0ncology Todays is.. ancer Immunotherapy? nd immunotherapy
Liquid biopsies to track clonal evolution and resistance to EGFR inhibition in mcrc
Liquid biopsies to track clonal evolution and resistance to EGFR inhibition in mcrc Alberto Bardelli Candiolo Cancer Center IRCCs University of Torino - Medical School Disclosures Horizon discovery Biocartis
Quantitative Real-Time PCR was performed as same as Materials and Methods.
Supplemental Material Quantitative Real-Time PCR Quantitative Real-Time PCR was performed as same as Materials and Methods. Expression levels in the aorta were normalized to peptidylprolyl isomerase B
Pushing the boundaries-targeted therapies
Pushing the boundaries-targeted therapies Professor Grant McArthur MB BS PhD Director Melanoma and Skin Cancer VCCC Parkville, Peter MacCallum Cancer Centre Lorenzo Galli Chair of Melanoma & Skin Cancers,
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated
Supplementary fig. 1. Crystals induce necroptosis does not involve caspases, TNF receptor or NLRP3. A. Mouse tubular epithelial cells were pretreated with zvad-fmk (10µM) and exposed to calcium oxalate
ras Multikinase Inhibitor Multikinase Inhibitor 0.1
a ras ** * ** * ** ** ** ** un in et m lu Se ib SL G 32 W 7 So 50 ra 74 fe ni b LY W 294 or 0 tm 02 R an ap n a in Ev my er cin ol im BE us Z2 3 En P 5 za I13 st 0 au rin D as SP ati 60 nib C 012 is 5
K-Ras EGFR pegfr Tubulin. pplcγ 1. Mock EGF
shcttl shkras EGF + + 15 17 17 KRas EGFR pegfr 13 pplcγ 1 Level of pegfr (A.U.) 1 8 6 4 2 shkras Mock EGF Supplementary Figure S1. KRasdeficient pancreatic cancer cells retain normal RTK signalling. (a)
Human malignant mesothelioma is recapitulated in immunocompetent BALB/c mice
SUPPLEMENTARY MATERIAL Human malignant mesothelioma is recapitulated in immunocompetent BALB/c mice injected with murine AB cells Rosanna Mezzapelle 1, Eltjona Rrapaj 1,, Elena Gatti 1, Chiara Ceriotti
UNIVERSITÀ DEGLI STUDI DI MILANO Scuola di Dottorato in Scienze Biologiche e Molecolari. XXIV Ciclo
UNIVERSITÀ DEGLI STUDI DI MILANO Scuola di Dottorato in Scienze Biologiche e Molecolari XXIV Ciclo BRAF AND MAPK PATHWAY MOLECULES FOR TARGETED THERAPY OF MALIGNANT MELANOMA SDD: MED 16, BIO 11 Elisabetta
Translational Clinical Research, the Key to Personalised Healthcare in Practice
New Models of Collaborations with Academia to foster Translational Clinical Research, the Key to ersonalised Healthcare in ractice Exploratory Clinical Development World Europe Conference 2012 London,
SORAFENIB BLOCKS TUMOUR GROWTH, ANGIOGENESIS AND METASTATIC POTENTIAL IN PRECLINICAL MODELS OF OSTEOSARCOMA
SORAFENIB BLOCKS TUMOUR GROWTH, ANGIOGENESIS AND METASTATIC POTENTIAL IN PRECLINICAL MODELS OF OSTEOSARCOMA Ymera Pignochino, PhD Division of Medical Oncology IRCC - Candiolo - TO CLINICAL FEATURES OF
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as
Supplementary Figure 1. Basal level EGFR across a panel of ESCC lines. Immunoblots demonstrate the expression of phosphorylated and total EGFR as well as their downstream effectors across a panel of ESCC
Morphology Case Study. Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital
Morphology Case Study Presented by Niamh O Donnell, BSc, MSc. Medical Scientist Haematology Laboratory Cork University Hospital 41 year old male presented to GP for routine check-up in May 2011. FBC Results:
Tissue Factor/PAR2 signaling enhances the malignancy and radiation resistance of lung cancer brain metastases
Tissue Factor/PAR2 signaling enhances the malignancy and radiation resistance of lung cancer brain metastases Dusten Unruh, PhD 8 th Annual Brain Metastases Research and Emerging Therapy Conference Tissue
Adult Orbital Xanthogranulomatous Disease
Adult Orbital Xanthogranulomatous Disease Evening Specialty Conference: Ophthalmic Pathology Sunday, March 22, 2015 Lynn Schoenfield Associate Professor, Ohio State University Wexner Medical Center No
Supplementary Information. Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis.
Supplementary Information Protectin DX alleviates insulin resistance by activating a myokine-liver glucoregulatory axis. Phillip J. White, Philippe St-Pierre, Alexandre Charbonneau, Patricia Mitchell,
Urinary ctdna Platform for Diagnosis and Cancer Treatment Monitoring. Summit August 19,2015
Urinary ctdna Platform for Diagnosis and Cancer Treatment Monitoring Mark G. Erlander, Ph.D., CSO CHI Next Generation Summit August 19,2015 Circulating Tumor DNA (ctdna) Tumor cells Main Advantages of