Supplemental Materials, Nishimura et al, Page1 of 22 1

Size: px
Start display at page:

Download "Supplemental Materials, Nishimura et al, Page1 of 22 1"

Transcription

1 Supplemental Materials, Nishimura et al, Page of 5 Quantitative assessment of Pdx promoter activity in vivo using a secreted luciferase reporter system Wataru Nishimura, Koki Eto, Atsushi Miki, Motohito Goto, Miho Kawaguchi, Takao Nammo, Haruhide Udagawa, Masaki Hiramoto, Yukiko Shimizu, Tadashi Okamura, Toshiyoshi Fujiwara, Yoshikazu Yasuda and Kazuki Yasuda. 0 Supplemental Materials Supplemental Materials and Methods. Supplemental Figure Legends. Supplemental Tables (). Supplemental Figures (0) 9

2 Supplemental Materials, Nishimura et al, Page of SUPPLEMENTAL MATERIALS AND METHODS Cell Culture Rat β-cell line INS- was cultured in RPMI medium (Sigma, St. Louis, MO), with 0% fetal bovine serum (FBS; Thermo Scientific, Logan, UT), mm sodium pyruvate, 0 mm Hepes, 00 U/ml penicillin, 00 mg/ml streptomycin and 55 µm β-mercaptoethanol (Life Technologies, Carlsbad, CA). NIH-T cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Sigma) supplemented with 0% FBS, 00 U/ml penicillin and 00 mg/ml streptomycin. Mouse β-cell line MIN6 cells were cultured in DMEM with 5% FBS, 00 U/ml penicillin, 00 mg/ml streptomycin and 55 µm β-mercaptoethanol. All cell lines were cultured at 7 C under 5% CO Genotyping Genotyping of the mice was performed by NaOH extraction methods. Briefly, mm tails of the mice were cut and plated into the 96-well plate. 75µl of 5mM NaOH, 0.mM EDTA was added to each well, followed by placing the plates in the thermocycler at 98 for one hour, then the temperature was reduced to 5. 75µl of 0mM of Tris/HCl ph5.5 was added to each well, and was centrifuged at,000rpm for 5 minutes. µl of supernatant was used for PCR reaction with the primers (see Supplemental Table for information on the primers and see Supplemental Figure A for the results of PCR). In parallel, the plasma GLuc activity was measured as mentioned below (Supplemental Figure BC). The plasma GLuc activity of genotype positive mice varies even within the same line, which can be divided into the two groups (Supplemental Figure C), and transgenic mice with high GLuc activity were analyzed in this study. 5 Islet Isolation Mice were deeply anesthetized followed by cervical dislocation. A laparotomy was performed, and the pancreas was exposed. One milliliter of collagenase solution (Liberase-TL; Roche,

3 Supplemental Materials, Nishimura et al, Page of Indianapolis, IN) was injected into the pancreas via the common bile duct from the ampulla of Vater after the ligation of the distal common bile duct. The pancreas was removed and incubated in a water bath for 0 min at 7 C. The islets were separated by a density gradient (Histopaque-08 and 9; Sigma) and centrifuged at 60g for 0 min. The islets were handpicked and cultured overnight in RPMI-60 supplemented with 0% FBS, mm sodium pyruvate, 0 mm Hepes, 00 U/ml penicillin and 00 mg/ml streptomycin. Islets of similar size were handpicked and cultured in 6-well dishes, followed by performance of the reporter assay, imaging or transplantation Preparation of Samples from Medium, Plasma or Organ Homogenates for Gaussia Luciferase Assay INS-, MIN6 and NIH-T cells were transfected with the indicated reporter plasmids and the psv-β-gal (Promega) or the pgl. vector (Promega) for the internal controls using Lipofectamine 000 (Life Technologies) according to the manufacturer's protocol. Forty-eight hours after the transfection, the culture medium was analyzed for Gaussia luciferase activity as described in the Materials and Methods, and the cells were examined for Firefly luciferase activity with the One-Glo luciferase assay system (Promega) or the β-gal assay as reported previously (8). The culture medium of the transgenic islets was also used for the assay. For both of these assays, 00 µl of culture medium was briefly centrifuged, and 0 µl were used for the luciferase assay. Blood from a tail snip was taken via heparinized tubes followed by centrifugation, and the plasma was taken, frozen with liquid nitrogen and kept at -80 C. Thawed samples were used after brief centrifugation. For the homogenates of organs or isolated islets, various organs from the mice were removed and frozen with liquid nitrogen after the injection of collagenase solution from the pancreatic duct followed by pancreatectomy for islet isolation. Samples were weighed and homogenized in a solution of 50 mm Tris/HCl at ph 8.0, 00 mm NaCl, and % Triton-X with the homogenizer Shakeman and.0 mm zirconia beads (Bio Medical Science, Tokyo, Japan), followed by centrifugation at 6,00g for

4 Supplemental Materials, Nishimura et al, Page of 5 minutes. Supernatants were diluted to a tenth of their original concentration in PBS and used for the reporter assay. The results of the luciferase activity derived from organ homogenates were normalized using protein concentrations as determined from a BCA assay Analysis of metabolic parameters Blood glucose values were measured on blood from tail snip using Glutest Ace-R and Glutest Sensor (Sanwa Kagaku Kenkyusho, Nagoya, Japan). For intraperitoneal glucose tolerance testing, mice were deprived of food for to 6 hours and blood glucose and body weight were measured prior to peritoneal injection of g / kg body weight glucose. Blood glucose was measure at the time point of 5, 0, 60 and 0 minutes after glucose loads. For insulin tolerance testing, mice were fasted for three hours, followed by the measurement of blood glucose and body weight. U/kg body weight of human regular insulin (Humalin R, Eli Lilly, Indianapolis) was injected and blood glucose levels were measured at the time point of 5, 0 and 60 minutes Assay of insulin secretion from isolated islets. 5 isolated islets from - to -month-old mice were manually selected, incubated in Krebs- Ringer solution, and stimulated at 7 C with indicated concentrations of either glucose or KCl for the indicated time period. The supernatants were then collected by centrifugation and were assayed for GLuc by luciferase assay or for insulin by ELISA (Shibayagi, Gunma, Japan). 0 5 The detailed information of immunohistochemistry and morphometric analysis for quantification Pancreatic samples were isolated in ice-cold PBS. Tissues were transferred to 0% sucrose in PBS at C overnight. Subsequently, tissues were transferred to a : 0% sucrose/oct compound solution for hours at C, followed by 00% OCT for hour at C, then were placed in OCT and kept at -80 C until sectioning. After cryosectioning, immunostaining analyses were performed after

5 Supplemental Materials, Nishimura et al, Page5 of incubation in % paraformaldehyde in 0.% Sorenson s Phosphate buffer as described previously (8) and in the Materials and Methods. See Supplemental Table for the list of the primary antibodies used in this study. For the quantification of the proportion of insulin positive cells expressing GLuc, totally 7 or 5 insulin positive cells in randomly selected sections of the transgenic pancreas or the transplanted islets (n=) were counted for the expression of GLuc. The data was presented as the percentage of GLuc positive cells per insulin positive cells. For the quantification of insulinexpressing or GLuc-expressing areas, sections of transgenic pancreas with or without surgery (n = for each group) were immunostained at 00-µm intervals to avoid measurement of the same islets twice. The images of entire pancreas were obtained by automatic scanning of BZ-9000 and analyzed with BZ-HC (Keyence, Osaka) Bioluminescence (BLI) A total of 00 µg of CTZ (500 µl of 00 µg/ml CTZ; approximately mg per kg body weight) was injected into the tail vein of 8 week-old mice anesthetized with isoflurane (% in 98% O ) (,8). For cultured islets, 5 µg of CTZ (5 µl of mg/ml CTZ) was added directly to -well plates containing 500 µl of islet culture medium. The mice and medium were analyzed using an IVIS Lumina II equipped with a charge-coupled device (CCD) camera (Xenogen/Caliper, Alameda, CA). BLI intensity was quantified using Living Image software (Xenogen) and by performing photoncounting measurements in equal-area regions of interest centered over the bioluminescent region. The stock solution of mg/ml CTZ in methanol with 0.M HCl was stored at 80 C, which was diluted in PBS with 5mM NaCl (ph7.) for the working solution and used after incubation for 0 minutes at room temperature with protection from light. 5 6 Islet Transplantation Mouse islets were transplanted under the kidney capsule of the male SCID mouse. The isolated islets were counted and aliquoted into groups of islets. The islets were then

6 Supplemental Materials, Nishimura et al, Page6 of centrifuged in PE50 polyethylene tubing (BD Bioscience, San Jose, CA) to form pellets. Male SCID mice were deeply anesthetized by intraperitoneal injection of 65 mg/kg body weight of the pentobarbital solution Somnopentyl (Kyoritsu Seiyaku, Tokyo, Japan), and an incision was made in the kidney capsule. The islets were gently deposited in the subcapsular space through a polyethylene tube. The incision in the kidney capsule was then closed, and the surgical wound was sutured. After wound closure, mice were allowed to recover on a warm plate. Blood glucose values were measured in blood from a tail snip using a Glutest Ace-R and Glutest Sensor (Sanwa Kagaku Kenkyusho), plasma samples for the GLuc assay were taken and frozen, and body weights were measured at the indicated time points after the surgery Partial Pancreatectomy Blood glucose and body weights of -week-old transgenic or 0-week-old wild type mice were measured, and blood samples for the GLuc activity were taken from snipped tails and frozen prior to the surgery. Mice were deeply anesthetized using Somnopentyl (Kyoritsu Seiyaku). Partial pancreatectomy (approximately 50%) was performed by resection of the body and tail of the pancreas and the spleen, leaving the pancreatic head and duodenum intact. Blood glucose values, plasma GLuc activity and body weight were measured at the indicated time points after the surgery. 8

7 Supplemental Materials, Nishimura et al, Page7 of SUPPLEMENTAL FIGURE LEGENDS Supplemental Fig. : Dynamic state of GLuc in vivo and in vitro (A) The medium with (GLuc) or without (Control) GLuc was injected into the tail vein of wild-type mice, followed by the analysis of plasma GLuc activity at the indicated time points. GLuc is quickly cleared from the circulation within twenty minutes (n=). (B) GLuc activity in the urine of Pdx-GLuc and wild-type mice collected overnight revealed secreted GLuc is eliminated mainly by renal excretion (n=). (C) Culture medium of INS- cells two days after the transfection with ppdx-gluc-enhancer vector (Figure BC) were stored at, and an aliquot of medium was frozen at the indicated time points. The GLuc activities were measured, which revealed GLuc is extremely stable at. (D) The plasma of Pdx-GLuc mice were incubated at 7, and an aliquot of the plasma was frozen at the indicated time points. The GLuc activities were measured, which revealed that the half life of GLuc is more than days at Supplemental Fig. : Identification, establishment and genotype of Pdx-GLuc mice (A) The results of PCR for genotyping founders # to #7. Founders #, # and #5 were genotypepositive. (B) Plasma GLuc activity in each founder relative to that in the wild-type control (n = ). Lines #, #, # and #7 were subjected to the screening using BLI. (C) The averages of the plasma GLuc activity in Pdx-GLuc (line #) and wild-type mice. Pdx-GLuc mice could be divided into two groups, GLuc high group (n=) and low group (n=7), both of which are higher than wild-type mice (n=85) in the plasma GLuc activity. (D, E, F) Body weight (D), fed blood glucose (E) and plasma GLuc activity (F) in Pdx-GLuc mice were measured for weeks. The relaive plasma luciferase activities were stable over time. n=0. Each bar and dot represent the mean ± SEM. 5 Supplemental Fig. : Metabolic characterization of Pdx-GLuc mice

8 Supplemental Materials, Nishimura et al, Page8 of (A) Body weight, (B) fasting blood glucose and (C) the results of intraperitoneal glucose tolerance testing of Pdx-GLuc mice (n = 5) and wild-type mice (n = ). (D) The results of insulin tolerance testing of Pdx-GLuc mice (n = ) and wild-type mice (n = ). Each bar and dot represent the mean ± SEM Supplemental Fig. : Batch incubation assay of Pdx-GLuc islets (A) 5 islets of Pdx-GLuc and wild-type mice were incubated in 500 µl of Krebs-Ringer buffer (KRB) with.8mm glucose for 60 minutes, followed by the measurement of GLuc activity. The results are presented as the fold increase relative to the wild-types. n = for Pdx-GLuc and n= for wild-type mice. (B) 5 islets of Pdx-GLuc mice were incubated in KRB with.8mm glucose, 6.7 mm glucose or 60 mm KCl for 60 minutes, followed by the measurement of GLuc activity. The results are presented as the fold increase relative to the values of.8mm glucose. The assay # (n=) used the islets from two mice and the assay # (n=) and # (n=) used the islets from a single mouse. (C) Insulin secretion measured in parallel with the experiments (B). Each bar represent the mean ± SEM Supplemental Fig. 5: Analysis of the islets of Pdx-GLuc mice line # (A) The reporter assay performed in homogenates of various organs from Pdx-GLuc line # (C; red) or wild-type mice (blue) reveals GLuc activity in islets that is greater than 00-fold higher than that in non-islets of the pancreas. n = for both genotypes. The plasma GLuc activity is also presented in RLU. (B, C) Immunohistochemistry of the Pdx-GLuc pancreas line #. (B) GLuc (green) colocalizes with insulin (red). (C) GLuc (green) is not colocalized with glucagon (red). DAPI (blue). Bar: 0 µm. (D-F) Isolated Pdx-GLuc islets line # were cultured overnight, and the indicated number of islets of similar sizes were handpicked and cultured for two hours. (D) The results of a reporter assay performed in culture medium demonstrate that the secreted luciferase activity correlated with the number of islets. (E) Analysis of the medium demonstrates a graded photon emission in response to an increasing number of islets. (F) The quantification of the BLI presented in (E) demonstrates a

9 Supplemental Materials, Nishimura et al, Page9 of correlation between GLuc activity and the number of islets. n =. Each bar in A and dot in D and F represent the mean ± SEM Supplemental Fig. 6: Immunohistochemistry of the Pdx-GLuc pancreas for GLuc and glucagon Colocalization of GLuc (green) with glucagon (red) is rare. Quantification of immunohistochemistry revealed that less than % of the glucagon positive cells expressed GLuc in the Pdx-GLuc pancreas (n = ); 07 glucagon positive cells were counted. DAPI (blue). Bar: 0 µm Supplemental Fig. 7: Secreted GLuc from Pdx-GLuc islets correlated with the number of islets (related to Figure C) Islets isolated from Pdx-GLuc line # or wild-type mice were cultured overnight, and the indicated number of Pdx-GLuc islets of similar sizes were handpicked and cultured for two hours. Native CTZ was added to 500 µl of medium, followed by analysis of the medium using BLI (presented in Figure C). The quantification of the BLI with natve CTZ demonstrates a correlation of GLuc activity with the number of islets. n = for both genotypes. Each dot represents the mean ± SEM Supplemental Fig. 8: BLI for Pdx-GLuc mice after partial pancreatectomy BLI after the injection of CTZ reveals reduced bioluminescent signals in the Pdx-GLuc mice after partial pancreatectomy (A; Line # PPx) compared to that in the conventional transgenic mice (B; Line #). No signals were observed in wile-type mice (C). The reduction in the signals in the pancreatomized mice may be partially due to the interference of the bioluminescence by the black wound. Supplemental Fig. 9: Exendin- increased the Pdx-GLuc activity in islets culture medium

10 Supplemental Materials, Nishimura et al, Page0 of (A) 50 pancreatic islets were isolated from Pdx-GLuc or wild-type mice, and cultured overnight in RPMI-60 supplemented with.mm glucose, 0% FBS, mm sodium pyruvate, 0 mm Hepes, 00 U/ml penicillin and 00 mg/ml streptomycin. Subsequently the islets were preincubated in.5mm glucose for ten hours, followed by incubation with RPMI-60-based medium supplemented with () 00nM exendin- and 0mM glucose, () 0mM glucose and ().5mM glucose for hours. Analysis of culture medium revealed the increased luciferase activity secreted from Pdx-GLuc islets cultured with exendin-, suggesting the effect of GLP- on the Pdx promoter activity in mouse islets. n = 8 for transgenic islets, n = for wild-type islets. (B) The experiments same as (A) were performed with 75 Pdx-GLuc islets, followed by analysis of mrna expression in the islets by TaqMan qrt- PCR in addition to the secreted GLuc activity. n =. Each bar represents the mean ± SEM Supplemental Fig. 0: Batch incubation assay of the Pdx-GLuc islets with various glucose concentrations 5 islets of Pdx-GLuc or wild-type mice were incubated in 500 µl of Krebs-Ringer buffer with the indicated concentrations of glucose for the indicated time period, followed by the measurement of GLuc activity in time-course manner. The dots represent the mean ± SEM. n= for each concentration of glucose. 8

11 Supplemental Materials, Nishimura et al, Page of SUPPLEMENTAL TABLE The oligonucleotide primer sets to detect the presence of the transgene by PCR amplification of genomic DNA. Forward primer Reverse primer Product size PCR-a 5 -ATTAAGCGCGGCGGGTGTGGT- 5 -TTGGGGTCGAGGTGCCGTAAAG- 86 bp PCR-b 5 -AAGGGGGCCGGTGGTGACTAAGC- 5 -CGCCCCTAACTCCGCCCATCC- 75 bp PCR-c 5 -CAAGGGGGCCGGTGGTGACTA- 5 -ACGCGGCCTTTTTACGGTTCCTG- 856 bp PCR-d 5 -GGACGCTGCCACACCTACGAA- 5 -CACCACCGGCCCCCTTGAT- 80 bp 5

12 Supplemental Materials, Nishimura et al, Page of SUPPLEMENTAL TABLE The antibodies used in this study. Antigen Species Maker Catalogue number Dilution Gaussia Mouse Nanolight technologies, Pinetop, 0M :00 luciferase AZ Pdx Rabbit Trans Genic Inc., Japan KR059 :00 Insulin Guinea pig Takara Bio Inc., Japan M78 :00 Glucagon Guinea pig Takara Bio Inc., Japan M8 :00 Somatostatin Rabbit Chemicon International, AB59 :50 Billerica, MA

13

14

15

16

17

18

19

20

21

22

Supporting Information

Supporting Information Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)

More information

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and

Supplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and

More information

Modulating Glucose Uptake in Skeletal Myotubes: Insulin Induction with Bioluminescent Glucose Uptake Analysis

Modulating Glucose Uptake in Skeletal Myotubes: Insulin Induction with Bioluminescent Glucose Uptake Analysis icell Skeletal Myoblasts Application Protocol Modulating Glucose Uptake in Skeletal Myotubes: Insulin Induction with Bioluminescent Glucose Uptake Analysis Introduction The skeletal muscle is one of the

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

Mouse primary keratinocytes preparation

Mouse primary keratinocytes preparation Mouse primary keratinocytes preparation 1. Fill a 150 X 25 mm petri dish with ice. Put newborn mice (2 3 days old) in the petri dish and insert it in an ice bucket. Leave the mice in the ice bucket for

More information

Transplantation of Human Pancreatic Endoderm Cells Reverses Diabetes. Post Transplantation in a Prevascularized Subcutaneous Site

Transplantation of Human Pancreatic Endoderm Cells Reverses Diabetes. Post Transplantation in a Prevascularized Subcutaneous Site Stem Cell Reports, Volume 8 Supplemental Information Transplantation of Human Pancreatic Endoderm Cells Reverses Diabetes Post Transplantation in a Prevascularized Subcutaneous Site Andrew R. Pepper, Rena

More information

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin

For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin Materials and Methods Pair Feeding Experiment For pair feeding, mice were fed 2.7g of HFD containing tofogliflozin (0.005%), which is average daily food intake of mice fed control HFD ad libitum at week

More information

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot

Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter

More information

A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified

A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Cell culture and animal model A549 and A549-fLuc cells were maintained in high glucose Dulbecco modified Eagle medium supplemented with 10% fetal bovine serum at 37 C in humidified atmosphere containing

More information

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages

Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator. of the Interaction with Macrophages Serum Amyloid A3 Gene Expression in Adipocytes is an Indicator of the Interaction with Macrophages Yohei Sanada, Takafumi Yamamoto, Rika Satake, Akiko Yamashita, Sumire Kanai, Norihisa Kato, Fons AJ van

More information

Protocol for Gene Transfection & Western Blotting

Protocol for Gene Transfection & Western Blotting The schedule and the manual of basic techniques for cell culture Advanced Protocol for Gene Transfection & Western Blotting Schedule Day 1 26/07/2008 Transfection Day 3 28/07/2008 Cell lysis Immunoprecipitation

More information

Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538

Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538 Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538 Background: TIGIT is a co-inhibitory receptor that is highly expressed in Natural Killer (NK) cells, activated CD4+, CD8+ and regulatory

More information

Lumino Firefly Luciferase Assay

Lumino Firefly Luciferase Assay G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Lumino Firefly Luciferase Assay (Cat. # 786 1267, 786 1268) think proteins! think G-Biosciences

More information

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow

Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow diet (n = 7 per genotype). Body weight and fed blood glucose

More information

The Schedule and the Manual of Basic Techniques for Cell Culture

The Schedule and the Manual of Basic Techniques for Cell Culture The Schedule and the Manual of Basic Techniques for Cell Culture 1 Materials Calcium Phosphate Transfection Kit: Invitrogen Cat.No.K2780-01 Falcon tube (Cat No.35-2054:12 x 75 mm, 5 ml tube) Cell: 293

More information

SUPPLEMENTAL MATERIAL. Supplementary Methods

SUPPLEMENTAL MATERIAL. Supplementary Methods SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was

More information

A protocol for enhancement of the AAV-mediated expression of transgenes

A protocol for enhancement of the AAV-mediated expression of transgenes A protocol for enhancement of the AAV-mediated expression of transgenes Hiroaki Mizukami, Takeharu Kanazawa, Takashi Okada, and Keiya Ozawa Division of Genetic Therapeutics, Center for Molecular Medicine,

More information

Western Immunoblotting Preparation of Samples:

Western Immunoblotting Preparation of Samples: Western Immunoblotting Preparation of Samples: Total Protein Extraction from Culture Cells: Take off the medium Wash culture with 1 x PBS 1 ml hot Cell-lysis Solution into T75 flask Scrap out the cells

More information

HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates

HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates HIV-1 Virus-like Particle Budding Assay Nathan H Vande Burgt, Luis J Cocka * and Paul Bates Department of Microbiology, Perelman School of Medicine at the University of Pennsylvania, Philadelphia, USA

More information

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer

B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small cell lung cancer Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2017 Experimental Methods Cell culture B16-F10 (Mus musculus skin melanoma), NCI-H460 (human non-small

More information

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice

Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25

More information

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets

Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC

More information

Lipoprotein Lipase Activity Assay Kit (Fluorometric)

Lipoprotein Lipase Activity Assay Kit (Fluorometric) Lipoprotein Lipase Activity Assay Kit (Fluorometric) Catalog Number KA4538 100 assays Version: 02 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General

More information

Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535

Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535 Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements with constitutive

More information

ASSAY OF SPHINGOMYELINASE ACTIVITY

ASSAY OF SPHINGOMYELINASE ACTIVITY ASSAY OF SPHINGOMYELINASE ACTIVITY Protocol for Protein Extraction Stock Solution 1. Leupeptin/hydrochloride (FW 463.0,

More information

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS

Impact of hyper-o-glcnacylation on apoptosis and NF-κB activity SUPPLEMENTARY METHODS SUPPLEMENTARY METHODS 3D culture and cell proliferation- MiaPaCa-2 cell culture in 3D was performed as described previously (1). Briefly, 8-well glass chamber slides were evenly coated with 50 µl/well

More information

Data Sheet IL-2-Luciferase Reporter (Luc) - Jurkat Cell Line Catalog # 60481

Data Sheet IL-2-Luciferase Reporter (Luc) - Jurkat Cell Line Catalog # 60481 642 Cornerstone Court W, Ste B Tel: 1.858.829.382 Data Sheet IL-2-Luciferase Reporter (Luc) - Jurkat Cell Line Catalog # 6481 Description Human IL-2 reporter construct is stably integrated into the genome

More information

For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format:

For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Supplementary Protocol 1. Adaptor preparation: For the 5 GATC-overhang two-oligo adaptors set up the following reactions in 96-well plate format: Per reaction X96 10X NEBuffer 2 10 µl 10 µl x 96 5 -GATC

More information

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization

VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Cell Reports, Volume 9 Supplemental Information VEGFR2-Mediated Vascular Dilation as a Mechanism of VEGF-Induced Anemia and Bone Marrow Cell Mobilization Sharon Lim, Yin Zhang, Danfang Zhang, Fang Chen,

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Histogram showing hybridization signals for chicken (left) and quail (right) genomic DNA analyzed by Chicken GeneChip (n=3). www.nature.com/nature 1 Supplementary Figure 2. Independent

More information

Supplementary Information. Cryptochrome Mediates Circadian Regulation of camp. Signalling and Hepatic Gluconeogenesis

Supplementary Information. Cryptochrome Mediates Circadian Regulation of camp. Signalling and Hepatic Gluconeogenesis Supplementary Information Cryptochrome Mediates Circadian Regulation of camp Signalling and Hepatic Gluconeogenesis Eric E. Zhang 1,2*, Yi Liu 3,5*, Renaud Dentin 3, Pagkapol Y. Pongsawakul 1, Andrew C.

More information

MagCapture Exosome Isolation Kit PS Q&A

MagCapture Exosome Isolation Kit PS Q&A MagCapture Exosome Isolation Kit PS Q&A Specifications and performance P.1 Comparison of the conventional method P.2 Operation methods and composition P.4 Amount of starting sample P.5 Analysis after exosomes

More information

Gladstone Institutes, University of California (UCSF), San Francisco, USA

Gladstone Institutes, University of California (UCSF), San Francisco, USA Fluorescence-linked Antigen Quantification (FLAQ) Assay for Fast Quantification of HIV-1 p24 Gag Marianne Gesner, Mekhala Maiti, Robert Grant and Marielle Cavrois * Gladstone Institutes, University of

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with

More information

2-Deoxyglucose Assay Kit (Colorimetric)

2-Deoxyglucose Assay Kit (Colorimetric) 2-Deoxyglucose Assay Kit (Colorimetric) Catalog Number KA3753 100 assays Version: 01 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Background... 3 General Information...

More information

Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535

Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535 Data Sheet PD-1 / NFAT Reporter - Jurkat Cell Line Catalog #: 60535 Product Description Recombinant Jurkat T cell expressing firefly luciferase gene under the control of NFAT response elements with constitutive

More information

Acute myocardial infarction (MI) on initial presentation was diagnosed if there was 20 minutes

Acute myocardial infarction (MI) on initial presentation was diagnosed if there was 20 minutes SUPPLEMENTAL MATERIAL Supplemental Methods Diagnosis for acute myocardial infarction Acute myocardial infarction (MI) on initial presentation was diagnosed if there was 20 minutes or more of chest pain

More information

Antibodies: LB1 buffer For 50 ml For 10ml For 30 ml Final 1 M HEPES, ph 2.5 ml 0.5 ml 1.5 ml 50mM. 5 M NaCl 1.4 ml 280 µl 0.

Antibodies: LB1 buffer For 50 ml For 10ml For 30 ml Final 1 M HEPES, ph 2.5 ml 0.5 ml 1.5 ml 50mM. 5 M NaCl 1.4 ml 280 µl 0. Experiment: Date: Tissue: Purpose: ChIP-Seq Antibodies: 11x cross-link buffer: Regent Stock Solution Final Vol for 10 ml of 11xstock concentration 5 M NaCl 0.1M 0.2 ml 0.5 M EDTA 1 mm 20 ul 0.5 M EGTA,

More information

Essential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in

Essential Medium, containing 10% fetal bovine serum, 100 U/ml penicillin and 100 µg/ml streptomycin. Huvec were cultured in Supplemental data Methods Cell culture media formulations A-431 and U-87 MG cells were maintained in Dulbecco s Modified Eagle s Medium. FaDu cells were cultured in Eagle's Minimum Essential Medium, containing

More information

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2

Online Data Supplement. Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Online Data Supplement Anti-aging Gene Klotho Enhances Glucose-induced Insulin Secretion by Upregulating Plasma Membrane Retention of TRPV2 Yi Lin and Zhongjie Sun Department of physiology, college of

More information

Protocol for Thawing Cryopreserved Hepatocytes

Protocol for Thawing Cryopreserved Hepatocytes cell and tissue-based products Protocol for Thawing Cryopreserved Hepatocytes Product Instruction The following procedure may be carried out in a biosafety containment hood to reduce the risk of contamination

More information

Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice

Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice Impact of Sox9 Dosage and Hes1-mediated Notch Signaling in Controlling the Plasticity of Adult Pancreatic Duct Cells in Mice Shinichi Hosokawa 1,3,Kenichiro Furuyama 1,3, Masashi Horiguchi 1,3,Yoshiki

More information

Supplementary Information

Supplementary Information Supplementary Information GADD34-deficient mice develop obesity, nonalcoholic fatty liver disease, hepatic carcinoma and insulin resistance Naomi Nishio and Ken-ichi Isobe Department of Immunology, Nagoya

More information

Rescue IVF protocol for legacy stock

Rescue IVF protocol for legacy stock Rescue IVF protocol for legacy stock Sperm thawing/ivf protocol for MTG sperm samples (80ul per straw) from straw and conventional CPA from Vial (100ml per vial) This protocol is based on methods developed

More information

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Supplementary Information p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO Yuri Shibata, Masaaki Oyama, Hiroko Kozuka-Hata, Xiao Han, Yuetsu Tanaka,

More information

Human ipsc-derived Ventricular Cardiomyocytes. Protocol version 3.1

Human ipsc-derived Ventricular Cardiomyocytes. Protocol version 3.1 Human ipsc-derived Ventricular Cardiomyocytes Protocol version 3.1 Protocol version 3.1 Table of Contents Product Information 2 Recommendations 2 Preparing Cardiomyocyte Maintenance Medium 3 Cardiomyocyte

More information

Islet Assay Using the Agilent Seahorse XF24 Islet Capture Microplate

Islet Assay Using the Agilent Seahorse XF24 Islet Capture Microplate Islet Assay Using the Agilent Seahorse XF24 Islet Capture Microplate Technical Overview Introduction Agilent Seahorse XF Analyzers are most commonly used with an adherent monolayer of cells attached to

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES

More information

CANINE CARDIAC MYOCYTE ISOLATION PROTOCOL November 2000

CANINE CARDIAC MYOCYTE ISOLATION PROTOCOL November 2000 CANINE CARDIAC MYOCYTE ISOLATION PROTOCOL November 2000 I. Preparation for cell isolation: A. Make sure the following items are autoclaved: 1. 1-8X8 baking dish 6. 3-1 liter bottles 2. 2-500 ml beaker

More information

2-Deoxyglucose (2DG) Uptake Measurement kit

2-Deoxyglucose (2DG) Uptake Measurement kit Document#:K2DG13516E For research use only. Not for clinical diagnosis. Catalog No. CSR-OKP-PMG-K1E 2-Deoxyglucose (2DG) Uptake Measurement kit Introduction Measurement of 2-deoxyglucose (2DG) uptake in

More information

Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652

Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652 Notch Signaling Pathway Notch CSL Reporter HEK293 Cell line Catalog #: 60652 Background The Notch signaling pathway controls cell fate decisions in vertebrate and invertebrate tissues. Notch signaling

More information

Supporting Information File S2

Supporting Information File S2 Pulli et al. Measuring Myeloperoxidase Activity in Biological Samples Page 1 of 6 Supporting Information File S2 Step-by-Step Protocol Reagents: Sucrose (Sigma, S3089) CaCl 2 (Sigma, C5770) Heparin Sodium

More information

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress

Supplemental Data. Short Article. ATF4-Mediated Induction of 4E-BP1. Contributes to Pancreatic β Cell Survival. under Endoplasmic Reticulum Stress Cell Metabolism, Volume 7 Supplemental Data Short Article ATF4-Mediated Induction of 4E-BP1 Contributes to Pancreatic β Cell Survival under Endoplasmic Reticulum Stress Suguru Yamaguchi, Hisamitsu Ishihara,

More information

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ± Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1

More information

Item Catalog Number Manufacturer 1,4-Dithioerythritol (1 g) D9680 Sigma-Aldrich

Item Catalog Number Manufacturer 1,4-Dithioerythritol (1 g) D9680 Sigma-Aldrich SOP: Nuclei isolation from fresh mouse tissues and DNaseI treatment Date modified: 01/12/2011 Modified by: E. Giste/ T. Canfield (UW) The following protocol describes the isolation of nuclei and subsequent

More information

Glucose Uptake Colorimetric Assay Kit

Glucose Uptake Colorimetric Assay Kit ab136955 Glucose Uptake Colorimetric Assay Kit Instructions for Use For the sensitive and accurate measurement of Glucose uptake in various samples This product is for research use only and is not intended

More information

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches

Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular

More information

Phospholipid Assay Kit

Phospholipid Assay Kit Phospholipid Assay Kit Catalog Number KA1635 100 assays Version: 06 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...

More information

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan

Secondary Negative Effects of Isolation Enzyme (s) On Human Islets. A.N.Balamurugan Secondary Negative Effects of Isolation Enzyme (s) On Human Islets A.N.Balamurugan Human Islets Functional Mass Preservation 18-25 min 10 min 8-12 min 10-15 min 45-60 min pancreas in chamber 37º Sub-Optimal

More information

Chromatin Immunoprecipitation (ChIPs) Protocol (Mirmira Lab)

Chromatin Immunoprecipitation (ChIPs) Protocol (Mirmira Lab) Chromatin Immunoprecipitation (ChIPs) Protocol (Mirmira Lab) Updated 12/3/02 Reagents: ChIP sonication Buffer (1% Triton X-100, 0.1% Deoxycholate, 50 mm Tris 8.1, 150 mm NaCl, 5 mm EDTA): 10 ml 10 % Triton

More information

Transfection of Sf9 cells with recombinant Bacmid DNA

Transfection of Sf9 cells with recombinant Bacmid DNA Transposition Bacmid DNA Mini Culturing baculo cells Transfection of Sf9 cells with recombinant Bacmid DNA Amplification of the virus Titration of baculo stocks Testing the expression Transposition 1.

More information

Title Modified Western blotting for insulin and other diabetes-associated peptide hormones

Title Modified Western blotting for insulin and other diabetes-associated peptide hormones Supplemental Figures Title Modified Western blotting for insulin and other diabetes-associated peptide hormones Authors Naoyuki Okita, Yoshikazu Higami, Fumio Fukai, Masaki Kobayashi, Miku Mitarai, Takao

More information

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow

Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow SUPPLEMENTARY DATA Supplementary Figure Legends Figure S1. PMVs from THP-1 cells expose phosphatidylserine and carry actin. A) Flow cytometry analysis of PMVs labelled with annexin-v-pe (Guava technologies)

More information

SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric*

SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric* SensoLyte pnpp Alkaline Phosphatase Assay Kit *Colorimetric* Catalog # 72146 Kit Size 500 Assays (96-well plate) Optimized Performance: This kit is optimized to detect alkaline phosphatase activity Enhanced

More information

Human TRPC6 Ion Channel Cell Line

Human TRPC6 Ion Channel Cell Line TECHNICAL DATA SHEET ValiScreen Ion Channel Cell Line Caution: For Laboratory Use. A research product for research purposes only Human TRPC6 Ion Channel Cell Line Product No.: AX-012-C Lot No.: 512-548-A

More information

Purification and Fluorescent Labeling of Exosomes Asuka Nanbo 1*, Eri Kawanishi 2, Ryuji Yoshida 2 and Hironori Yoshiyama 3

Purification and Fluorescent Labeling of Exosomes Asuka Nanbo 1*, Eri Kawanishi 2, Ryuji Yoshida 2 and Hironori Yoshiyama 3 Purification and Fluorescent Labeling of Exosomes Asuka Nanbo 1*, Eri Kawanishi 2, Ryuji Yoshida 2 and Hironori Yoshiyama 3 1 Graduate School of Medicine, Hokkaido University, Sapporo, Japan; 2 Graduate

More information

Vitrification of mouse embryos in straw

Vitrification of mouse embryos in straw Vitrification of mouse embryos in straw Based on a method originally published by Nakagata et al (1997) 1. Materials 1.1. Media and solutions 1.1.1. PB1 as basic solution 1.1.2. 1M DMSO solution in PB1.

More information

Islet Oxygen Consumption Assay using the XF24 Islet Capture Microplate Shirihai Lab and Seahorse Bioscience Aug

Islet Oxygen Consumption Assay using the XF24 Islet Capture Microplate Shirihai Lab and Seahorse Bioscience Aug 1 Islet Oxygen Consumption Assay using the XF24 Islet Capture Microplate Shirihai Lab and Seahorse Bioscience Aug 6 2009 XF Analyzers are most commonly used with an adherent monolayer of cells attached

More information

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were

Supplementary Figure (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were Supplementary Figure 1. Gd@C 82 (OH) 22 nanoparticles did not affect cell viability and apoposis. MDA-MB-231, MCF-7, MCF-10A and BT549 cells were treated with PBS, Gd@C 82 (OH) 22, C 60 (OH) 22 or GdCl

More information

JLR Papers In Press. Published on October 16, 2003 as Manuscript D JLR200

JLR Papers In Press. Published on October 16, 2003 as Manuscript D JLR200 JLR Papers In Press. Published on October 16, 2003 as Manuscript D300024-JLR200 A method of direct measurement for the enzymatic determination of cholesterol esters Toshimi Mizoguchi 1, Toshiyuki Edano,

More information

Supporting Information

Supporting Information Supporting Information The Effects of Spacer Length and Composition on Aptamer-Mediated Cell-Specific Targeting with Nanoscale PEGylated Liposomal Doxorubicin Hang Xing +, [a] Ji Li +, [a] Weidong Xu,

More information

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers

Evaluation of directed and random motility in microslides Assessment of leukocyte adhesion in flow chambers Evaluation of directed and random motility in microslides Motility experiments in IBIDI microslides, image acquisition and processing were performed as described. PMN, which ended up in an angle < 180

More information

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.

Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification. Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA

More information

Protocol for purification of recombinant protein from 300 ml yeast culture

Protocol for purification of recombinant protein from 300 ml yeast culture Protocol for purification of recombinant protein from 300 ml yeast culture Equipment and reagents needed: Zirconia beads (0.5 mm diameter from BSP, Germany) Paint Shaker (at 4 C) Tube rotator for 15 ml

More information

For research or further manufacturing use only. Not for injection or diagnostic procedures.

For research or further manufacturing use only. Not for injection or diagnostic procedures. PRIME-XV T cell Expansion XSFM PRIME-XV T Cell Expansion XSFM is a xeno-free, serum-free medium optimized for the activation and expansion of human T lymphocytes. This medium contains gentamicin and requires

More information

10.00 PBS OVA OVA+isotype antibody 8.00 OVA+anti-HMGB1. PBS Methatroline (mg/ml)

10.00 PBS OVA OVA+isotype antibody 8.00 OVA+anti-HMGB1. PBS Methatroline (mg/ml) RESEARCH ARTICLE Penh (100% of PBS) 1 PBS 8.00 +anti-hmgb1 6.00 4.00 p=0.054 Cellular & Molecular Immunology advance online publication, PBS 3.12 6.25 Methatroline (mg/ml) Neutrophil isolation and culture

More information

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14- 1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish

More information

CHO α 1 β 2 γ 2 GABAA Cell Line

CHO α 1 β 2 γ 2 GABAA Cell Line B SYS GmbH CHO α 1 β 2 γ 2 GABAA Cell Line Specification Sheet B SYS GmbH B SYS GmbH CHO α 1 β 2 γ 2 Cells Page 2 TABLE OF CONTENTS 1 BACKGROUND...3 1.1 THE PHARMACOLOGICAL DISTINCTION OF GABA A RECEPTOR

More information

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.

Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6. Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,

More information

Ph. Eur. Reference Standard - LEAFLET

Ph. Eur. Reference Standard - LEAFLET European Directorate for the Quality of Medicines & HealthCare European Pharmacopoeia (Ph. Eur.) 7, Allée Kastner CS 30026, F-67081 Strasbourg (France) Tel. +33 (0)3 88 41 20 35 Fax. + 33 (0)3 88 41 27

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass

More information

Cryopreserved Human Hepatocytes (Cat # HP-F)

Cryopreserved Human Hepatocytes (Cat # HP-F) Certificate of Analysis Cryopreserved Human Hepatocytes (Cat # HP-F) This CoA represents a single Lot specific batch of cells. For details of current Lots available please contact us. Lot#: H0434 Gender

More information

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry

TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi

More information

Entrainment of the mouse circadian clock by sub-acute physical and psychological

Entrainment of the mouse circadian clock by sub-acute physical and psychological Supplementary Information Entrainment of the mouse circadian clock by sub-acute physical and psychological Yu Tahara 1, Takuya Shiraishi 1, Yosuke Kikuchi 1, Atsushi Haraguchi 1, Daisuke Kuriki 1, Hiroyuki

More information

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine

Electron micrograph of phosphotungstanic acid-stained exosomes derived from murine 1 SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES Supplementary Figure 1. Physical properties of murine DC-derived exosomes. a, Electron micrograph of phosphotungstanic acid-stained exosomes derived from

More information

E.Z.N.A. SQ Blood DNA Kit II. Table of Contents

E.Z.N.A. SQ Blood DNA Kit II. Table of Contents E.Z.N.A. SQ Blood DNA Kit II Table of Contents Introduction and Overview...2 Kit Contents/Storage and Stability...3 Blood Storage and DNA Yield...4 Preparing Reagents...5 100-500 μl Whole Blood Protocol...6

More information

HEK293 cells transfected with human MATE1, MATE2-K, or vector control were established by

HEK293 cells transfected with human MATE1, MATE2-K, or vector control were established by SUPPLEMENTAL DIGITAL CONTENT METHODS In Vitro Metformin Transport Studies Effect of Dolutegravir on Metformin Transport by MATE1 and MATE2-K HEK293 cells transfected with human MATE1, MATE2-K, or vector

More information

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival

Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Supplementary Information for Proteomic profiling of small-molecule inhibitors reveals dispensability of MTH1 for cancer cell survival Tatsuro Kawamura 1, Makoto Kawatani 1, Makoto Muroi, Yasumitsu Kondoh,

More information

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences.

SUPPLEMENTARY DATA. Supplementary Table 2. Antibodies used for Immunofluoresence. Supplementary Table 3. Real-time PCR primer sequences. Supplementary Table 2. Antibodies used for Immunofluoresence. Antibody Dilution Source Goat anti-pdx1 1:100 R&D Systems Rabbit anti-hnf6 1:100 Santa Cruz Biotechnology Mouse anti-nkx6.1 1:200 Developmental

More information

SUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients

SUPPLEMENTARY INFORMATION. CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative. breast cancer patients SUPPLEMENTARY INFORMATION CXCR4 inhibitors could benefit to HER2 but not to Triple-Negative breast cancer patients Lefort S. 1,2, Thuleau A. 3, Kieffer Y. 1,2, Sirven P. 1,2, Bieche I. 4, Marangoni E.

More information

Fructose Assay Kit. Catalog Number KA assays Version: 04. Intended for research use only.

Fructose Assay Kit. Catalog Number KA assays Version: 04. Intended for research use only. Fructose Assay Kit Catalog Number KA1668 100 assays Version: 04 Intended for research use only www.abnova.com Table of Contents Introduction... 3 Intended Use... 3 Background... 3 General Information...

More information

Data Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621

Data Sheet. NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621 Data Sheet NFAT Reporter (Luc) Jurkat Cell line Catalog #: 60621 Background The nuclear factor of activator T cells (NFAT) family of transcription factors plays an important role in immune response. T

More information

RayBio KinaseSTAR TM Akt Activity Assay Kit

RayBio KinaseSTAR TM Akt Activity Assay Kit Activity Assay Kit User Manual Version 1.0 March 13, 2015 RayBio KinaseSTAR TM Akt Activity Kit Protocol (Cat#: 68AT-Akt-S40) RayBiotech, Inc. We Provide You With Excellent Support And Service Tel:(Toll

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION Supplementary Figure 1. Long-term protection studies. 45 minutes of ischemia was induced in wild type (S1pr2 +/+ ) and S1pr2 -/- by MCAO. A) 5 days later brains were harvested

More information

For the quantitative determination of Glucagon concentrations in cell culture supernates, serum and plasma.

For the quantitative determination of Glucagon concentrations in cell culture supernates, serum and plasma. Glucagon ELISA Kit Cat.No: DEIA2827 Lot. No. (See product label) Size 96T Intended Use For the quantitative determination of Glucagon concentrations in cell culture supernates, serum and plasma. General

More information

Supplementary Figure 1

Supplementary Figure 1 VO (ml kg - min - ) VCO (ml kg - min - ) Respiratory exchange ratio Energy expenditure (cal kg - min - ) Locomotor activity (x count) Body temperature ( C) Relative mrna expression TA Sol EDL PT Heart

More information

Supplementary Materials for

Supplementary Materials for www.sciencetranslationalmedicine.org/cgi/content/full/7/273/273ra14/dc1 Supplementary Materials for Local iontophoretic administration of cytotoxic therapies to solid tumors James D. Byrne,* Mohammad R.

More information

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )

Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) 770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG

More information