SUPPLEMENTARY DATA. Supplementary Table 1. Primers used for PCR and qpcr Primer Name
|
|
|
- Myron Nichols
- 5 years ago
- Views:
Transcription
1 Supplementary Table. Primers used for PCR and qpcr Primer Name ccession Number Fwd Rev Type of PCR Cre NC_8 GGCGTCTTCCGC GTGCCCCTCGTTTG Standard PCR LoUcp CCGGGCTGTCTCCGCGG GGCTGTTCGCCCGGCC Standard PCR Ucp eon3 NM_7.3 GCCGCCTTCTGCCTCCTGTGTT GGCGCTTTGGCGGC Standard PCR β ctin NM_7393 CTGTGGCCCGGTCTG CCCTGGCTGCCTCCC qpcr Pepck NM_ GTGGGGTTCGTGGGG TCTGCTCTTGGGTGTGTG qpcr Gpc NM_8 TCTGTCCCGGTCTCCTTG GTGTCCGCGCGC qpcr Fbp NM_939 GGGCCGCCGTGGG TGGGTGGTGCCTTGGGCT qpcr Gck NM_9 GGTGGTGTGGTGGCT CCGCTCCCTTCTGCT qpcr Fasn NM_7988 CTCTGTCGTGGCCTCCTC TGCTGCGTTTGGTCTGC qpcr Sod NM_3 GTGTTGGGTTGCGCGT TGGTTTGGGGTGCGTGGT qpcr Sod NM_37 TTCGCGCGTCTGC GGTGGCGTTGGTTGTTC qpcr Sod3 NM_3 CTGCTCTGCGGGTC GCCGCCGGTGTCTG qpcr Gp NM_8 CGCTTTCGTCCTCGCTC GGGCCGCCTTGGGTTG qpcr Gp NM_377 CCGTCCCGCTCTCT CGTTCCGGCCGTCTG qpcr Gp3 NM_8 CTTGTCCCGTGTGTGCT TGGCCTCCCTGGGTTTC qpcr Gp NM_8 CCCGTTGCTGGTGTGGTT CCTGCCTCCCCTGGTT qpcr Cat NM_98 TGGGCCTGCGCTTC CCCTTCGCGCCTGTG qpcr Ho NM_ CCTCCTGGCGGTCTC CCTCGTGGGCGCTTTCT qpcr Ucp NM_7.3 CGCCGCGCCCGTCC CTGCGGCGGGGCGC qpcr UCP NM_33 GGGGCCCCGGCCTTCTC GGCGCCTGGGGCTCGTT qpcr GCG NM_ GGCGCTGGCCGTTCCCT CTTGGGCCGCCTGGGTCC qpcr CT NM_ TGGCTGCGTGTGGCTCCC GGGTGCCGCCTGGTGC qpcr
2 Supplementary Figure. Genotyping of mice and efficiency of recombination/deletion using Gcg cre mice.. Genotyping results using PCR to detect floed UCP and cre epression in loucp and Gcg cre mice.. Immunostaining for glucagon protein (red) (mouse anti glucagon, Sigma Cat#G) and eyfp (green) (rabbit anti GFP, Invitrogen Cat#; also detects eyfp) in islets from Gcg cre YFP mice. Colocalization is indicated by yellow and was observed in 7 ± % of glucagon positive cells. N=3. floed wt Cre Glucagon YFP
3 Supplementary Figure. Phenotypical comparison of Gcg cre and floed UCP mice. 8 week old male Gcg cre and floed UCP mice were fasted overnight and then. lood glucose concentration and. Plasma glucagon levels were measured. N= 9 3/genotype. C. Oral glucose tolerance test (OGTT) shows no difference in glucose tolerance between the two genotypes as the incremental area under the OGTT curve (iuc) (inset) was similar. N= 7 9/genotype. lood Glucose (mmol/l) 7 3 Floed Plasma Glucagon (pg/ml) 8 C Glucose (mmol/l) 8 Floed Glucose iuc (mmol/l.min) Time (min)
4 Supplementary Figure 3. No ectopic epression of cre in the brainstem or distal ileum.. Gcg cre YFP mice were perfused with % PF by cardiac perfusion, the brains removed, sectioned and stained with a GFP antibody that detects eyfp (Millipore Cat# 9) and co stained with DPI. Images were acquired with a fluorescent microscope. There was eyfp staining in the nucleus of the solitary tract (n=). C. The distal ileum was removed from Gcg cre YFP (not shown) and UCPKO YFP (shown) mice, fied with % PF, embedded in paraffin blocks, sectioned and stained with either () a GLP antibody (bcam Cat#) which showed scattered staining throughout as indicated with the arrows (inset is higher magnification) or (C) a GFP antibody (Invitrogen Cat# ) which did not show any specific eyfp staining (n=3).
5 Supplementary Figure. Corticosterone levels and 3 hydroybutyrate were not different between Gcg cre and UCPKO mice after a prolonged h fast but MCF were significantly reduced in UCPKO mice.. Corticosterone levels were measured in plasma before (Fed) and after a h fast (Fasting) using an RI kit (MP iomedicals, Canada). n = 7 8 mice in each group. & C. mass spectromic analysis of plasma metabolite levels was conducted on samples taken from fed and h fasted Gcg cre (Cntrl) and UCPKO (KO) mice.. The levels of 3 hydroybutyrate was similarly increased in Gcg cre and UCPKO mice upon fasting. C. Eamples of medium chain length fatty acids (MCF) (7: and 8:) are shown that increased in Gcg cre mice and decreased in UCPKO mice upon fasting (n=8 per genotype). Data are epressed as means ± SEM; *P<. genotype/fed state interaction. Corticosterone (ng/ml) 3 UCPKO Fed h Fasting C
6 Supplementary Figure. Dispersed UCPKO alpha cells have higher ROS levels. Islets isolated from Gcg cre YFP and UCPKO YFP mice were cultured overnight and then dispersed and plated into a 9 well View Plate (Perkin Elmer, Ontario, Canada). The following day islet cells were incubated with or without genipin (µm) for h before being loaded with CellROX (mm) and Hoechst (mm) for 3min in complete media. The cells were then washed once with imaging buffer and then imaged on a Cellomics rray Scan (Thermo Fisher, Pittsburgh). Gcg cre YFP+ cells = 38; Gcg cre YFP cells = 798; UCPKO YFP+ cells = UCPKO YFP cells =, 9. P<.. CellRo (verage Intensity) 3 YFP+ (alpha cells) Control Genipin UCPKO CellRo (verage Intensity) YFP- (non-alpha cells) Control Genipin
7 Supplementary Figure. lpha cell UCP deletion does not affect the epression of a series of antioidant genes and insulin secretion was enhanced from Gcg cre islets incubated with H O.. Islet epression of the antioidant enzymes superoide dismutase (Sod), Sod3, Glutathione peroidase (Gp), Gp, Gp3, Gp, catalase (Cat) and the cytoprotective Heme oygenase (Ho ) genes were quantified by real time PCR and normalized to beta actin. n = /genotype Data are means ± SEM. C. Fresh isolated mouse islets were pre incubated ± µm genipin (GEN) () or µm H O (C) for h in mm RPMI before being incubated with high glucose (HG:mM) for min and then HG or low glucose (LG:mM) during a h static secretion assay. N = mice/genotype. D. GSIS from human islets pre incubated ± Genipin ( µm) during a half hour static secretion assay. N= 7. *P<.. D mrn epression (% eta-actin) mrn epression (% eta actin) Insulin (Fold-change over LG) Insulin Secretion (Fold-change over LG) Sod Gcgcre KO Gp3 Gcgcre KO HG HG + GEN Control Genipin.. 8 * Sod3 Gp UCPKO UCPKO UCPKO LG LG + GEN.. Gp Gcgcre KO Cat C Insulin (Fold-change over LG) UCPKO * Gp Ho- HG HG+ + HOH O UCPKO UCPKO UCPKO UCPKO LG LG+ + HOH O LG HG
8 Supplementary Figure 7. TP sensitive K + current was similar in UCPKO and Gcg cre alpha cells and islet TP content was unchanged.. Whole cell recordings of K TP currents in YFP+ alpha cells. verage I/V curves were obtained by plotting the maimum current against the applied potential. Diazoide (Diaz.: μmol/l) application produced a large K TP current (N= cells) that was blocked by tolbutamide (Tolb.: μmol/l) N=8 cells, mice/genotype.. TP content was measured in mouse islets after a static secretion assay protocol (HG = high glucose KR (mm) and LG = low glucose KR (mm)). N=3 mice/genotype. Katp Current in eyfp+ cells Current (p/pf) "_Diazoide +Diaz. (n=)" _Tolbutamide +Tolb. "UCPKO_Diazoide UCPKO+Diaz. (n=7)" UCPKO_tolbutamide UCPKO+Tolb Holding Potential (mv) TP (pmol/islet) 8 HG UCPKO LG -
9 Supplementary Figure 8. Genipin and H O reduce intracellular calcium but increase oscillations in Gcg cre alpha cells. D Dispersed islets were pre incubated with genipin (µm) or H O (µm) for h in mm glucose RPMI. Cytosolic calcium uptake was measured in dispersed YFP+ alpha cells loaded with Fura M in high glucose KR (mm). The effect of a switch to low glucose (mm) and then the addition of HG + arginine (mm) or KCl (3mM) were then determined. family of representative traces is shown per condition. N = 3 cells from 3 different mice/genotype. E. Quantification of oscillation frequency in YFP+ alpha cells in the presence of low glucose ± H O (µm) or genipin (GEN) (µm).. Control Fura-M Fluorescence (Normalized to HG+rg) C. Genipin Fura-M Fluorescence (Normalized to HG+rg) HG LG HG+rg HG+KCl. 8 Time E. HG LG HG+rg HG+KCl. 8 Time Ca + Oscillation Frequency (oscillations/min) LG LG + HO LG + GEN UCPKO Fura-M Fluorescence (Normalized to HG+rg) Fura-M Fluorescence (Normalized to HG+rg). Control UCPKO HG LG HG+rg HG+KCl. 8 Time D. H O HG LG HG+rg HG+KCl. 8 Time
General Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC
Supplementary information Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC Pathway in Pancreatic -Cells Authors: Hodaka Yamada 1,*, Masashi Yoshida 1,*, Kiyonori Ito 1, Katsuya
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
islets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
Supplementary Figure 1.
Supplementary Figure 1. Increased β cell mass and islet diameter in βtsc2 -/- mice up to 35 weeks A: Reconstruction of multiple anti-insulin immunofluorescence images showing differences in β cell mass
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION Advances in pancreatic islet monolayer culture on glass surfaces enable superresolution microscopy and insights into beta cell ciliogenesis and proliferation Edward A. Phelps,
Fig. S4. Current-voltage relations of iglurs. A-C: time courses of currents evoked by 100 ms pulses
Fig. S1. Immunohistochemical detection of iglur2 protein in single islet cells. A: α cells identified using glucagon-specific antibody express the iglur2 subtype of AMPA receptor. 24 out of 26 identified
SUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
Abbreviations: P- paraffin-embedded section; C, cryosection; Bio-SA, biotin-streptavidin-conjugated fluorescein amplification.
Supplementary Table 1. Sequence of primers for real time PCR. Gene Forward primer Reverse primer S25 5 -GTG GTC CAC ACT ACT CTC TGA GTT TC-3 5 - GAC TTT CCG GCA TCC TTC TTC-3 Mafa cds 5 -CTT CAG CAA GGA
(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
Supplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches
Supplementary Figure 1: Steviol and stevioside potentiate TRPM5 in a cell-free environment. (a) TRPM5 currents are activated in inside-out patches during application of 500 µm Ca 2+ at the intracellular
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination
AAV-TBGp-Cre treatment resulted in hepatocyte-specific GH receptor gene recombination Supplementary Figure 1. Generation of the adult-onset, liver-specific GH receptor knock-down (alivghrkd, Kd) mouse
Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated,
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1: Neuregulin 1 increases the growth of mammary organoids compared to EGF. (a) Mammary epithelial cells were freshly isolated, embedded in matrigel and exposed
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Supplementary Table 1. Table showing different gene specific primers used in real-time PCR.
Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. gene Forward (5 3 ) Reverse(5 3 ) act CGTGAAAAGATGACCCAGATCA TGGTACGACCAGAGGCATACAG Nox1 TCGACACACAGGAATCAGGA
Supplementary Figure 1
Supplementary Figure 1 how HFD how HFD Epi WT p p Hypothalamus p p Inguinal WT T Liver Lean mouse adipocytes p p p p p p Obese mouse adipocytes Kidney Muscle Spleen Heart p p p p p p p p Extracellular
SUPPLEMENTAL FIGURE 1
SUPPLEMENTL FIGURE 1 C Supplemental Figure 1. pproach for removal of snorns from Rpl13a gene. () Wild type Rpl13a exonintron structure is shown, with exo in black and intronic snorns in red rectangles.
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
Supplementary Figure 1
Supplementary Figure 1 a Percent of body weight! (%) 4! 3! 1! Epididymal fat Subcutaneous fat Liver SD Percent of body weight! (%) ** 3! 1! SD Percent of body weight! (%) 6! 4! SD ** b Blood glucose (mg/dl)!
SUPPLEMENTAL MATERIAL. Supplementary Methods
SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was
Figure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.
Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets
SUPPLEMENTARY INFORMATION
Supplementary Figures Supplementary Figure S1. Binding of full-length OGT and deletion mutants to PIP strips (Echelon Biosciences). Supplementary Figure S2. Binding of the OGT (919-1036) fragments with
Supporting Information
Supporting Information Pang et al. 10.1073/pnas.1322009111 SI Materials and Methods ELISAs. These assays were performed as previously described (1). ELISA plates (MaxiSorp Nunc; Thermo Fisher Scientific)
Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION doi:10.1038/nature11464 Supplemental Figure S1. The expression of Vegfb is increased in obese and diabetic mice as compared to lean mice. a-b, Body weight and postprandial blood
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
TFEB-mediated increase in peripheral lysosomes regulates. Store Operated Calcium Entry
TFEB-mediated increase in peripheral lysosomes regulates Store Operated Calcium Entry Luigi Sbano, Massimo Bonora, Saverio Marchi, Federica Baldassari, Diego L. Medina, Andrea Ballabio, Carlotta Giorgi
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
Supplemental Materials. STK16 regulates actin dynamics to control Golgi organization and cell cycle
Supplemental Materials STK16 regulates actin dynamics to control Golgi organization and cell cycle Juanjuan Liu 1,2,3, Xingxing Yang 1,3, Binhua Li 1, Junjun Wang 1,2, Wenchao Wang 1, Jing Liu 1, Qingsong
Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells.
Supplementary Figure S1. Distinct compartmentalization of proinsulin in obese db/db mouse islet ß- cells. Pancreata from 16-weeks-old 6J +/+, 6J db/db, KS +/+ and KS db/db mice were harvested, fixed with
Name Animal source Vendor Cat # Dilutions
Supplementary data Table S1. Primary and Secondary antibody sources Devi et al, TXNIP in mitophagy A. Primary Antibodies Name Animal source Vendor Cat # Dilutions 1. TXNIP mouse MBL KO205-2 1:2000 (WB)
McAlpine PERK-GSK3 regulates foam cell formation. Supplemental Material. Supplementary Table I. Sequences of real time PCR primers.
Mclpine PERK-GSK3 regulates foam cell formation Supplemental Material Supplementary Table I. Sequences of real time PCR primers. Primer Name Primer Sequences (5-3 ) Product Size (bp) GRP78 (human) Fwd:
Supplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
Pair-fed % inkt cells 0.5. EtOH 0.0
MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded
SUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3461 In the format provided by the authors and unedited. Supplementary Figure 1 (associated to Figure 1). Cpeb4 gene-targeted mice develop liver steatosis. a, Immunoblot displaying CPEB4
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane
Supplementary Figure 1) GABAergic enhancement by leptin hyperpolarizes POMC neurons A) Representative recording samples showing the membrane potential recorded from POMC neurons following treatment with
GPR120 *** * * Liver BAT iwat ewat mwat Ileum Colon. UCP1 mrna ***
a GPR120 GPR120 mrna/ppia mrna Arbitrary Units 150 100 50 Liver BAT iwat ewat mwat Ileum Colon b UCP1 mrna Fold induction 20 15 10 5 - camp camp SB202190 - - - H89 - - - - - GW7647 Supplementary Figure
a 10 4 Link et al. Supplementary Figure 1 Nature Immunology: doi: /ni.1842 Cells per mouse ( 10 5 ) TRPV2KO anti-gr1 anti-gr anti-f4/80
a 10 4 WT 10 4 TRPV2KO 10 3 10 3 anti-gr1 10 2 10 1 anti-gr1 10 2 10 1 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 42.3 45.2 10 0 10 0 10 1 10 2 10 3 10 4 anti-f4/80 10 4 10 4 40 42.5 anti-cd11b 10 3 10 2
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Supplemental Figure 2.
Supplemental data Supplemental Figure Legends Supplemental Figure 1. Analysis of deletion of AMPK!2 in POMC and AgRP neurons in control and POMC!2KO and AgRP!2KO mice. (A) mmunofluorescence analysis for
Inhibition of DYRK1A stimulates human beta-cell proliferation
Inhibition of DYRK1A stimulates human beta-cell proliferation Ercument Dirice 1,, Deepika Walpita 2,, Amedeo Vetere 2, Bennett C. Meier 2,5, Sevim Kahraman 1, Jiang Hu 1, Vlado Dančík 2, Sean M. Burns
glucagon receptor AgRP merged color map I corr = 0.76±0.024 glucagon receptor DAPI merged
Hypothalamic glucagon signaling inhibits glucose production Patricia I. Mighiu*, Jessica T.Y. Yue*, Beatrice M. Filippi, Mona A. Abraham, Madhu Chari, Carol K.L. Lam, Clair S. Yang, Nikita R. Christian,
Supplemental Information. CD4 + CD25 + Foxp3 + Regulatory T Cells Promote. Th17 Cells In Vitro and Enhance Host Resistance
Immunity, Volume 34 Supplemental Information D4 + D25 + + Regulatory T ells Promote Th17 ells In Vitro and Enhance Host Resistance in Mouse andida albicans Th17 ell Infection Model Pushpa Pandiyan, Heather
Supporting Information
Supporting Information Gerasimenko et al..73/pnas.39 SI Materials and Methods Reagents used in this study include Fluo-4/Fura- (Invitrogen), thapsigargin (albiochem), collagenase (Worthington), palmitoleic
Supplemental Information. b Cell Aging Markers Have Heterogeneous. Distribution and Are Induced by Insulin Resistance
Cell Metabolism, Volume 25 Supplemental Information b Cell Aging Markers Have Heterogeneous Distribution and Are Induced by Insulin Resistance Cristina Aguayo-Mazzucato, Mark van Haaren, Magdalena Mruk,
Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
genome edited transient transfection, CMV promoter
Supplementary Figure 1. In the absence of new protein translation, overexpressed caveolin-1-gfp is degraded faster than caveolin-1-gfp expressed from the endogenous caveolin 1 locus % loss of total caveolin-1-gfp
Supplementary Figure 1
Supplementary Figure 1 ZV 50 nm Relative to Protein Levels () C Relative to Protein Levels () 6 4 2 0 10 8 6 4 2 0 Treatment Time (6 h) ZV Concentration (25 µm) ZV Concentration (25 µm) Supplementary Figure
GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!
Supplementary information a +KA Relative expression d! Tlr9 5!! 5! NSC Neuron Astrocyte Microglia! 5! Tlr7!!!! NSC Neuron Astrocyte! GFP/Sβ/! Iba/Hoechst Microglia e Hoechst/Iba/TLR9! GFP/Iba/GFAP f Brain
Supplementary Materials for
www.sciencetranslationalmedicine.org/cgi/content/full/4/117/117ra8/dc1 Supplementary Materials for Notch4 Normalization Reduces Blood Vessel Size in Arteriovenous Malformations Patrick A. Murphy, Tyson
Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad
Supplementary Figure 1 Validation of Per2 deletion in neuronal cells in N Per2 -/- mice. (a) Western blot from liver extracts of mice held under ad libitum conditions detecting PER2 protein in brain and
Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion.
Supplementary Information Supplementary Figure 1. Ent inhibits LPO activity in a dose- and time-dependent fashion. Various concentrations of Ent, DHBA or ABAH were pre-incubated for 10 min with LPO (50
Islet viability assay and Glucose Stimulated Insulin Secretion assay RT-PCR and Western Blot
Islet viability assay and Glucose Stimulated Insulin Secretion assay Islet cell viability was determined by colorimetric (3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide assay using CellTiter
Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al
Supplementary Material Rescue of mutant rhodopsin traffic by metformin-induced AMPK activation accelerates photoreceptor degeneration Athanasiou et al Supplementary Figure 1. AICAR improves P23H rod opsin
a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53
1 2 3 4 5 6 7 8 9 10 Supplementary Figure 1. Induction of p53 LOH by MADM. a) Primary cultures derived from the pancreas of an 11-week-old Pdx1-Cre; K-MADM-p53 mouse revealed increased p53 KO/KO (green,
Impact factor: Reporter:4A1H0019 Chen Zi Hao 4A1H0023 Huang Wan ting 4A1H0039 Sue Yi Zhu 4A1H0070 Lin Guan cheng 4A1H0077 Chen Bo xuan
Curcumin Protects Neonatal Rat Cardiomyocytes against High Glucose-Induced Apoptosis via PI3K/Akt Signalling Pathway Wei Yu,1,2 Wenliang Zha,1 Zhiqiang Ke,1 Qing Min,2 Cairong Li,1 Huirong Sun,3 and Chao
BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice
SUPPLEMENTARY MATERIALS BMP6 treatment compensates for the molecular defect and ameliorates hemochromatosis in Hfe knockout mice Elena Corradini, Paul J. Schmidt, Delphine Meynard, Cinzia Garuti, Giuliana
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
Supplementary Materials and Methods
Supplementary Materials and Methods Hepatocyte toxicity assay. Freshly isolated hepatocytes were incubated for overnight with varying concentrations (-25 µm) of sodium glycochenodeoxycholate (GCDC) or
Supplementary Figure 1. SybII and Ceb are sorted to distinct vesicle populations in astrocytes. Nature Neuroscience: doi: /nn.
Supplementary Figure 1 SybII and Ceb are sorted to distinct vesicle populations in astrocytes. (a) Exemplary images for cultured astrocytes co-immunolabeled with SybII and Ceb antibodies. SybII accumulates
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
SUPPLEMENTARY LEGENDS...
TABLE OF CONTENTS SUPPLEMENTARY LEGENDS... 2 11 MOVIE S1... 2 FIGURE S1 LEGEND... 3 FIGURE S2 LEGEND... 4 FIGURE S3 LEGEND... 5 FIGURE S4 LEGEND... 6 FIGURE S5 LEGEND... 7 FIGURE S6 LEGEND... 8 FIGURE
SUPPLEMENTARY INFORMATION
DOI:.38/ncb3399 a b c d FSP DAPI 5mm mm 5mm 5mm e Correspond to melanoma in-situ Figure a DCT FSP- f MITF mm mm MlanaA melanoma in-situ DCT 5mm FSP- mm mm mm mm mm g melanoma in-situ MITF MlanaA mm mm
Validation & Assay Performance Summary
Validation & Assay Performance Summary LanthaScreen IGF-1R GripTite Cells Cat. no. K1834 Modification Detected: Phosphorylation of Multiple Tyr Residues on IGF-1R LanthaScreen Cellular Assay Validation
Supplemental Information. Tissue Myeloid Progenitors Differentiate. into Pericytes through TGF-b Signaling. in Developing Skin Vasculature
Cell Reports, Volume 18 Supplemental Information Tissue Myeloid Progenitors Differentiate into Pericytes through TGF-b Signaling in Developing Skin Vasculature Tomoko Yamazaki, Ani Nalbandian, Yutaka Uchida,
Postn MCM Smad2 fl/fl Postn MCM Smad3 fl/fl Postn MCM Smad2/3 fl/fl. Postn MCM. Tgfbr1/2 fl/fl TAC
A Smad2 fl/fl Smad3 fl/fl Smad2/3 fl/fl Tgfbr1/2 fl/fl 1. mm B Tcf21 MCM Tcf21 MCM Smad3 fl/fl Tcf21 MCM Smad2/3 fl/fl Tcf21 MCM Tgfbr1/2 fl/fl αmhc MCM C 1. mm 1. mm D Smad2 fl/fl Smad3 fl/fl Smad2/3
BMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented
Supplemental Materials Figure S1. Cultured BMDCs express CD11c BMDCs were generated in vitro from bone marrow cells cultured in 10 % RPMI supplemented with 15 ng/ml GM-CSF. Media was changed and fresh
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2
Supplementary Fig. 1. Identification of acetylation of K68 of SOD2 A B H. sapiens 54 KHHAAYVNNLNVTEEKYQEALAK 75 M. musculus 54 KHHAAYVNNLNATEEKYHEALAK 75 X. laevis 55 KHHATYVNNLNITEEKYAEALAK 77 D. rerio
A263 A352 A204. Pan CK. pstat STAT3 pstat3 STAT3 pstat3. Columns Columns 1-6 Positive control. Omentum. Rectosigmoid A195.
pstat3 75 Pan CK A A263 A352 A24 B Columns 1-6 Positive control A195 A22 A24 A183 Rectal Nodule STAT3 pstat3 STAT3 pstat3 Columns 7-12 Omentum Rectosigmoid Left Ovary Right Ovary Omentum Uterus Uterus
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10188 Supplementary Figure 1. Embryonic epicardial genes are down-regulated from midgestation stages and barely detectable post-natally. Real time qrt-pcr revealed a significant down-regulation
HSP72 HSP90. Quadriceps Muscle. MEF2c MyoD1 MyoG Myf5 Hsf1 Hsp GLUT4/GAPDH (AU)
Supplementary Figure 1. Impaired insulin action in HSP72 deficient muscle and myotubes in culture cannot be explained by altered myogenesis or reduced total GLUT4 expression. Genes associated with myogenesis
SUPPLEMENTARY INFORMATION
doi: 10.1038/nature06994 A phosphatase cascade by which rewarding stimuli control nucleosomal response A. Stipanovich*, E. Valjent*, M. Matamales*, A. Nishi, J.H. Ahn, M. Maroteaux, J. Bertran-Gonzalez,
SUPPLEMENTARY DATA. Supplementary Table 1. Primer sequences for qrt-pcr
Supplementary Table 1. Primer sequences for qrt-pcr Gene PRDM16 UCP1 PGC1α Dio2 Elovl3 Cidea Cox8b PPARγ AP2 mttfam CyCs Nampt NRF1 16s-rRNA Hexokinase 2, intron 9 β-actin Primer Sequences 5'-CCA CCA GCG
Figure S1, related to Figure 1. Escaper p38a-expressing cancer cells repopulate the tumors (A) Scheme of the mt/mg reporter that expresses a
Cancer Cell, Volume 33 Supplemental Information Targeting p38a Increases DNA Damage, Chromosome Instability, and the Anti-tumoral Response to Taxanes in Breast Cancer Cells Begoña Cánovas, Ana Igea, Alessandro
SOD1 inhibition reduces non-small cell lung cancer by inducing cell death
SUPPLEMENTAL INFORMATION SOD1 inhibition reduces non-small cell lung cancer by inducing cell death Andrea Glasauer, Laura A. Sena, Lauren P. Diebold, Andrew P. Mazar & Navdeep S. Chandel Inventory of Supplemental
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table.
Type of file: PDF Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Tale. Type of file: VI Title of file for HTML: Supplementary Movie 1 Description:
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were
Supplementary Figure 1 CD4 + T cells from PKC-θ null mice are defective in NF-κB activation during T cell receptor signaling. CD4 + T cells were isolated from wild type (PKC-θ- WT) or PKC-θ null (PKC-θ-KO)
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±
Supplementary data: Control DC Blimp-1 ko DC 8 6 4 2-2 IL-1β p=.5 medium 8 6 4 2 IL-2 Medium p=.16 8 6 4 2 IL-6 medium p=.3 5 4 3 2 1-1 medium IL-1 n.s. 25 2 15 1 5 IL-12(p7) p=.15 5 IFNγ p=.65 4 3 2 1
Figure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
Supplementary Figure 1
Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5
Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)
Supplemental Methods Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2) podocytes were cultured as described previously. Staurosporine, angiotensin II and actinomycin D were all obtained
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols
Supplementary Figure S1. Monolayer differentiation of mouse ESCs into telencephalic neural precursors. (a) Schematic representation of the protocols used to differentiate mouse ESCs. (b) Representative
IL-6Rα IL-6RαT-KO KO. IL-6Rα f/f bp. f/f 628 bp deleted 368 bp. 500 bp
STD H 2 O WT KO IL-6Rα f/f IL-6Rα IL-6RαT-KO KO 1000 bp 500 bp f/f 628 bp deleted 368 bp Supplementary Figure 1 Confirmation of T-cell IL-6Rα deficiency. (a) Representative histograms and (b) quantification
Glucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon
Glucose Homeostasis Liver Glucose Glucose utilization Glucose production, storage Insulin Glucagon Muscle, Fat Pancreatic Islet Classification of Diabetes Type 1 diabetes Type 2 diabetes Other types of
(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses
Supplemental Figure 1. (A) The localization of Cre DNA recombinase in the testis of Cyp19a1-Cre mice was detected by immunohistchemical analyses using an anti-cre antibody; testes at 1 week (left panel),
Nature Neuroscience: doi: /nn Supplementary Figure 1. Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons
Supplementary Figure 1 Diverse anorexigenic signals induce c-fos expression in CEl PKC-δ + neurons a-c. Quantification of CEl c-fos expression in mice intraperitoneal injected with anorexigenic drugs (a),
Results and discussion
Supplementary Figure 1. Assessment of the cross-talk between FuraPE3 and D4ER fluorescent spectra. Cells were perifused with 15 mmol/l glucose (G15) in the presence of 250 µmol/l of the KATP channel opener
1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
![1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]](/thumbs/87/97258189.jpg "1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]")
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
SUPPLEMENTARY INFORMATION
b 350 300 250 200 150 100 50 0 E0 E10 E50 E0 E10 E50 E0 E10 E50 E0 E10 E50 Number of organoids per well 350 300 250 200 150 100 50 0 R0 R50 R100 R500 1st 2nd 3rd Noggin 100 ng/ml Noggin 10 ng/ml Noggin
Influenza virus exploits tunneling nanotubes for cell-to-cell spread
Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,
Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion
Supplementary online material to Interleukin-6 enhances insulin secretion by increasing L cell and cell glucagon-like peptide-1 secretion Helga Ellingsgaard 1, Irina Hauselmann 1, Beat Schuler 2, Abdella
mm Distance (mm)
b a Magnet Illumination Coverslips MPs Objective 2575 µm 1875 µm 1575 µm 1075 µm 875 µm 545 µm 20µm 2 3 0.5 0.3mm 1 1000 100 10 1 0.1 1000 100 10 1 0.1 Field Induction (Gauss) 1.5 0 5 10 15 20 Distance