Severe epilepsy as the major symptom of new mutations in the mitochondrial trna Phe gene

Transcription

1 Severe epilepsy as the major symptom of new mutations in the mitochondrial trna Phe gene G. Zsurka, MD, PhD* K.G. Hampel* I. Nelson, PhD C. Jardel, PharmD, PhD S.R. Mirandola, PhD R. Sassen, MD C. Kornblum, MD P. Marcorelles, MD S. Lavoué, MD A. Lombès, MD, PhD W.S. Kunz, PhD Address correspondence and reprint requests to Dr. Wolfram S. Kunz, Division of Neurochemistry, Department of Epileptology and Life & Brain Center, University Bonn Medical Center, Sigmund-Freud-Str. 25, D Bonn, Germany ABSTRACT Objective: To present 2 families with maternally inherited severe epilepsy as the main symptom of mitochondrial disease due to point mutations at position 616 in the mitochondrial trna Phe (MT- TF) gene. Methods: Histologic stainings were performed on skeletal muscle slices from the 2 index patients. Oxidative phosphorylation activity was measured by oxygraphic and spectrophotometric methods. The patients complete mitochondrial DNA (mtdna) and the relevant mtdna region in maternal relatives were sequenced. Results: Muscle histology showed only decreased overall COX staining, while a combined respiratory chain defect, most severely affecting complex IV, was noted in both patients skeletal muscle. Sequencing of the mtdna revealed in both patients a mutation at position 616 in the MT-TF gene (T C ort G). These mutations disrupt a base pair in the anticodon stem at a highly conserved position. They were apparently homoplasmic in both patients, and had different heteroplasmy levels in the investigated maternal relatives. Conclusions: Deleterious mutations in the mitochondrial trna Phe may solely manifest with epilepsy when segregating to homoplasmy. They may be overlooked in the absence of lactate accumulation and typical mosaic mitochondrial defects in muscle. Neurology 2010;74: GLOSSARY AED antiepileptic drug; COX cytochrome c oxidase; CPS complex partial seizures; MELAS mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes; MERRF myoclonus epilepsy with ragged red fibers; mtdna mitochondrial DNA; RFLP restriction fragment length polymorphism; SDH succinate dehydrogenase. Epilepsy is a common feature of mitochondrial encephalopathies caused by defective oxidative phosphorylation in the CNS. 1-5 In myoclonus epilepsy with ragged red fibers (MERRF), mitochondrial dysfunction associates with myoclonic epilepsy, commonly in combination with ataxia, hearing loss, peripheral neuropathy, short stature, dementia, and lactic acidosis. This syndrome is most often due to the m.8344a G mutation in the mitochondrial DNA (mtdna) trna Lys gene (MT-TK). 1,2 Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS), rarely presenting with epilepsy, is most frequently associated with the m.3243a G mutation in the mtdna trna Leu gene (MT-TL1). 3 In other mitochondrial encephalopathies, the majority of mutations are located in the mtdna genes MT-TL1 and MT-TK, but mutations occur in other mtdna trna genes 4 such as 2 mutations of the mtdna trna Phe gene (MT-TF) in2 patients presenting with MERRF (m.611g A 6 ) or MELAS (m.583g A 7 ) syndrome. Here, we report 2 families with maternally inherited severe epilepsy as the major clinical symptom due to 2 different mutations at the same 616 nucleotide position in the mitochondrial MT-TF gene. * These authors contributed equally. From the Departments of Epileptology and Life & Brain Center (G.Z., K.G.H., S.M., R.S., W.S.K.), Department of Neurology (C.K.), University of Bonn, Bonn, Germany; Inserm (I.N., C.J., A.L.), UMRS 975, Paris; Université Pierre et Marie Curie UPMC-Paris 6 (A.L.), Paris; AP-HP (C.J., A.L.), Department of Metabolic Biochemistry, Hôpital de La Salpêtrière, Paris; Pathology Department (P.M.), Morvan Hospital, Brest; and Intensive Care Unit (S.L.), CHU de Rennes, France. Study funding: Supported by the Deutsche Forschungsgemeinschaft (KU-911/15-1, TR3-A11 and TR3-D12) and the BMBF (01GZ0704, 01GM0868) to W.S.K. and by the AFM (Association Française contre les Myopathies) to I.N. and A.L. Disclosure: The authors report no disclosures. Copyright 2010 by AAN Enterprises, Inc. 507

2 Figure 1 Pedigrees of affected families Red pie charts indicate mutation loads determined in buccal mucosa from investigated family members, fibroblasts of patient 1, and blood of patient 2. METHODS Patients. Patient 1, the index patient from the first family, had her first epileptic seizure at the age of 10 months with a left-sided complex partial seizure followed by a transient paresis of the left arm. Carbamazepine was administered but 2 months after it was discontinued because of adverse effects, a second seizure occurred at the age of 2 years, manifesting as status epilepticus with bilateral myoclonus. Thiopental was necessary to stop the seizures, which were followed by amaurosis lasting several weeks. Subsequently, she developed a mild rightsided spastic paresis and delayed psychomotor development. In the following years, she had antiepileptic drug (AED) resistant complex partial seizures (CPS) with a tonic turning of the head, unilateral clonic jerks predominantly in the right but also in the left arm, and unconsciousness for 30 to 60 seconds with a frequency of 1 10 per month. EEG was abnormal with theta slowing and intermittent multifocal sharp waves and sharp slow waves. A status epilepticus of CPS with right-sided convulsions and loss of consciousness at age 11 necessitated high-dose benzodiazepines with mechanical ventilation for 9 days. Three days after termination of mechanical ventilation, myoclonus of the right sternocleidomastoid started and evolved into epilepsia partialis continua of the right arm; this focal motor status stopped during sleep. There was no evidence of cerebellar ataxia, polyneuropathy, myopathy, or visual or hearing loss. Her brain MRI was normal, as were her blood lactate levels. A muscle biopsy was performed. In the following years the patient had drug-resistant epileptic seizures, nonepileptic myoclonus, and a progressive encephalopathy with tetraplegia. She had chronic renal insufficiency and died of heart failure after status epilepticus at the age of 17 years. The pedigree of patient 1 s family is shown in figure 1A. A maternal cousin of the patient also had epileptic seizures starting in early childhood and died of kidney failure. Patient 2, the index patient from the second family, was healthy until the age of 15 years when, after a few days with headache, he presented with 2 generalized tonic-clonic seizures rapidly followed by continuous partial seizures affecting the left hemiface. Myoclonus without EEG abnormalities had been noted at the beginning of the status epilepticus, but the EEG eventually showed typical spike-waves in the right frontotempo- Figure 2 Muscle histology of patients in comparison to a control and an individual with mtdna deletion Upper panels: succinate dehydrogenase (SDH), middle panels: cytochrome c oxidase (COX), and lower panels: COX/SDH double stainings. Deletion, muscle biopsy of a patient with chronic progressive ophthalmoplegia (CPEO) harboring a single 3.6-kb mtdna deletion. Note the decreased general intensity of the COX staining in both patients muscle in comparison with the control and the lack of typical mosaic pattern in comparison to the patient with CPEO. Scale bar, 100 m. 508 Neurology 74 February 9, 2010

3 ral cortex that were secondarily generalized. The status epilepticus stopped after 72 hours of intensive barbiturate treatment requiring mechanical ventilation. Treated with topiramate and carbamazepine, there were no seizures until an episode of status epilepticus at 17 years, beginning with partial myoclonic seizures of the upper right limb, initially without EEG abnormalities. This evolved to repeated seizures of the left hemibody accompanied by typical spike-waves in the right frontotemporal cortex. Clinical seizures only disappeared under deep general anesthesia but electric discharges persisted. Whenever reduction of the AEDs was attempted, seizures recurred, initially in the left hemibody, then generalized. The patient died of infection in intensive care unit after 4 months in status epilepticus. The pedigree of patient 2 is shown in figure 1B. The patient s mother presented with status epilepticus that closely resembled that of her son s. They were identical in the age at onset (15 years of age); in the absence of associated symptoms, in particular the absence of any previous mental deterioration; in the initial presentation with focal myoclonus without EEG correlate, rapidly followed by seizures with electric discharges; in the focal then generalized nature of the seizures; and in their pharmacoresistance. Unlike her son, the mother never had any other status epilepticus despite 4 5 generalized tonic-clonic seizures per year, treated with primidone and valproic acid. A maternal aunt of the patient also presented with status epilepticus at 15 years of age, without previously noted symptoms. Details are scarce for the precise epileptic features of the status epilepticus but they included generalized tonic-clonic seizures and electric discharges. The maternal aunt never recovered from her first status epilepticus and died of infectious complication after 15 months. The patient s younger sister is healthy. Standard protocol approvals, registrations, and patient consents. This study was conducted according to the guidelines of the University Bonn Ethical Committee and the Rennes Medical University. Written informed consent was obtained from all patients (or guardians of patients) included in the study. Muscle histology. The muscle biopsies were immediately frozen in isopentane cooled to liquid nitrogen temperature. Histochemical analyses of cytochrome c oxidase (COX) and succinate dehydrogenase activities were performed according to Dubowitz and Brooke. 8 Biochemical investigations. Respiratory chain enzyme activities (rotenone sensitive NADH-CoQ 1 oxidoreductase [complex I], antimycin sensitive CoQH 2 -cytochrome c oxidoreductase [complex III], and COX [complex IV]) and citrate synthase in skeletal muscle homogenate were measured spectrophotometrically by standard methods, as described previously 9 and in protocols at Results were corrected for potential fiber type variation or mitochondrial proliferation by normalization of data to the mitochondrial marker enzyme citrate synthase. The maximal rates of respiration of saponin-permeabilized muscle fibers were assessed by high-resolution respirometry as described. 10 DNA mutation analysis. Total DNA was extracted from 10-mL aliquots of EDTA anticoagulated blood using a saltingout method, 11 from buccal swabs, urine sediment, or cultured fibroblasts with the QiaAmp DNA mini kit (Qiagen, Hilden, Germany), and from muscle biopsy specimens using routine procedure based on SDS-proteinase K digestion followed by phenol-chloroform extraction and isopropanol precipitation. Direct sequencing of purified PCR products was performed on an automatic sequence analyzer. PCR amplification followed by RFLP was used to detect the MT-TF mutations. The m.616t C mutation was analyzed after amplification between primers ACACCGCTGCTAACCCCAT- AC (nt ) and GGTGATGTGAGCCCGTCTAAAC (nt ) and digestion with restriction endonuclease HpyCH4IV that cleaves the PCR product in the presence of mutation m.616t C. The m.616t G mutation was analyzed after amplification between primers CCTCAAAGCAATA- CACTGAAGA (nt ) and AGGGTGAACTCACT- GGAACG (nt ). The forward primer carries a mismatched nucleotide (underlined) that allows creation of a restriction site for endonuclease Eam1104I in the presence of mutation m.616t G. Denaturing gradient gel electrophoresis was performed as described. 12 RESULTS Muscle histology showed a COX defect but no ragged red fibers. Typical ragged red fibers were not seen with modified Gomori trichrome staining of both patients muscle (data not shown) or with succinate dehydrogenase (SDH) histochemical staining (figure 2). COX histochemical staining was markedly decreased in virtually all muscle fibers of both patients biopsies (figure 2). Although in patient 2 some fibers might appear less defective than others, the pattern observed in both patients clearly differed from the typical appearance of mosaic pattern of in- Table Respiratory chain complex activities in skeletal muscle homogenates a Controls (n 200) Patient 1 Patient 2 Complex I SDH ND ND Complex III ND ND Complex IV Citrate synthase Complex I/CS Complex III/CS ND 0.37 Complex IV/CS Abbreviations: complex I NADH ubiquinone oxidoreductase; complex III ubiquinol cytochrome c oxidoreductase; complex IV cytochrome c oxidase; SDH succinate dehydrogenase, proximal part of respiratory complex II. a Spectrophotometric assays were performed with different protocols in the 2 diagnostic centers (see Methods) and therefore had different control values. Normalization of the respiratory activities to citrate synthase, however, gave similar control ranges in the 2 centers. The absolute activities are expressed in micromoles per minute and g muscle wet weight (patient 1) or nanomoles per minute and milligram protein in muscle homogenate (patient 2). Neurology 74 February 9,

4 Figure 3 Detected mutations in the mitochondria phenylalanyl-trna gene Combined defect of the respiratory chain was shown by biochemical investigations of skeletal muscle biopsies. Decreased rates of maximal respiration were observed with all substrates by oxygraphic measurements of saponin-permeabilized muscle fibers from patient 1. Glutamate and malate gave a value of nmol O 2 /min/mg dry weight (controls: ), while nmol O 2 /min/mg dry weight (controls: ) was measured with succinate. Fiber respiration using TMPD ascorbate, substrates entering the respiratory chain at the level of complex IV, showed the most severe decrease, 7.5 nmol O 2 / min/mg dry weight in comparison to in controls. This pronounced complex IV deficiency was confirmed by titrations of muscle fiber respiration with cyanide, an irreversible inhibitor of COX. The increased cyanide sensitivity of respiration resulted in an increased flux control coefficient of complex IV 13 ( in comparison to in controls). The activities of respiratory chain complexes were analyzed in muscle homogenates from both patients using spectrophotometry. In both patients, the COX activity was severely decreased both in absolute terms and after normalization to citrate synthase activity (table). Other respiratory complexes whose activity depends on the mtdna function were also defective but only when normalized to citrate synthase activity. Activity of complex II, the only respiratory chain complex with only nuclear DNA-encoded subunits, was elevated in patient 2 s muscle, as was that of citrate synthase, thus showing that the patients muscle had an increased mitochondrial population despite the absence of ragged red fibers on histology. (A) mtdna sequence of the index patient of family 1 showing the m.616t C mutation. (B) mtdna sequence of the index patient of family 2 showing the m.616t G mutation. (C) Structure of the mitochondrial trna Phe with the mutated site indicated. The stars indicate the anticodon positions. tense mitochondrial proliferation and COX defect leading to the presence of characteristic blue fibers with COX/SDH double staining as observed in typical mitochondrial myopathy due to a heteroplasmic mtdna deletion (figure 2). Mutations of the same nucleotide position in the MT-TF gene were found in both patients. After excluding the presence of large-scale mtdna rearrangements, the complete mtdna of both patients was sequenced (GenBank accession number GQ for patient 1 and GQ for patient 2). In addition to known mtdna polymorphisms, an apparently homoplasmic T to C transition was detected in patient 1 (figure 3A) and a T to G transversion in patient 2 (figure 3B) at position 616 in the mitochondrial trna Phe gene (MT- TF). This nucleotide position is strictly conserved in mammals and the changes detected in the patients have never been encountered in any of the over 5,000 human complete mtdna sequences known to date. 14 Both mutations disrupt a Watson-Crick base pair at the end of the anticodon stem (figure 3C). Restriction fragment length polymorphism (RFLP) analysis showed that the m.616t C mutation was apparently homoplasmic in all tissue samples of patient 1, except leukocytes, where traces of the wild-type allele were detectable (figure 4A). The mutation was heteroplasmic in buccal swabs from healthy maternal relatives of patient 1. RFLP analysis also showed that mutation m.616t G was apparently homoplasmic in skeletal muscle of patient 2 (figure 4B). However, the presence of faint heteroduplex bands in denaturing gradient gel electrophoresis showed that the mutation was heteroplasmic in muscle, albeit present in a very high proportion, and homoplasmic in blood (figure 4C). Analysis of other mtdna polymorphisms showed that patient 1 belongs to the mtdna haplogroup H10, and patient 2 to T2. This indicates that the occurrence of the 616 mutations is not associated with a specific mtdna haplogroup. DISCUSSION We describe 2 different nucleotide changes at position 616 in the mitochondrial phenylalanyl-trna gene (MT-TF) that are, despite 510 Neurology 74 February 9, 2010

5 Figure 4 Analysis of the heteroplasmy levels of the np 616 mutations by restriction fragment length polymorphism and DGGE (A) Detection of the m.616t C mutation in members of family 1. A 10% polyacrylamide gel is shown after SYBR Green I staining. MB muscle biopsy; UR urinary sediment; FB fibroblasts; BL blood; BS buccal swab; C control DNA sample; wt wild-type 616T allele; mut mutant 616C allele. (B) Mutation analysis of m.616t G in skeletal muscle of the index patient from family 2. C control; MB digested PCR product from the patient s muscle biopsy; U undigested PCR product from patient s muscle biopsy. (C) Detection of the m.616t G mutation in the index patient of family 2 using denaturing gradient gel electrophoresis (DGGE). Mixing a control DNA sample (C) with DNA from the patient s blood (BL) or muscle biopsy (MB) prior to PCR amplification allowed to show the different migration pattern of the homoduplex DNA fragments with reference sequence (wt) or m.616t G mutation (mut). Heteroduplex molecules (hd) created during amplification are faintly visible in the upper part of the gel (lanes C BL and C MB). Their faint presence in the DNA fragments amplified from the patient s muscle DNA (lane MB) indicated that the mutation was heteroplasmic in that tissue. of lack of direct evidence of an intramitochondrial translation defect, very likely the cause of epilepsy in 2 unrelated patients. Both patients were carrying their mutations in most tissues at an apparently homoplasmic state, while heteroplasmic family members were free of symptoms. Only mutation m.616t C has been previously reported as a low heteroplasmy level somatic mutation in a thymidine phosphorylase deficient patient, where the nuclear gene defect leads to increased mtdna mutation rate. 15 The nucleotide changes disrupt a highly conserved Watson-Crick base pairing located at the end of the anticodon stem of trna Phe that is likely involved in the secondary structure of the trna molecule. It has occurred twice in different mtdna haplotypes and is associated with strikingly similar clinical and biochemical manifestations. The fact that all investigated heteroplasmic family members from family 1 were healthy demonstrated that the m.616t C mutation results in mitochondrial failure only at homoplasmy (or very high proportion of the mutation). This indicates that the deleterious effects of the m.616t C mutation are mild and easily compensated by the presence of wild-type mtdna molecules. The mutation can, therefore, be transmitted in heteroplasmic form through generations without phenotypic expression. The prominent phenotypic expression of the disease in both families was severe intractable epilepsy as previously reported with homoplasmic point mutations in trna Ser(UCN). 16,17 One possible explanation for that particular phenotype could be an extreme sensitivity to energy deprivation of certain interneurons with a very high mitochondrial content. Mildly deleterious homoplasmic mitochondrial DNA mutations might compromise specific neuronal populations, thus creating a state of excessive excitability. 5 Apart from severe encephalopathy, both members of family 1 with epilepsy had progressive kidney failure. Such an involvement of kidney has been reported before in association with the m.3243a G mutation in MT-TL1. 18 Renal symptoms were absent in the members of family 2, however. It thus remains to be elucidated whether that difference is due to subtle difference in the mutation severity (transition vs transversion) or to other mechanisms. Providing convincing evidence for the pathogenic effect of homoplasmic mtdna mutations is a difficult task, exemplified by our cases, for which the usual characteristics associated with deleterious heteroplasmic mutations were lacking, in particular the mosaic pattern of mitochondrial proliferation and COX defect in skeletal muscle. The observed general decrease in the intensity of COX staining could easily be overlooked in the absence of identically processed controls. Biochemical assays of mitochondrial respiratory chain activities are, therefore, especially useful under these circumstances, identifying the pronounced biochemical defects in complexes IV, I, and III, that all depend on mtdna-encoded subunits. Similar observations were made for apparently homoplasmic patients with the MT-TK gene m.8344a G mutation 19 or the MT-TV gene m.1624c T mutation. 20 The COX deficiency observed in both patients could be explained by the high number of phenylalanine residues in COX subunit 1 that contains all prosthetic groups required for catalysis. A similar effect for one of the respiratory Neurology 74 February 9,

6 complexes has been discussed for the MT-TK m.8344a G mutation on the basis of the elevated lysine codon frequency in the ND5 gene. 21 There are major diagnostic impediments in cases of deleterious homoplasmic mtdna mutations, since they 1) have normal blood lactate levels and 2) lack typical histopathologic hallmarks of mtdna involvement. These features were observed for our patients but have also been reported for other cases. 20 It may be that the mutations have a relatively mild metabolic impact, failing to induce symptoms until reaching near homoplasmy. Received May 19, Accepted in final form November 10, REFERENCES 1. Shoffner JM, Lott MT, Lezza AM, Seibel P, Ballinger SW, Wallace DC. Myoclonic epilepsy and ragged-red fiber disease (MERRF) is associated with a mitochondrial DNA trna(lys) mutation. Cell 1990;61: Zeviani M, Muntoni F, Savarese N, et al. A MERRF/ MELAS overlap syndrome associated with a new point mutation in the mitochondrial DNA trna(lys) gene. Eur J Hum Genet 1993;1: Goto Y, Nonaka I, Horai S. A mutation in the trna- (Leu)(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies. Nature 1990;348: Hirano M, Kunz WS, DiMauro S. Mitochondrial diseases. In: Engel J, Pedley TA, eds. Epilepsy: A Comprehensive Textbook. Philadelphia: Lippincott Williams & Wilkins; 2008: Kudin AP, Zsurka G, Elger CE, Kunz WS. Mitochondrial involvement in temporal lobe epilepsy. Exp Neurol 2009; 218: Mancuso M, Filosto M, Mootha VK, et al. A novel mitochondrial trnaphe mutation causes MERRF syndrome. Neurology 2004;62: Hanna MG, Nelson IP, Morgan-Hughes JA, Wood NW. MELAS: a new disease associated mitochondrial DNA mutation and evidence for further genetic heterogeneity. J Neurol Neurosurg Psychiatry 1998;65: Dubowitz V, Brooke MH. Muscle Biopsy: A Modern Approach. Philadelphia: W.B. Saunders; Wiedemann FR, Vielhaber S, Schröder R, Elger CE, Kunz WS. Evaluation of methods for the determination of mitochondrial respiratory chain enzyme activities in human skeletal muscle samples. Anal Biochem 2000;279: Kuznetsov AV, Veksler V, Gellerich FN, Saks V, Margreiter R, Kunz WS. Analysis of mitochondrial function in situ in permeabilized muscle fibers, tissues and cells. Nat Protoc 2008;3: Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16: Sternberg D, Chatzoglou E, Laforêt P, et al. Mitochondrial DNA transfer RNA gene sequence variations in patients with mitochondrial disorders. Brain 2001;124: Kunz WS, Kudin A, Vielhaber S, Elger CE, Attardi G, Villani G. Flux control of cytochrome c oxidase in human skeletal muscle. J Biol Chem 2000;275: Pereira L, Freitas F, Fernandes V, et al. The diversity present in 5140 human mitochondrial genomes. Am J Hum Genet 2009;84: Nishigaki Y, Martí R, Copeland WC, Hirano M. Sitespecific somatic mitochondrial DNA point mutations in patients with thymidine phosphorylase deficiency. J Clin Invest 2003;111: Jaksch M, Klopstock T, Kurlemann G, et al. Progressive myoclonus epilepsy and mitochondrial myopathy associated with mutations in the trna(ser(ucn)) gene. Ann Neurol 1998;44: Schuelke M, Bakker M, Stoltenburg G, Sperner J, von Moers A. Epilepsia partialis continua associated with a homoplasmic mitochondrial trna(ser(ucn)) mutation. Ann Neurol 1998;44: Dinour D, Mini S, Polak-Charcon S, Lotan D, Holtzman EJ. Progressive nephropathy associated with mitochondrial trna gene mutation. Clin Nephrol 2004;62: Zsurka G, Hampel KG, Kudina T, et al. Inheritance of mitochondrial DNA recombinants in double-heteroplasmic families: potential implications for phylogenetic analysis. Am J Hum Genet 2007;80: McFarland R, Clark KM, Morris AA, et al. Multiple neonatal deaths due to a homoplasmic mitochondrial DNA mutation. Nat Genet 2002;30: Enriquez JA, Chomyn A, Attardi G. MtDNA mutation in MERRF syndrome causes defective aminoacylation of trna(lys) and premature translation termination. Nat Genet 1995;10: Neurology 74 February 9, 2010