Revit 2018 Architecture Certification Exam Study Guide

Size: px
Start display at page:

Download "Revit 2018 Architecture Certification Exam Study Guide"

Transcription

1 ELISE MOSS Autodesk Autodesk Certified Instructor Revit 2018 Architecture Certification Exam Study Guide Certified User and Certified Professional SDC P U B L I C AT I O N S Better Textbooks. Lower Prices. ACCESS CODE UNIQUE CODE INSIDE

2 Powered by TCPDF ( Visit the following websites to learn more about this book:

3 Table of Contents Introduction FAQs on Getting Certified in Revit Lesson One Building Information Modeling and Revit Basics Exercise 1-1 Quick Access Toolbar 1-4 Exercise 1-2 Exploring the User Interface 1-8 Exercise 1-3 Recover and Use Backup Files 1-9 : Exercise 1-4 Design Options 1-14 Exercise 1-5 Design Options Practice Question 1-27 Exercise 1-6 Phases 1-30 Certified User Practice Exam 1-44 Certified Professional Practice Exam 1-46 Lesson Two The Basics of Building a Model Exercise 2-1 Wall Options 2-2 Exercise 2-2 Compound Walls 2-6 Exercise 2-3 Stacked Walls 2-15 Exercise 2-4 Attaching Walls 2-17 Exercise 2-5 Array Components 2-20 Exercise 2-6 Placing a Wall Sweep 2-25 Exercise 2-7 Create a Wall Sweep Style 2-29 Exercise 2-8 Create a Custom Profile 2-31 Exercise 2-9 Dividing a Wall into Parts 2-34 I

4 Exercise 2-10 Creating an In-Place Mass 2-46 Exercise 2-11 Editing an In-Place Mass 2-61 Exercise 2-12 Mass Properties 2-68 Exercise 2-13 Mass Floors 2-71 Certified User Practice Exam 2-73 Certified Professional Practice Exam 2-75 Lesson Three Component Families Exercise 3-1 Level-Based Component 3-3 Exercise 3-2 Identifying a Family 3-5 Exercise 3-3 Creating a Family 3-7 Exercise 3-4 Creating a Door Panel 3-22 Exercise 3-5 Create a Nested Door Family 3-44 Exercise 3-6 Creating a Type Catalog 3-57 Exercise 3-7 Assigning OMNI Class Numbers 3-62 Exercise 3-8 Room Calculation Point 3-65 Exercise 3-9 Modifying an Existing Family 3-69 Certified User Practice Exam 3-71 Certified Professional Practice Exam 3-73 Lesson Four View Properties Exercise 4-1 Creating a Level 4-2 Exercise 4-2 Story vs. Non-Story Levels 4-4 Exercise 4-3 Creating Column Grids 4-7 Exercise 4-4 II

5 Create a Cropped View 4-14 Exercise 4-5 Change View Display 4-16 Exercise 4-6 Duplicating Views 4-20 Exercise 4-7 View Range 4-27 Exercise 4-8 Reveal Hidden Elements 4-29 Exercise 4-9 Duplicate a View 4-31 Exercise 4-10 Create a View Template 4-32 Exercise 4-11 Create a Scope Box 4-39 Exercise 4-12 Segmented Views 4-43 Exercise 4-13 Depth Cueing 4-47 Exercise 4-14 Rotate a Cropped View 4-52 Exercise 4-15 Apply a View Template to a Sheet 4-54 Exercise 4-16 Detail View 4-57 Certified User Practice Exam 4-58 Certified Professional Practice Exam 4-60 Lesson Five Dimensions and Constraints Exercise 5-1 Placing Permanent Dimensions 5-3 Exercise 5-2 Modifying Dimension Text 5-8 Exercise 5-3 Converting Temporary Dimensions to Permanent Dimensions 5-11 Exercise 5-4 Applying Constraints 5-13 Exercise 5-5 Multi-Segmented Dimensions 5-18 Exercise 5-6 Equality Formula 5-21 Exercise 5-7 Alternate Dimensions 5-23 Exercise 5-8 Global Parameters 5-25 III

6 Exercise 5-9 Reveal Constraints 5-33 Exercise 5-10 Add a Symbol to a Note 5-34 Certified User Practice Exam 5-35 Certified Professional Practice Exam 5-37 Lesson Six Developing the Building Model Exercise 6-1 Modifying a Floor Perimeter 6-3 Exercise 6-2 Modifying a Floor using Property Types 6-6 Exercise 6-3 Modifying a Ceiling 6-7 Exercise 6-4 Creating a Reflected Ceiling Plan 6-11 Exercise 6-5 Creating Stairs by Sketch 6-14 Exercise 6-6 Creating Stairs by Component 6-19 Exercise 6-7 Railings 6-23 Exercise 6-8 Creating a Roof by Footprint 6-27 Exercise 6-9 Modifying a Roof Join 6-30 Exercise 6-10 Modifying Assembled Stairs 6-36 Exercise 6-11 Multistory Stairs 6-42 Exercise 6-12 Baluster Family 6-45 Exercise 6-13 Railing Family 6-52 Exercise 6-14 Creating a Roof by Extrusion 6-60 Exercise 6-15 Creating a Sloped Ceiling 6-66 Certified User Practice Exam 6-72 Certified Professional Practice Exam 6-75 IV

7 Lesson Seven Detailing and Drafting Exercise 7-1 Creating Drafting Views 7-2 Exercise 7-2 Reassociate a Callout 7-8 Exercise 7-3 Filled Regions 7-11 Exercise 7-4 Adding Tags 7-16 Exercise 7-5 Creating a Detail View 7-20 Exercise 7-6 Creating a Drafting View 7-28 Exercise 7-7 Callout from Sketch 7-35 Exercise 7-8 Save and Re-Use a Drafting View 7-40 Exercise 7-9 Calculated Values in Tags and Schedules 7-42 Exercise 7-10 Creating a Detail Group 7-48 Exercise 7-11 Revision Control 7-51 Exercise 7-12 Modify a Revision Schedule 7-55 Exercise 7-13 Add Revision Clouds 7-59 Exercise 7-14 Aligning Views Between Sheets 7-64 Certified User Practice Exam 7-69 Certified Professional Practice Exam 7-71 Lesson Eight Construction Documentation Exercise 8-1 Creating a Door Schedule 8-2 Exercise 8-2 Add Notes 8-5 Exercise 8-3 Create a Schedule with Images 8-7 V

8 Exercise 8-4 Creating a Legend 8-16 Exercise 8-5 Creating a Furniture Legend 8-24 Exercise 8-6 Copying a Legend to a New Project 8-26 Exercise 8-7 Adding Rooms to a Floor Plan 8-29 Exercise 8-8 Creating an Area Scheme 8-32 Exercise 8-9 Creating an Area Plan 8-35 Exercise 8-10 Creating a Room Finish Schedule 8-40 Exercise 8-11 Creating a Drawing List 8-43 Exercise 8-12 Create a Note Symbol 8-46 Exercise 8-13 Create a Material TakeOff Schedule 8-51 Exercise 8-14 Create a Mass Floor Schedule 8-54 Exercise 8-15 Creating a Schedule Template 8-56 Certified User Practice Exam 8-60 Certified Professional Practice Exam 8-61 Lesson Nine Presenting the Building Model Exercise 9-1 Creating a Toposurface 9-2 Exercise 9-2 Toposurface Properties 9-12 Exercise 9-3 Imported CAD File Properties 9-14 Exercise 9-4 Defining Camera Views 9-15 Exercise 9-5 Sun Settings 9-22 Exercise 9-6 Rendering Settings 9-26 Exercise 9-7 Using Element Graphic Overrides in a Hidden View 9-28 Exercise 9-8 Render in Cloud 9-31 VI

9 Exercise 9-9 Place a Decal 9-34 Exercise 9-10 Adding a Background 9-39 Exercise 9-11 Using Transparency Settings 9-46 Exercise 9-12 Custom Render Settings 9-48 Exercise 9-13 Dynamo Player 9-52 Certified User Practice Exam 9-53 Certified Professional Practice Exam 9-54 Lesson Ten Collaboration Exercise 10-1 Monitoring a Linked File 10-3 Exercise 10-2 Interference Checking 10-9 Exercise 10-3 Using Shared Coordinates Exercise 10-4 Worksets Exercise 10-5 Worksets Display Exercise 10-6 Import an IFC File Certified Professional Practice Exam VII

Revit 2017 Architecture Certification Exam Study Guide

Revit 2017 Architecture Certification Exam Study Guide ELISE MOSS Autodesk Autodesk Certified Instructor Revit 2017 Architecture Certification Exam Study Guide Certified User and Certified Professional SDC P U B L I C AT I O N S Better Textbooks. Lower Prices.

More information

Elise Moss Revit Architecture 2017 Basics From the Ground Up SDC. Better Textbooks. Lower Prices.

Elise Moss Revit Architecture 2017 Basics From the Ground Up SDC. Better Textbooks. Lower Prices. Elise Moss Revit Architecture 2017 Basics From the Ground Up SDC P U B L I C AT I O N S Better Textbooks. Lower Prices. www.sdcpublications.com Powered by TCPDF (www.tcpdf.org) Visit the following websites

More information

Revit Architecture 2013 Basics: From the Ground Up

Revit Architecture 2013 Basics: From the Ground Up Revit Architecture 2013 Basics: From the Ground Up Elise Moss Supplemental Files SDC P U B L I C AT I O N S Schroff Development Corporation Better Textbooks. Lower Prices. www.sdcpublications.com Tutorial

More information

AutoCAD 2017 Fundamentals

AutoCAD 2017 Fundamentals Autodesk AutoCAD 2017 Fundamentals Elise Moss SDC PUBLICATIONS Better Textbooks. Lower Prices. www.sdcpublications.com Powered by TCPDF (www.tcpdf.org) Visit the following websites to learn more about

More information

Table of Contents Foreword 9 Stay Informed 9 Introduction to Visual Steps 10 What You Will Need 10 Basic Knowledge 11 How to Use This Book

Table of Contents Foreword 9 Stay Informed 9 Introduction to Visual Steps 10 What You Will Need 10 Basic Knowledge 11 How to Use This Book Table of Contents Foreword... 9 Stay Informed... 9 Introduction to Visual Steps... 10 What You Will Need... 10 Basic Knowledge... 11 How to Use This Book... 11 The Screenshots... 12 The Website and Supplementary

More information

Clinical Essentials Test Blueprint

Clinical Essentials Test Blueprint Clinical Essentials Test Blueprint Charting Treatment Planning Overview Who should take this Clinical Essentials test? Dentrix users with less than a year experience with Dentrix, or that have a limited

More information

FORMAT FOR CORRELATION TO THE GEORGIA PERFORMANCE STANDARDS. Textbook Title: Benchmark Series: Microsoft Office Publisher: EMC Publishing, LLC

FORMAT FOR CORRELATION TO THE GEORGIA PERFORMANCE STANDARDS. Textbook Title: Benchmark Series: Microsoft Office Publisher: EMC Publishing, LLC FORMAT FOR CORRELATION TO THE GEORGIA PERFORMANCE STANDARDS Subject Area: Business and Computer Science State-Funded Course: Computer Applications II Textbook Title: Benchmark Series: Microsoft Office

More information

Content Part 2 Users manual... 4

Content Part 2 Users manual... 4 Content Part 2 Users manual... 4 Introduction. What is Kleos... 4 Case management... 5 Identity management... 9 Document management... 11 Document generation... 15 e-mail management... 15 Installation

More information

LESSON COMMUNITY PLANNING SERIES for PANDEMIC INFLUENZA PREPAREDNESS:

LESSON COMMUNITY PLANNING SERIES for PANDEMIC INFLUENZA PREPAREDNESS: LESSON COMMUNITY PLANNING SERIES for PANDEMIC INFLUENZA PREPAREDNESS: PLANS A Series of Multi-Sector Collaborative Plan Development Sessions for Local Communities Center for Hazards Research & Policy Development

More information

Venue Mystery Shopping Form - Guide

Venue Mystery Shopping Form - Guide What we need: Venue Mystery Shopping Form - Guide It is important to us that you fill out the form using your own personal experiences. However, here may be fact-based questions that do not apply to your

More information

Prentice Hall. Learning Microsoft Excel , (Weixel et al.) Arkansas Spreadsheet Applications - Curriculum Content Frameworks

Prentice Hall. Learning Microsoft Excel , (Weixel et al.) Arkansas Spreadsheet Applications - Curriculum Content Frameworks Prentice Hall Learning Microsoft Excel 2007 2008, (Weixel et al.) C O R R E L A T E D T O Arkansas Spreadsheet s - Curriculum Content Frameworks Arkansas Spreadsheet s - Curriculum Content Frameworks Unit

More information

Preston Grande Villas and Town-homes. Architectural Standards and Guidelines

Preston Grande Villas and Town-homes. Architectural Standards and Guidelines Preston Grande Villas and Town-homes Architectural Standards and Guidelines Prestonian Place Grande Drive Open Court PGVTA Architectural Guidelines Section 1. Common Architectural Elements. Homeowners

More information

TIVA MidWinter 2019 Conference

TIVA MidWinter 2019 Conference Function Name Tuesday 1/15/2019 Start Date & Time TIVA MidWinter 2019 Conference End Date & Time Draft Agenda v1.2 Description Event Visual Cue Room Name Speaker Name TIVA Executive Board 1:00pm 3:00pm

More information

GLOBAL CRITERIA THE 12 CORE FUNCTIONS OF THE SUBSTANCE ABUSE COUNSELOR (SIXTH EDITION) BY JOHN HERDMAN

GLOBAL CRITERIA THE 12 CORE FUNCTIONS OF THE SUBSTANCE ABUSE COUNSELOR (SIXTH EDITION) BY JOHN HERDMAN Read Online and Download Ebook GLOBAL CRITERIA THE 12 CORE FUNCTIONS OF THE SUBSTANCE ABUSE COUNSELOR (SIXTH EDITION) BY JOHN HERDMAN DOWNLOAD EBOOK : GLOBAL CRITERIA THE 12 CORE FUNCTIONS OF THE Click

More information

Preparations. Planmeca Romexis Smile Design Quick guide. Capture 2D photo(s) Start Romexis Smile Design software

Preparations. Planmeca Romexis Smile Design Quick guide. Capture 2D photo(s) Start Romexis Smile Design software Planmeca Romexis Smile Design Quick guide Preparations Capture D photo(s) A face photo with smile A retractor photo (if gum line is not showing when smiling) Start Romexis Smile Design software From desktop

More information

From Biostatistics Using JMP: A Practical Guide. Full book available for purchase here. Chapter 1: Introduction... 1

From Biostatistics Using JMP: A Practical Guide. Full book available for purchase here. Chapter 1: Introduction... 1 From Biostatistics Using JMP: A Practical Guide. Full book available for purchase here. Contents Dedication... iii Acknowledgments... xi About This Book... xiii About the Author... xvii Chapter 1: Introduction...

More information

Audit Firm Administrator steps to follow

Audit Firm Administrator steps to follow Contents Audit Firm Administrator steps to follow... 3 What to know before you start... 3 Understanding CaseWare Cloud in a nutshell... 3 How to do the once off set up for the Audit Firm or Organisation...

More information

ClinCheck Fact Sheet.

ClinCheck Fact Sheet. ClinCheck Fact Sheet. Introducing new features of ClinCheck Pro with 3D Controls and ClinCheck Web Powered by your needs to optimize your treatment planning journey. This fact sheet provides an overview

More information

Welcome to the AccessibilityOnline Webinar Series. A collaborative program between the ADA National Network and the US Access Board

Welcome to the AccessibilityOnline Webinar Series. A collaborative program between the ADA National Network and the US Access Board Welcome to the AccessibilityOnline Webinar Series A collaborative program between the ADA National Network and the US Access Board The Session is Scheduled to begin at 2:30pm Eastern Time We will be testing

More information

costanzo physiology B476D3476C8EEE5CBAC4D93D Costanzo Physiology 1 / 6

costanzo physiology B476D3476C8EEE5CBAC4D93D Costanzo Physiology 1 / 6 Costanzo Physiology 1 / 6 2 / 6 3 / 6 Costanzo Physiology More Clinical Physiology Case Boxes relate to pathophysiology for a clinical context. Student Consult access includes high-yield student FAQs with

More information

Kinesis & Flexibility / Kinesis / Kinesis One. Kinesis One

Kinesis & Flexibility / Kinesis / Kinesis One. Kinesis One Kinesis & Flexibility / Kinesis / Kinesis One Kinesis One the ORIGINAL FUNCTIONAL Movement The Kinesis innovation & technology is also available in one single station. Developed as a free standing unit

More information

ISR Process for Internal Service Providers

ISR Process for Internal Service Providers ISR Process for Internal Service Providers Course Outline 1) Internal Service Request Process Overview Internal Service Requests (ISR) are created by the end user via the BUworks Central Portal Procurement

More information

Sectra Orthopaedic Solutions

Sectra Orthopaedic Solutions Sectra Orthopaedic Solutions Customer case story Well prepared before surgery Preoperative planning in 2D and 3D The Orthopaedic section at the University Hospital of Rostock is a well-known institute

More information

Syllabus. ASL Level 3. Instructor: Deanne Bray-Kotsur (Video Relay Service) Class Meets: In Room I-7

Syllabus. ASL Level 3. Instructor: Deanne Bray-Kotsur (Video Relay Service) Class Meets: In Room I-7 Syllabus ASL Level 3 Instructor: Deanne Bray-Kotsur dbray@opusd.org 818-483-0411 (Video Relay Service) Class Meets: In Room I-7 August 8, 2017 to May 25, 2018 Course Description Signing Naturally, Units

More information

Incorporation of Imaging-Based Functional Assessment Procedures into the DICOM Standard Draft version 0.1 7/27/2011

Incorporation of Imaging-Based Functional Assessment Procedures into the DICOM Standard Draft version 0.1 7/27/2011 Incorporation of Imaging-Based Functional Assessment Procedures into the DICOM Standard Draft version 0.1 7/27/2011 I. Purpose Drawing from the profile development of the QIBA-fMRI Technical Committee,

More information

BLOODPRESSURE & PULSE App for iphone, ipad and ipod USER GUIDE. App Version 2.2

BLOODPRESSURE & PULSE App for iphone, ipad and ipod USER GUIDE. App Version 2.2 App for iphone, ipad and ipod USER GUIDE App Version 2.2 Table of contents Description 3-4 Views 5 Enter your measurements 6 Summary of your values 7 Stages of Hypertension 8 Statistics 9-10 Diary Logs

More information

Background Information. Instructions. Problem Statement. HOMEWORK INSTRUCTIONS Homework #2 HIV Statistics Problem

Background Information. Instructions. Problem Statement. HOMEWORK INSTRUCTIONS Homework #2 HIV Statistics Problem Background Information HOMEWORK INSTRUCTIONS The scourge of HIV/AIDS has had an extraordinary impact on the entire world. The spread of the disease has been closely tracked since the discovery of the HIV

More information

PBSI-EHR Off the Charts!

PBSI-EHR Off the Charts! PBSI-EHR Off the Charts! Enhancement Release 3.2.1 TABLE OF CONTENTS Description of enhancement change Page Encounter 2 Patient Chart 3 Meds/Allergies/Problems 4 Faxing 4 ICD 10 Posting Overview 5 Master

More information

Q: How do I get the protein concentration in mg/ml from the standard curve if the X-axis is in units of µg.

Q: How do I get the protein concentration in mg/ml from the standard curve if the X-axis is in units of µg. Photometry Frequently Asked Questions Q: How do I get the protein concentration in mg/ml from the standard curve if the X-axis is in units of µg. Protein standard curves are traditionally presented as

More information

Lionbridge Connector for Hybris. User Guide

Lionbridge Connector for Hybris. User Guide Lionbridge Connector for Hybris User Guide Version 2.1.0 November 24, 2017 Copyright Copyright 2017 Lionbridge Technologies, Inc. All rights reserved. Published in the USA. March, 2016. Lionbridge and

More information

Department of Surgery

Department of Surgery Department of Surgery Robotic Surgery Curriculum Updated 4/28/2014 OVERVIEW With the growth of robotic surgery, and anticipated continued growth within the area of general surgery, it is becoming increasingly

More information

Technology Design 1. Masters of Arts in Learning and Technology. Technology Design Portfolio. Assessment Code: TDT1 Task 3. Mentor: Dr.

Technology Design 1. Masters of Arts in Learning and Technology. Technology Design Portfolio. Assessment Code: TDT1 Task 3. Mentor: Dr. Technology Design 1 Masters of Arts in Learning and Technology Technology Design Portfolio Assessment Code: TDT1 Task 3 Mentor: Dr. Teresa Dove Mary Mulford Student ID: 000163172 July 11, 2014 A Written

More information

Unit 1: Introduction to the Operating System, Computer Systems, and Networks 1.1 Define terminology Prepare a list of terms with definitions

Unit 1: Introduction to the Operating System, Computer Systems, and Networks 1.1 Define terminology Prepare a list of terms with definitions AR Computer Applications I Correlated to Benchmark Microsoft Office 2010 (492490) Unit 1: Introduction to the Operating System, Computer Systems, and Networks 1.1 Define terminology 1.1.1 Prepare a list

More information

Further Mathematics. Written Examination 2 October/November

Further Mathematics. Written Examination 2 October/November Further Mathematics Written Examination 2 October/November Introduction Further Mathematics Examination 2 is designed to assess students ability to understand and communicate mathematical ideas, and to

More information

CALYPSO 2017 Software Download Portal. https://sdp.metrology.zeiss.com/#/home

CALYPSO 2017 Software Download Portal. https://sdp.metrology.zeiss.com/#/home CALYPSO 2017 Software Download Portal https://sdp.metrology.zeiss.com/#/home 1 CALYPSO 2017 - Highlights standardized: PiWeb reporting modern: new technologies linked: colin3d & CALYPSO easy: improved

More information

WIC and WIC BFPC Local Agency Application FY 20XX-20XX

WIC and WIC BFPC Local Agency Application FY 20XX-20XX WIC and WIC BFPC Local Agency Application FY 20XX-20XX Please submit all documents electronically to the ITCA WIC Director at mindy.jossefides@itcaonline.com. Required: All documents marked with an asterisk

More information

TRI + Digital Solutions 3SHAPE MANUAL

TRI + Digital Solutions 3SHAPE MANUAL TRI + Digital Solutions 3SHAPE MANUAL V1.3_2018-02-12 NOTE TRI + represents the interface between the TRI dental implant system and the 3Shape CADCAM system. The following instructions are intended only

More information

Quotations invited for Interior Designing and Set up of Corporate Office of AMH SSC

Quotations invited for Interior Designing and Set up of Corporate Office of AMH SSC Quotations invited for Interior Designing and Set up of Corporate Office of AMH SSC Greetings from the Apparel Made-ups & Home Furnishing Sector Skill Council. Introduction of AMH SSC This is to introduce

More information

ACCESSIBILITY DETAILS FOR SIGNS

ACCESSIBILITY DETAILS FOR SIGNS INFORMATION BULLETIN / PUBLIC - BUILDING CODE REFERENCE NO.: LABC Sec.11B-703 Effective: 01/01/2017 DOCUMENT NO.: P/BC 2017-091 Revised: 03/01/2017 Previously Issued As: P/BC 2014-091 ACCESSIBILITY DETAILS

More information

Contour Diabetes app User Guide

Contour Diabetes app User Guide Contour Diabetes app User Guide Contents iii Contents Chapter 1: Introduction...5 About the CONTOUR DIABETES app...6 System and Device Requirements...6 Intended Use...6 Chapter 2: Getting Started...7

More information

EyeRIS Manual. Table of contents 1. Quickstart Positioning Calibration Start Alignment...

EyeRIS Manual. Table of contents 1. Quickstart Positioning Calibration Start Alignment... Benutzerhandbuch EyeRIS Manual Table of contents 1. Quickstart... 3 2. Positioning... 4 3. Calibration... 7 3.1. Start... 7 3.2. Alignment... 7 3.3. Nine-Point-Calibration... 8 4. EyeRIS Options... 9 4.1.

More information

Quality Assurance of Ultrasound Imaging in Radiation Therapy. Zuofeng Li, D.Sc. Murty S. Goddu, Ph.D. Washington University St.

Quality Assurance of Ultrasound Imaging in Radiation Therapy. Zuofeng Li, D.Sc. Murty S. Goddu, Ph.D. Washington University St. Quality Assurance of Ultrasound Imaging in Radiation Therapy Zuofeng Li, D.Sc. Murty S. Goddu, Ph.D. Washington University St. Louis, Missouri Typical Applications of Ultrasound Imaging in Radiation Therapy

More information

Matrix Series BGA Sockets

Matrix Series BGA Sockets Matrix Series BGA Sockets Featuring HXC Material System DESCRIPTION Tyco Electronics is pleased to announce the Matrix Series of BGA Sockets utilizing HXC 125 polymer. The sockets are fully arrayed matrixes

More information

SIGN SHOP WINTER 2016

SIGN SHOP WINTER 2016 Sign Catalog IU Bloomington Sign Shop Service Building 1800 N. Range Road Bloomington, IN 47408 812-856-0761 e-mail: paynejl@indiana.edu IU Sign Shop offers: Custom Projects Signs (non-template) Posters

More information

Elluminate and Accessibility: Receive, Respond, and Contribute

Elluminate and Accessibility: Receive, Respond, and Contribute Elluminate and Accessibility: Receive, Respond, and Contribute More than 43 million Americans have one or more physical or mental disabilities. What s more, as an increasing number of aging baby boomers

More information

COURSE LISTING. Courses Listed. Training for Database & Technology with Development in SAP Hybris Commerce. 29 November 2017 (11:16 GMT) Beginner

COURSE LISTING. Courses Listed. Training for Database & Technology with Development in SAP Hybris Commerce. 29 November 2017 (11:16 GMT) Beginner Training for Database & Technology with Development in SAP Hybris Commerce Courses Listed Beginner HY100 - SAP Hybris Commerce Product Overview HY100E - SAP Hybris Commerce Essentials Online Advanced HY410

More information

MD 4300: Introduction to Medical Dosimetry (3semester hour) Course Syllabus for Fall 2009

MD 4300: Introduction to Medical Dosimetry (3semester hour) Course Syllabus for Fall 2009 MD 4300: Introduction to Medical Dosimetry (3semester hour) Course Syllabus for Fall 2009 Instructors: Office hours: Mahsa Dehghanpour, M.S., CMD Jane Chapman, MEd, CMD Faye Bryan, BA., RTT, CMD Medical

More information

Personal Work and Power Lab

Personal Work and Power Lab Personal and Power Lab Purpose: In this activity, we will experience the concepts of and Power using simple materials. Complete the following activity in your group. Part One: Calculating & Power Supplies:

More information

SUMMARY OF NOVEMBER 2018 REVISIONS - VERSION

SUMMARY OF NOVEMBER 2018 REVISIONS - VERSION SUMMARY OF NOVEMBER 2018 REVISIONS - VERSION 3.2.5.0 Since the release of BRADD Version 3.2.4.3, several operational issues have been addressed. This release of BRADD Version 3.2.5.0 contains the following

More information

CONSET BROCHURE SEPTEMBER 2017 MANUFACTURERS OF ELECTRIC SIT-STAND DESKS

CONSET BROCHURE SEPTEMBER 2017 MANUFACTURERS OF ELECTRIC SIT-STAND DESKS CONSET BROCHURE SEPTEMBER 2017 MANUFACTURERS OF ELECTRIC SIT-STAND DESKS ConSet Brochure 2017 2 Your choice of frame HEIGHT ADJUSTABLE HEALTHY WORKING ConSet has desks of different designs and frames with

More information

Directions for Menu Worksheet ***Updated 9/3/2014 for SY Breakfast *** General Information:

Directions for Menu Worksheet ***Updated 9/3/2014 for SY Breakfast *** General Information: Directions for Menu Worksheet ***Updated 9/3/2014 for SY 2014-15 Breakfast *** Welcome to the FNS Menu Worksheet, a tool designed to assist School Food Authorities (SFAs) in demonstrating that each of

More information

Cleaning Up and Visualizing My Workout Data With JMP Shannon Conners, PhD JMP, SAS Abstract

Cleaning Up and Visualizing My Workout Data With JMP Shannon Conners, PhD JMP, SAS Abstract Cleaning Up and Visualizing My Workout Data With JMP Shannon Conners, PhD JMP, SAS Abstract I began tracking weight training workouts in notebooks in middle school. However, training notes did not give

More information

Please note: Forms with PXXXX designations can be found at All other forms can be found at

Please note: Forms with PXXXX designations can be found at   All other forms can be found at ADULT SAFETY NET (ASN) PROGRAM 2018 COMPLIANCE SITE VISIT FOLLOW-UP PLAN This document is used to track required follow-up actions at the completion of an ASN compliance site visit. When all follow-up

More information

Supervisor at Dental Technology Lab.

Supervisor at Dental Technology Lab. Course Title Jordan University of Science and Technology Faculty of Applied Medical Sciences Department of Applied Dental Sciences First Semester Course syllabus Course Information Partial Removable Prosthodontics

More information

AudioConsole. User Guide. Doc. No EN/01 Part No EN

AudioConsole. User Guide. Doc. No EN/01 Part No EN AudioConsole Doc. No. 7-50-2180-EN/01 Part No. 7-50-21800-EN Copyright notice [2003], 2018 Inmedico A/S. All rights reserved. Oscilla is aregistered trademark of Inmedico A/S in the U.S.A. and/or other

More information

CNV PCA Search Tutorial

CNV PCA Search Tutorial CNV PCA Search Tutorial Release 8.1 Golden Helix, Inc. March 18, 2014 Contents 1. Data Preparation 2 A. Join Log Ratio Data with Phenotype Information.............................. 2 B. Activate only

More information

The ipad and Mobile Devices: Useful Tools for Individuals with Autism

The ipad and Mobile Devices: Useful Tools for Individuals with Autism The ipad and Mobile Devices: Useful Tools for Individuals with Autism Leslie Mullette, OTR/L, ATP Clinical Coordinator / MonTECH MAR Conference October 25, 2012 Purpose of AT Enhance overall understanding

More information

Induction Lesson and Summer Transition

Induction Lesson and Summer Transition Induction Lesson and Summer Transition Year 11 starting A Level whats the difference? Induction Lesson and Summer Transition Assignment OBJECTIVES By the end of the lesson you MUST BE ABLE TO Know what

More information

SAP Hybris Academy. Public. February March 2017

SAP Hybris Academy. Public. February March 2017 SAP Hybris Academy Public February March 2017 Agenda Introduction SAP Hybris Academy Overview Java Knowledge Needed for SAP Hybris Development HY200 SAP Hybris Commerce Functional Analyst: Course Content

More information

TRI + Digital Solutions DENTAL WINGS MANUAL

TRI + Digital Solutions DENTAL WINGS MANUAL TRI + Digital Solutions DENTAL WINGS MANUAL V1.2_2018-02-12 NOTE TRI + represents the interface between the TRI dental implant system and the Dental Wings digital solutions. The following instructions

More information

Modifying Food Packages

Modifying Food Packages This resource provides step-by-step instructions on how to complete the following types of food prescription modifications in Crossroads: Modifying the Default Food Package Adding Food Prescription Items

More information

COSMOS STANDARD SUPPORT GUIDE. Ref: P1655Fm Version. No: 04 Issue date: April

COSMOS STANDARD SUPPORT GUIDE. Ref: P1655Fm Version. No: 04 Issue date: April COSMOS STANDARD SUPPORT GUIDE Ref: P1655Fm Version. No: 04 Issue date: April 2018 1 CONTENTS Finding your scheme (P3) Types of ingredients (P4) Permitted ingredients (P5) Raw material approval (P6) How

More information

AGENDA for 01/13/14. HOMEWORK: Due end of period AGENDA: Quiz on 2.3 (and other Unit 2 concepts) tomorrow, Tues, OBJECTIVES:

AGENDA for 01/13/14. HOMEWORK: Due end of period AGENDA: Quiz on 2.3 (and other Unit 2 concepts) tomorrow, Tues, OBJECTIVES: AGENDA for 01/13/14 AGENDA: 1. 2.3.3: Complications of Diabetes Researching Complications Human Body Graphic Organizer OBJECTIVES: 1. Explore the impact that Type 1 and Type 2 diabetes can have on human

More information

Regression CHAPTER SIXTEEN NOTE TO INSTRUCTORS OUTLINE OF RESOURCES

Regression CHAPTER SIXTEEN NOTE TO INSTRUCTORS OUTLINE OF RESOURCES CHAPTER SIXTEEN Regression NOTE TO INSTRUCTORS This chapter includes a number of complex concepts that may seem intimidating to students. Encourage students to focus on the big picture through some of

More information

Chapter 1: Managing workbooks

Chapter 1: Managing workbooks Chapter 1: Managing workbooks Module A: Managing worksheets You use the Insert tab on the ribbon to insert new worksheets. True or False? Which of the following are options for moving or copying a worksheet?

More information

Immunization Scheduler Quick Start Guide

Immunization Scheduler Quick Start Guide Immunization Scheduler Quick Start Guide The Scheduler About This Tool This 2017 Catch-Up Immunization Scheduler tool uses a child's birth date and vaccination history to automatically create a personalized

More information

Using the New Nutrition Facts Label Formats in TechWizard Version 5

Using the New Nutrition Facts Label Formats in TechWizard Version 5 Using the New Nutrition Facts Label Formats in TechWizard Version 5 Introduction This document covers how to utilize the new US Nutrition Facts label formats that are part of Version 5. Refer to Installing

More information

Contents New Features 2 JustGiving Integration 2

Contents New Features 2 JustGiving Integration 2 Contents 7.44.0 New Features 2 JustGiving Integration 2 Step One: Basic settings 2 Step Two: Events Mapping 3 Step Three: Import Historical Data 4 Step Four: Finish 5 Edit the JustGiving import 5 JustGiving

More information

DENTRIX ENTERPRISE 8.0.5

DENTRIX ENTERPRISE 8.0.5 DENTRIX ENTERPRISE 8.0. GETTING STARTED WITH THE CURRENT CLINICAL NOTES www.dentrixenterprise.com -800-DSCHEIN Getting Started with the Current Clinical Notes Working with Clinical Notes Keeping accurate

More information

COMP 3020: Human-Computer Interaction I Fall 2017

COMP 3020: Human-Computer Interaction I Fall 2017 COMP 3020: Human-Computer Interaction I Fall 2017 Layout James Young, with acknowledgements to Anthony Tang, Andrea Bunt, Pourang Irani, Julie Kientz, Saul Greenberg, Ehud Sharlin, Jake Wobbrock, Dave

More information

Ace Personal Trainer Manual 4th Edition 4

Ace Personal Trainer Manual 4th Edition 4 Ace Manual 4th Edition 4 Free PDF ebook Download: Ace Manual 4th Edition 4 Download or Read Online ebook ace personal trainer manual 4th edition 4 in PDF Format From The Best User Guide Database Required

More information

Story Telling in Medical Imaging

Story Telling in Medical Imaging ECR'91 European Congress of Radiology Try it yourself, see how easy it is Yes, this is great! salesman radiologist Hasbergsvei 36 P.O. Box 235, NO3603 Kongsberg Norway gaudisite@gmail.com Abstract Story

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

IAF Mandatory Document. Requirements for the Migration to ISO 45001:2018 from OHSAS 18001:2007 (IAF MD 21:2018)

IAF Mandatory Document. Requirements for the Migration to ISO 45001:2018 from OHSAS 18001:2007 (IAF MD 21:2018) IAF Mandatory Document Requirements for the Migration to ISO 45001:2018 from OHSAS 18001:2007 Issue 1 (IAF MD 21:2018) Issue 1 Requirements for the Migration to Page 2 of 12 The (IAF) facilitates trade

More information

Getting Kirkpatrick Evaluation Right Case Examples and Tips from Practitioners

Getting Kirkpatrick Evaluation Right Case Examples and Tips from Practitioners Trademark and Copyright Warning Copyright 2010-2016, Kirkpatrick Partners, LLC. All rights reserved. This presentation remains the exclusive property of Kirkpatrick Partners, LLC. Distribution or duplication

More information

DietMaster Pro Weight Management Certification Exam Part II Client Case Study Assignment. Instructions

DietMaster Pro Weight Management Certification Exam Part II Client Case Study Assignment. Instructions Instructions To complete your certification exam you will need to develop a case study with a client. This portion of your exam will account for 80 points, or 50% of your total grade points of 160 (unless

More information

How to enter and update Immunizations using HF71

How to enter and update Immunizations using HF71 How to enter and update Immunizations using HF71 The following instructions guide users through the changes that effect ordering and completing vaccines. With these new changes, keep in mind the following:

More information

PENNDOT e-notification

PENNDOT e-notification PENNDOT e-notification Bureau of Design Engineering Computing Management Division BRADD No. 027 August 30, 2010 Release of Version 3.1.5.0 PennDOT's Bridge Automated Design and Drafting Software (BRADD)

More information

AGENDA for 01/10/14. HOMEWORK: Due Mon, AGENDA: Quiz on 2.3 (2.3.1 to 2.3.3) on Tues, OBJECTIVES:

AGENDA for 01/10/14. HOMEWORK: Due Mon, AGENDA: Quiz on 2.3 (2.3.1 to 2.3.3) on Tues, OBJECTIVES: AGENDA for 01/10/14 AGENDA: 1. 2.3.3: Complications of Diabetes Researching Complications Human Body Graphic Organizer OBJECTIVES: 1. Explore the impact that Type 1 and Type 2 diabetes can have on human

More information

Technical Bulletin. Technical Information for Quidel Molecular Influenza A+B Assay on the Bio-Rad CFX96 Touch

Technical Bulletin. Technical Information for Quidel Molecular Influenza A+B Assay on the Bio-Rad CFX96 Touch Technical Bulletin Technical Information for Quidel Molecular Influenza A+B Assay on the Bio-Rad CFX96 Touch Quidel Corporation has verified the performance of the Quidel Molecular Influenza A+B Assay

More information

September News for the Research Community

September News for the Research Community September 2016 News for the Research Community Training Opportunities Did You Know? Clinical Research Employee Highlights Partner Resources News for the Research Community Clinical Trials Billing Office

More information

Dentrix Learning Edition

Dentrix Learning Edition Dentrix Learning Edition Study Guide www.dentrix.com 1-800-DENTRIX v Table of Contents...ix How to Use This Study Guide...ix How to Get Help...x Installation...1 Important Installation Information...2

More information

Content. The Origin. What is new in Déjà Vu X3? Transition smoothly from Déjà Vu X2 to. Déjà Vu X3. Help and guidance for my Déjà Vu X3

Content. The Origin. What is new in Déjà Vu X3? Transition smoothly from Déjà Vu X2 to. Déjà Vu X3. Help and guidance for my Déjà Vu X3 Discover Déjà Vu X3 Content The Origin What is new in Déjà Vu X3? Transition smoothly from Déjà Vu X2 to Déjà Vu X3 Help and guidance for my Déjà Vu X3 The Origin Right from our very beginnings, Atril

More information

Patients & Physicians

Patients & Physicians Patients & Physicians The patients and Physicians window presents options for managing your patients information, treatment records and much more. It is also possible to manage the physicians information

More information

The application can be accessed from the pull down menu by selecting ODOT > Drafting Apps > Signs, or by the following key-in command:

The application can be accessed from the pull down menu by selecting ODOT > Drafting Apps > Signs, or by the following key-in command: Application Name: Current version: Required MicroStation Version: Required GEOPAK Version: ODOT_Signs.mvba V14.07.18 MicroStation XM or V8i GEOPAK XM or V8i The ODOT_Signs.mvba application is a MicroStation

More information

NATIONAL CERTIFICATE (VOCATIONAL) LIFE ORIENTATION (Second Paper) NQF LEVEL 2 SUPPLEMENTARY EXAMINATION 2010

NATIONAL CERTIFICATE (VOCATIONAL) LIFE ORIENTATION (Second Paper) NQF LEVEL 2 SUPPLEMENTARY EXAMINATION 2010 NATIONAL CERTIFICATE (VOCATIONAL) LIFE ORIENTATION (Second Paper) NQF LEVEL 2 SUPPLEMENTARY EXAMINATION 2010 (7601012) 16 February (X-Paper) 09:00 11:00 This question paper consists of 10 pages and a 1-page

More information

About REACH: Machine Captioning for Video

About REACH: Machine Captioning for Video About REACH: Machine Captioning for Video REACH is a machine captioning service provided as a part of Kaltura. Starting July 1, 2018, REACH automatically captions and tags all new videos created with Kaltura

More information

COMMUNITY REPORTER FAQ and STARTER KIT

COMMUNITY REPORTER FAQ and STARTER KIT COMMUNITY REPORTER FAQ and STARTER KIT Creative Recovery Network Community Reporter FAQ and Starter Kit Feral Arts August 2013 What is the Creative Recovery Network? Artists, arts workers and cultural

More information

invisalign clinical results

invisalign clinical results invisalign G3 Engineered to deliver even better clinical results Invisalign G3 is the most significant collection of innovations in Align Technology s history. Invisalign G3 builds on the Enhanced Clinical

More information

Self Assessment 8.3 to 8.4.x

Self Assessment 8.3 to 8.4.x Self Assessment 8.3 to 8.4.x User Guide November 30, 2009 Contents What Self Assessments does Managing self assessments Creating self assessments Adding questions to your self assessment Grading and answers

More information

YOGA FOR LIFE COURSE OUTLINE

YOGA FOR LIFE COURSE OUTLINE YOGA FOR LIFE COURSE OUTLINE Teacher: Mrs. Drummond This course has been developed to introduce high school students to the principles of Yoga. Yoga not only focuses on physical postures to improve the

More information

ShadeVision v Color Map

ShadeVision v Color Map Kevin Aamodt Page 1 7/1/2004 ShadeVision v.3.01 Color Map The ShadeVision v.3.01 color map will allow the user to custom select the lookup regions of the Gingival, Middle, and Incisal areas of a tooth.

More information

USER GUIDE: NEW CIR APP. Technician User Guide

USER GUIDE: NEW CIR APP. Technician User Guide USER GUIDE: NEW CIR APP. Technician User Guide 0 Table of Contents 1 A New CIR User Interface Why?... 3 2 How to get started?... 3 3 Navigating the new CIR app. user interface... 6 3.1 Introduction...

More information

IOS & The Sirona Connect System Clinician Procedure

IOS & The Sirona Connect System Clinician Procedure Clinician Procedure Surgeon (Please ensure that these instructions are forwarded to the restorative clinician.) STEP 1: Select a BellaTek Encode Healing Abutment with the appropriate restorative platform

More information

NEW ROTARY CLUBS QUICK START GUIDE. JOIN LEADERS: 808-EN (1215)

NEW ROTARY CLUBS QUICK START GUIDE. JOIN LEADERS:  808-EN (1215) NEW ROTARY CLUBS QUICK START GUIDE JOIN LEADERS: www.rotary.org 808-EN (1215) NINE STEPS TO STARTING A NEW ROTARY CLUB Determine Areas for New Club Develop Your Strategy Create a Marketing Plan Hold Informational

More information

Healthy Living Study Guide. Pearson Education, Inc. (2007). Life Skills Health. Shoreview: Pearson AGS Globe.

Healthy Living Study Guide. Pearson Education, Inc. (2007). Life Skills Health. Shoreview: Pearson AGS Globe. Adult Basic Education Healthy Living Healthy Living 3102 Study Guide Prerequisite: Healthy Living 3101 Credit Value: 1 Resources: Pearson Education, Inc. (2007). Life Skills Health. Shoreview: Pearson

More information

Student Guide to EHR Go

Student Guide to EHR Go Student Guide to EHR Go I. Introduction... 1 II. Quick Facts... 1 III. Creating your Account... 1 IV. Applying Your Subscription... 4 V. Logging in to EHR Go... 7 VI. Library... 8 VII. Receiving Assignments

More information

TRAINER V3. Visualize your training. - Software overview - Copyright Global Sports Solutions

TRAINER V3. Visualize your training. - Software overview - Copyright Global Sports Solutions - Software overview - Visualize your training SportCoaching TRAINER Table of content Welcome - Idea, objectives, users, developers and authors Drill design - Transform new ideas into reality, create your

More information

Download Grid Systems: Principles Of Organizing Type (Design Briefs) Books

Download Grid Systems: Principles Of Organizing Type (Design Briefs) Books Download Grid Systems: Principles Of Organizing Type (Design Briefs) Books Although grid systems are the foundation for almost all typographic design, they are often associated with rigid, formulaic solutions.

More information