Hypertensive Changes Within the Aortic Arch of Infants and Children With Isolated Coarctation

Transcription

1 Hypertensive Changes Within the Aortic Arch of Infants and Children With Isolated Coarctation Michael F. Swartz, PhD, David Morrow, PhD, Nader Atallah-Yunes, MD, Jill M. Cholette, MD, Francisco Gensini, MD, Rae-Ellen Kavey, MD, and George M. Alfieris, MD Pediatric Cardiac Consortium of Upstate New York and University of Rochester Medical Center, Strong Memorial Hospital, Rochester, New York Background. Despite repair, a significant proportion of patients with coarctation of the aorta (CoA) present with late hypertension. Increased gene expression of aortic wall collagen and vascular smooth muscle cell markers occurs in the presence of hypertension. Before repair, a patent ductus arteriosus (PDA) limits hypertension proximal to the coarctation. We hypothesize that preoperative collagen and vascular smooth muscle expression from the aortic arch in children is variable, depending on the presence or absence of a PDA. Methods. We analyzed the expression patterns of collagen and vascular smooth muscle cell markers in 25 children with CoA using a quantitative polymerase chain reaction. Aortic arch tissue proximal to the CoA was normalized to descending aortic tissue distal to the coarctation. Collagen-I, transforming growth factor-b, elastin, and calponin were analyzed. Results. At repair, 19 patients were aged younger than 3 months (14 with a PDA, 5 with a ligamentum arteriosum), and the remaining 6 were older than 1 year. There was no difference in age or weight between infants with or without a PDA. Infants without a PDA had the greatest difference in collagen-i expression compared with infants with a PDA (7.0 ± 1.6-fold vs 0.8 ± 1.1-fold, p [ 0.01). Expression of transforming growth factor-b (4.3 ± 1.4 vs 2.6 ± 2.3, p [ 0.01) and calponin (3.7 ± 0.7 vs 0.6 ± 1.1, p [ 0.05) was lower from infants with vs without a PDA. Conclusions. Our findings provide evidence of preoperative changes in the aortic arch before repair, particularly in the absence of a PDA. (Ann Thorac Surg 2013;96:190 5) Ó 2013 by The Society of Thoracic Surgeons Patients with coarctation of the aorta (CoA) are susceptible to hypertension, coronary artery disease, and congestive heart failure later in life [1, 2]. However, the origin and mechanism(s) behind the development of late hypertension in this group is not well understood. Although delayed repair beyond infancy [3] and residual arch obstruction after surgical repair [4] provide a mechanism for hypertension in some children, this does not fully explain the increased life-long prevalence of hypertension that approaches 50% [5]. Coarctectomy segments have been analyzed in an attempt to elucidate the mechanism(s) behind the development of hypertension [6 9]. These segments have demonstrated an increase in smooth muscle cell and collagen activation, two hallmarks of hypertensive changes in the aorta [8, 9]. The tissue examined in these studies was primarily from the area of obstruction and from children aged older than 6 years at the time of Accepted for publication April 5, Presented at the Poster Session of the Forty-ninth Annual Meeting of The Society of Thoracic Surgeons, Los Angeles, CA, Jan 26 30, Address correspondence to Dr Swartz, Strong Memorial Hospital, Box Surg/Cardiac, 601 Elmwood Ave, Rochester, NY 14642; michael_swartz@urmc.rochester.edu. CoA repair. Therefore, hypertension and hypertensive vascular changes likely predated the operation [6 9]. More recently echocardiographic imaging has assessed arterial stiffness in the ascending aorta before and after surgical correction [10]. However,these data are particularly difficult to quantify and potentially unreliable in the presence of a patent ductus arteriosus (PDA), which will limit the blood pressure in the aortic arch. In an attempt to better understand the genesis of hypertension in patients with CoA, we analyzed messenger RNA transcripts from coarctectomy segments for genes associated with vascular smooth muscle, collagen, and elastin in infants aged younger than 90 days and in children older than 1 year at the time of repair. Specifically, we examined genes associated with the development of hypertension [8, 9] to determine if differences between the aortic arch and descending thoracic aorta would provide evidence of preoperative hypertensive changes. These genes include the vascular smooth muscle cell genes (smooth muscle actin and calponin), collagen-i, elastin, and transforming growth factor-b (TGF-b), a cytokine known to increase collagen deposition. We hypothesized that the presence of a PDA limits hypertensive changes in the aortic arch compared with a ligamentum arteriosum (LA). Ó 2013 by The Society of Thoracic Surgeons /$36.00 Published by Elsevier Inc

2 Ann Thorac Surg SWARTZ ET AL 2013;96:190 5 LATE HYPERTENSION IN CHILDREN WITH CoA 191 Patients and Methods Patient Recruitment After approval from the Institutional Review Board, the parents of all patients requiring CoA repair at Strong Memorial Hospital in Rochester, New York, from 2010 to 2012 were consented for evaluation of the coarctectomy segment. Inclusion criteria were age younger than 18 years, the absence of an intracardiac lesion requiring repair, and the absence of arch hypoplasia. Surgical Approach All patients were approached using a left lateral thoracotomy, as previously described [11]. Preoperative right upper extremity blood pressures were measured in all patients at the time of their transthoracic echocardiogram. Echocardiographic Measurements All patients underwent preoperative transthoracic echocardiograms, which were reviewed by a pediatric echocardiographer (N.A.-Y.). Suprasternal and subcostal views were used to examine the aortic arch and assess for aortic arch hypoplasia, as previously described [11]. The Doppler flow velocity in the ascending aorta and across the coarctation, the left ventricular end diastolic diameter, and left ventricular fractional shortening were measured in all patients. The aortic distensibility and aortic stiffness indices were measured as previously described [10]. Distensibility ¼ ½As AdŠ=½ðAd ðps PdÞŠ Aortic Stiffness Index ¼½lnðP s =Pd d Š=½ðD s D d Þ=D d Š With As indicating area of the ascending aorta during systole; Ad, area of the ascending aorta during diastole; Ps, systolic blood pressure; Pd, diastolic blood pressure; Ds, diameter of the ascending aorta during systole; and Dd, diameter of the ascending aorta during diastole. Tissue Preparation Aortic coarctation repair was performed in all patients using a technique previously described, with aggressive tissue mobilization to ensure complete resection of the coarctation segment with aortic tissue proximal and distal to the area of narrowing. The resected tissue was divided into three segments: (1) the aortic arch proximal to the coarctation, (2) the coarctation, and (3) the descending aorta distal to the coarctation. All proximal and distal aortic specimens were visually inspected to ensure no coarctation or ductal tissue was included within the sample. Although microscopic examination of tissue was not possible, the pale ductal tissue was clearly evident in all coarctation samples and was excluded from the aortic arch and distal aortic segments. Reverse-Transcription Polymerase Chain Reaction RNA was extracted using an RNeasy minikit (Qiagen, Valencia, CA) and transcribed using an Superscript III Table 1. Forward and Reverse Primer Sequences Gene Sequence Base Pairs 18S rrna F: CCCGAAGCGTTTAACTTTGAA 136 R: CCCTCTTAATCATGGCCTCA Collagen-I F: GCTACCCAACTTGCCTTCATG 33 R: GCTGTTCTTGCAGTGGTAGGTG TGF-b F: CCAGCATCTGCAAAGCTCC 94 R: GGTCCTTGCGGAAGTCAATGT Elastin F: GATGGGGGGTATACAGTACTGC 144 R: GTTGACCTGTCATGGCCG a-sma F: CATCAGAAGCAACATCTCTTGC 192 R: ATTCTCCCAGGGTCACACAG Calponin F: ACATTTTTGAGGCCAACGAC 120 R: ACTTCACTCCCACGTTCACC F ¼ forward; R ¼ reverse; rrna ¼ ribosomal RNA; SMA ¼ smooth muscle actin; TGF-b ¼ transforming growth factor-b. first-strand synthesis kit (Invitrogen, Carlsbad, CA). Primers (Table 1) were selected to cross an intron within the DNA sequence of interest. Twenty-five-microliter reactions using SyberGreenER (Invitrogen) were run in duplicate on a 96-well plate (Stratagene, La Jolla, CA). The cycles to threshold values corresponding to messenger RNA levels are based on a log scale and were transformed to Dcycles to threshold values by subtracting the gene of interest from 18s-ribosomal RNA (18s-rRNA). 18s-rRNA expression is present in all cells and accounts for variability in RNA quality and quantity [12]. To evaluate the difference in gene expression from the different tissue regions, the proximal and distal segments were compared with the coarctation to determine folddifferences in gene expression between the regions. Statistical Analyses Variables are reported as mean standard deviation. Patient variables were evaluated for the equality of variances ensuring normal distribution, and were compared using a two-tailed Student t test for statistical differences and corrected using the Bonferroni correction when comparing the three groups. Comparisons made between categoric variables were done using Pearson c 2 analysis and the Fisher exact test. Linear regression was used to compare the relationship between two sets of values and the Pearson coefficient determined. Results Patient Demographics Consent was obtained from the parents of 25 children undergoing isolated coarctation repair. Patients were divided into three groups: (1) 14 infants with a PDA, (2) 5 infants with closed PDA or LA, and (3) 6 children aged older than 1 year with a LA. Table 2 summarizes the patient demographics among the groups. In infants, there was no difference in age or weight between those with and without a PDA. Prostaglandin therapy had been initiated in all infants with a PDA and in 60% of patients with a LA. As expected, children aged older

3 192 SWARTZ ET AL Ann Thorac Surg LATE HYPERTENSION IN CHILDREN WITH CoA 2013;96:190 5 Table 2. Patient Characteristics Variables a PDA (n ¼ 14) LA (n ¼ 5) (PDA vs LA) Children (> 1y) (n ¼ 6) (Children vs PDA) Age at repair d d y <0.001 b Male sex 7 (50) 3 (50) > (50) >0.99 Weight, kg <0.001 b Body surface area, m <0.001 b Premature birth 7 (50) 2 (40) > >0.99 Prostaglandin E 14 (100) 3 (60) 0.05 b Bicuspid aortic valve 4 (29) 3 (60) (50) 0.62 Septal defect Atrial 9 (64) 1 (20) (33) 0.36 Ventricular 5 (36) (17) 0.61 Hypertension Preoperative 0 0 > (67) b On discharge 0 0 > (50) 0.01 b a Continuous data are shown as mean standard deviation and categoric data as number (%). b Denotes statistical significance. LA ¼ ligamentum arteriosum; PDA ¼ patent ductus arteriosus. than 1 year were heavier, hypertensive, and more likely to have taken antihypertensive medications. Echocardiographic Variables The diameters of all portions of the aorta were increased in children aged older than 1 year compared with their normal infant counterparts. However, the left carotid artery/proximal transverse arch ratio remained the same (Table 3). Preoperative diastolic blood pressures in infants and children were significantly greater than in infants with PDA ( and mm Hg vs mm Hg; p ¼ 0.01 and p ¼ 0.002). The Doppler flow Table 3. Echocardiographic Variables Variable a PDA (n ¼ 14) LA (n ¼ 6) (PDA vs LA) Children (> 1y) (n ¼ 6) (Children vs PDA) Bicuspid aortic valve 6 (43) 2 (33) > (66) >0.99 Aorta measurements PTA, cm DTA, cm Left carotid, cm b Isthmus, cm LCA PTA, cm Distensibility/stiffness Ascending aorta, cm Diameter systole b Diameter diastole b Area systole Area diastole Blood pressure, mm Hg Systolic <0.001 b Diastolic b b Distensibility, 10 3 kpa Stiffness index Gradient, mm Hg Aortic valve CoA LVEDD b Fractional shortening, % a Categoric data are shown as number (%) and continuous data as mean standard deviation. b Denotes statistical significance. CoA ¼ coarctation of the aorta; DTA ¼ distal transverse arch; LA ¼ ligamentum arteriosum; LCA ¼ left carotid artery; LVEDD ¼ left ventricular end diastolic diameter; PDA ¼ patent ductus arteriosus; PTA ¼ proximal transverse arch.

4 Ann Thorac Surg SWARTZ ET AL 2013;96:190 5 LATE HYPERTENSION IN CHILDREN WITH CoA 193 Fig 1. Fold-differences in messenger RNA (mrna) expression of collagen-i (COL-I), transforming growth factor-b (TGF-b), elastin, smooth muscle actin (SMA), and calponin (CAL). The error bars show the standard deviation. velocity in the ascending aorta was also significantly higher in children with an LA than in infants with a PDA (p ¼ 0.01). However, distensibility and the aortic stiffness index were similar between groups. Gene Expression When the entire population of patients was evaluated, the gene expressions of collagen-i, TGF-b, elastin, smooth muscle actin (SMA), and calponin were increased between onefold and twofold in the proximal vs distal aorta (Fig 1). However, the fold-increase in expression from the genes involved in the extracellular matrix (Col-1 and TGF-b) were greater than the genes representing smooth muscle cell expression. There were no differences in 18s-rRNA expression between the proximal and distal aorta from infants with a PDA, infants with a LA ( and , respectively; p ¼ 0.4), or children with a LA ( p ¼ 0.4). The greatest difference in gene expression between the proximal and distal aortic segments was observed in collagen-i expression. Infants with a PDA had a fold increase in collagen-i expression from the aortic arch, demonstrating that the difference between proximal and distal aortic collagen-i expression was not significant. However, there was fold increase (p ¼ 0.01) in collagen-i expression in the proximal vs distal aorta from infants with a LA and a fold increase (p ¼ 0.03) in children with an LA (Fig 2A). TGF-b was also significantly increased in the aortic arch from infants with an LA compared with infants with a PDA ( vs , p ¼ 0.01) (Fig 2B). This difference did not reach statistical significance when children aged older than 1 year were compared with infants with a PDA. Although there was increased expression of elastin in the proximal aorta compared with the distal aorta in the entire population (Fig 1), this difference was not significant among groups (children: , LA: , PDA: ). Comparison of the smooth muscle genes calponin and SMA demonstrated an increase in calponin in the LA group compared with the PDA infants ( vs , p ¼ 0.05) (Fig 2C). There were no significant differences in SMA expression among groups (Fig 2D). Collagen/Elastin Ratio To evaluate the distensibility and stiffness of the aortic arch, the collagen-i/elastin ratio was determined. Despite differences in collagen expression, the differences in the collagen-i/elastin ratio among groups were not significant (Fig 3A). To explore the hypothesis that preoperative pressure differences in the aortic arch are responsible for differences in collagen and elastin expression, we compared the collagen-i/elastin ratio with the preoperative ascending aorta Doppler flow velocity measured by echocardiography in all patients and found a direct linear relationship between Doppler flow velocity and the collagen-i/elastin ratio (Fig 3B). Fig 2. Fold differences in (A) collagen I, (B) transforming growth factor-b, (C) calponin, and (D) smooth muscle actin (SMA) expression among infants with a patent ductus arteriosus (PDA), infants with a ligamentum arteriosum (LA), and children with a coarctation. The error bars show the standard deviation. *p < (TGF-b ¼ transforming growth factor-b.)

5 194 SWARTZ ET AL Ann Thorac Surg LATE HYPERTENSION IN CHILDREN WITH CoA 2013;96:190 5 Fig 3. (A) Collagen-I/elastin expression ratio between groups. The error bars show the standard deviation. (B) Linear relationship between the collagen-i/elastin expression ratio and the preoperative Doppler flow velocity (Vel) in the ascending aorta. (LA ¼ ligamentum arteriosum; PDA ¼ patent ductus arteriosus.) Comment In this series, preoperative changes to the aortic arch proximal to the coarctation were demonstrated in infants and children with CoA. Specifically, the aortic arch expression of collagen-i was significantly increased from infants with a LA and children aged older than 1 year. In addition, infants with an LA had significantly increased expression of TGF-b and calponin from within the aortic arch. Lastly, there was a linear relationship between the collagen-i/elastin ratio in the tissue proximal to the coarctation and the preoperative Doppler flow velocity in the ascending aorta in all patients. The genes measured in this study were chosen for their critical role in the development of the extracellular matrix, providing support to the media of the aorta and resulting in the development of hypertension [13, 14]. In a nonhypertensive aorta, an abundance of elastin allows for the aorta to distend and accept the volume ejected from the left ventricle. However, smooth muscle cells are activated under conditions of higher pressure, resulting in collagen deposition within the aorta and reducing its ability to distend [13]. Smooth muscle cell activity can be expressed by many different genes, with SMA and calponin providing an estimate of the overall activity [15]. When smooth muscle cells are activated by increased pressure, stress, or cytokines (such as TGF-b), they begin to produce collagen to maintain the structural support of the arterial wall [15]. Unfortunately, the result is a stiff aorta that contributes to the development of hypertension over time. It is interesting that children aged older than 1 year did not have the largest differences in gene expression compared with infants with a PDA. This may reflect the variability in the obstruction within the aorta of these children. Previous authors have demonstrated an increased amount of collagen and smooth muscle hypertrophy from within the coarctation region compared with aortic segments without disease [9, 10]. However, minimal attention has been given to the aorta proximal and distal to the coarctation. Most of the samples examined have been from children aged older than 6 years at the time of repair, in whom vascular changes were likely already manifested. We chose to focus on expression patterns primarily from infants. It is difficult to discriminate whether changes observed in the aorta after 6 or more years were reflective of changes present at birth or changes that developed over the extended period of time with a coarctation. In our infant patients with a PDA, we demonstrated little or no difference in gene expression between the proximal aortic arch and distal aorta. This suggests that differences seen in infants with an LA after ductal closure are due to the increased pressure gradient resulting in increased smooth muscle accumulation in the extracellular matrix. Our data provide further impetus for early repair in infants with CoA, and specifically, more urgent repair of infants without a patent DA, to minimize ongoing vascular changes. Although the classic paradigm was to wait for somatic growth of the child [1 3], recent surgical and medical advancements have led to improved outcomes and a lower incidence of short-term hypertension when repairs are performed earlier in life [3, 11]. The decrease in early and late postoperative hypertension after neonatal and infant CoA repairs correlates with our data, suggesting that the increase in expression of extracellular matrix genes in the aortic arch tissue develops with time and predisposes to vascular stiffness and subsequent hypertension. Although we were able to show differences in collagen and smooth muscle expression in the aortic arch, whether a gradation of expression exists between the aortic arch and aortic sinuses is unclear. Expression is increased close to the obstruction, but this change may be minimized remote from the obstruction, closer to the left ventricle. Also unknown is whether these changes in the aortic arch vasculature are reversible. Currently, there is no animal model of inherited CoA. However, an animal model in which a CoA was created at age 2 months, repaired at age 12 months, and examined at 2 years demonstrated residual differences in intimal thickness within the aortic arch despite repair, suggesting that the changes may not be reversible [16]. By contrast, Brili and colleagues [17] recently demonstrated that use of a 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor after coarctation repair reduced postoperative vascular injury molecules and improved endothelial function, suggesting reversibility.

6 Ann Thorac Surg SWARTZ ET AL 2013;96:190 5 LATE HYPERTENSION IN CHILDREN WITH CoA 195 This work has several limitations. Unfortunately, we were not able to obtain enough samples for Western blot analysis for collagen and smooth muscle protein. A larger study would allow additional subgroups and comparison of gene expression and tissue properties across age groups (ie, 1 to 2 years, 3 to 4 years, and older than 5 years). Follow-up of patients for development of short-term and long-term hypertension and subsequent correlation between the messenger RNA expression and clinical outcome of hypertension will be important but were not available to date given the limited mean follow-up of 1 year. Late postoperative echocardiographic assessment of patients for arch distensibility and stiffness and correlation of these results with blood pressure, preoperative Doppler flow, and gene analysis results will also be important. In conclusion, this study demonstrates that even in the infant population with coarctation, hypertensive changes occur in the vasculature of the aortic arch, particularly in the absence of a decompressing ductus arteriosus. These changes may explain the development of hypertension in some children despite early and successful CoA repair. Larger studies are needed to confirm these findings. Further work is also necessary to determine if these vascular and endothelial smooth muscle aberrations in the aortic arch are reversible after the gradient is ameliorated. References 1. Cohen M, Fuster V, Steele PM, Driscoll D, McGoon DC. Coarctation of the aorta: long-term follow-up and prediction of outcome after surgical correction. Circulation 1989;80: Clarkson PM, Nicholson MR, Barratt-Boyes BG, Neutze JM, Whitlock RM. Results after repair of coarctation of the aorta beyond infancy: a 10 to 28 year follow-up with particular reference to late systemic hypertension. Am J Cardiol 1983;81: Wright GE, Nowak CA, Goldberg CS, Ohye RG, Bove EL, Rocchini AP. Extended resection and end-to-end anastomosis for aortic coarctation in infants: results of a tailored surgical approach. Ann Thorac Surg 2005;80: McElhinney DB, Yang SG, Hogarty AN, et al. Recurrent arch obstruction after repair of isolated coarctation of the aorta in neonates and young infants: is low weight a risk factor? J Thorac Cardiovasc Surg 2001; 122: Roifman I, Themen J, Ionescu-Ittu R, et al. Coarctation of the aorta and coronary artery disease: fact or fiction. Circulation 2012;126: Schested J, Baandrup U, Mikkelsen E. Different reactivity and structure of the prestenotic and poststenotic aorta in human coarctation. Implications for baroreceptor function. Circulation 1982;65: Ho SY, Anderson RH. Coarctation, tubular hypoplasia, and the ductus arteriosus. Br Heart J 1979;41: Jaeger E, Rust S, Scharffetter K, et al. Localization of cytoplasmic collagen mrna in human aortic coarctation: mrna enhancement in high blood pressure-induced intimal and medial thickening. J Histochem Cytochem 1990;38: Jimenez M, Daret D, Choussat A, Bonnet J. Immunohistological and ultrastructural analysis of the intimal thickening in coarctation of the human aorta. Cardiovasc Res 1999;41: Vogt M, Kuhn A, Baumgartner D, et al. Impaired elastic properties of the ascending aorta in newborns before and early after successful coarctation repair. Proof of a systemic vascular disease of the prestenotic arteries? Circulation 2005;111: Swartz MF, Atallah-Yunes N, Meagher C, et al. Surgical strategy for aortic coarctation repair resulting in physiologic arm and leg blood pressures. Congenit Heart Dis 2011;6: Swartz MF, Fink GW, Sarwar MF, et al. Elevated preoperative serum peptides for collagen I and III synthesis result in post-surgical atrial fibrillation. J Am Col Cardiol 2012;60: Xu C, Lee S, Singh TM, et al. Molecular mechanisms of aortic wall remodeling in response to hypertension. J Vasc Surg 2001;33: Lacolley P, Challande P, Osborne-Pellegrin M, Rognault V. Genetics and pathophysiology of arterial stiffness. Cardiovasc Res 2009;81: Hu J, Ambrus A, Fossum T, et al. Time courses of growth and remodeling of the porcine aortic media during hypertension: a quantitative immunohistochemical examination. J Histochem Cytochem 2008;56: Leskinen M, Reinila A, Tarkka M, Uhari M. Reversibility of hypertensive vascular changes after coarctation repair in dogs. Pediatr Res 1992;31: Brili S, Tousoulis D, Antonopoulos AS, et al. Effects of atorvastatin on endothelial function and the expression of proinflammatory cytokines and adhesion molecules in young subjects with successfully repair coarctation of the aorta. Heart 2012;98:325 9.