Microscopy Service 2019 Confocal Leica STED 3X Assisted $ 121
|
|
|
- Mabel Farmer
- 5 years ago
- Views:
Transcription
1 Microscopy Confocal Leica STED 3X Assisted $ 121 Self Use $ 54 Self Use Off Hours $ 27 Leica SP5 DM $ - Assisted $ 104 Self Use $ 37 Leica SP5 DMI $ - Assisted $ 114 Self Use $ 47 Olympus FV1000 Multiphoton $ - Assisted $ 114 Self Use $ 47 Yokogawa Spinning Disk Confocal $ - Assisted $ 104 Self Use $ 37 Zeiss LSM780 $ - Assisted $ 114 Self Use $ 47 Zeiss LSM880 Airyscan $ - Assisted $ 121 Self Use $ 54 $ - Image Analysis Software $ - 2D-3D Analysis $ - Assisted $ 85 Self Use $ 19 Self Use Off Hours $ 9 4D Image Analysis $ - Assisted $ 85 Self Use $ 19 Self Use Off Hours $ 9 $ - Widefield $ - AxioImager $ - Assisted $ 94 Self Use $ 27 Self Use Off Hours $ 13 AxioImager. Z2M (Motorized) $ - Assisted $ 94 Self Use $ 27 Self Use Off Hours $ 13 Live Cell Olympus $ - Assisted $ 91 Olympus Stereoscope MVX10 $ - Assisted $ 91 Leica DMi8 $ - Assisted $ 94 Zeiss AxioPlan2 $ - Assisted $ 91 $ - Electron Microscope $ - Hitachi 7000 Electron Microscope $ - Assisted $ 103 Self Use $ 67 Self Use Off Hours $ 41 Hitachi 7700 Electron Microscope $ - Assisted $ 103 Self Use $ 67 Self Use Off Hours $ 41 Page 1
2 Ancillary EM Equipment $ - Leica UltraMicrotome UC7 $ - Assisted $ 84 Self Use $ 21 Self Use Off Hours $ 10 Lightsheet $ - LaVision UltraMicroscope II $ - Assisted $ 123 Self Use $ 56 Self Use Off Hours $ 28 ELECTRON MICROSCOPY $ - Tissue Preparation (training) (Electron Microscope) $ 2,266 Staff Assistance $ 67 Perfusion-small animal model (First) $ 103 Perfusion-small animal model subsequent (2-8) $ 52 Perfusion-large animal model (First) $ 361 Perfusion-large animal model (Second) $ 180 Vibratome sectioning, small model $ 46 Vibratome sectioning, large model (based on volume/blocks) $ 1 Embedding -EPON Tissue $ 77 Embedding -EPON Cell Culture $ 129 Embedding -EPON Subcellular Fraction $ 77 Embedding (Myelin) - Tissue $ 155 Embedding- LOWICRYL - Tissue $ 193 Embedding- LOWICRYL - Subcellular Fraction $ 193 Immunogold Labeling $ 773 Sectioning - semi-thick (Toluidine-Blue stained) (per block) $ 52 Sectioning - semi-thick & ultrathin (per block) $ 129 Sectioning - semi-thick and serial ultrathin sections (per block) $ 206 Counterstaining (Uranyl Acetate and Lead Citrate) (per run) $ 103 Immunogold labeling (per antibody) $ 773 Negative staining (e.g., viral suspension) (per sample) $ 103 Subcellular fraction pellets/nanoparticles - embedding, Lowicryl-6 samples (1 run) $ 773 Corelative confocal/em -CLEM (per sample) $ 773 Array tomography(at) - Carbon Coat $ 258 AT sectioning (per sample) $ 258 Training - Tissue Preparation $ - Perfusion- small animal model (Training) $ 103 Perfusion-large animal model (Training) $ 103 Vibratome sectioning, small model (Training) $ 103 Vibratome sectioning, large model (Training) $ 103 Embedding -EPON (Training) $ 129 Embedding- LOWICRYL (Training) $ 129 Sectioning - semi-thick Toluidine Blues stained (Training) $ 155 Sectioning - semi-thick & ultrathin (Training) $ 155 Sectioning - semi-thick and serial ultrathin sections (Training) $ 155 Counterstaining (Uranyl Acetate and Lead Citrate) (Training) $ 103 Lowicryl embedded immunogold labeling (Training) $ 103 Negative staining (e.g., viral suspension) (Training) $ 103 Subcellular fraction pellets/nanoparticles - embedding, Epon (Training) $ 129 Subcellular fraction pellets/nanoparticles - embedding, Lowicryl (Training) $ 129 Cell culture - see EPON embedding - sample (Training) $ 129 Corelative confocal/em -cell culture - sample (Training) $ 155 Array tomography(at) -see Lowicryl embedding (Training) $ 129 AT sectioning (Training) $ 155 Page 2
3 Irradiator 15 min. Appointment ($1/min) $ Page 3
4 Machine Analyzer Flow Cytometry Service Self-op Rate Assisted Rate Aurora $ $ CantoII $ $ LSRIIA $ $ LSRIIB $ $ Attune $ $ i15cantoii $ $ i15fortessa $ $ i11fortessa $ $ Sorter 2019 CSM4L $ $ CSM5L $ $ Syd $ $ IMI3L $ $ IMI5L $ $ Influx $ $ Page 4
5 Mouse Genetics Pronuclear Injection - C57Bl/6 Hybrid or FVB Inbred (Pronuclear Injection) $ 3,068 Pronuclear Injection - C57Bl/6 Inbred or Other Inbred Lines (Pronuclear Injection) $ 3,838 Pronuclear Injection for Preimplantation Embryos: C57Bl/6 Hybrid or FVB Inbred (Pronuclear Injection) $ 2,299 Pronuclear Injection for Mid-Gestation Embryos: C57Bl/6 Hybrid or FVB Inbred (Pronuclear Injection) $ 2,605 Genome Editing (CRISPR) - Hybrid (Genome Editing) $ 3,068 Genome Editing (CRISPR) - Inbred (Genome Editing) $ 3,838 IVF rederivation (IVF rederivation) $ 1,534 IVF Recovery from Cryopreserved Sperm (IVF Recovery) $ 1,534 Cryopreserved embryo recovery (Cryopreserved embryo recovery) $ 1,295 ES cell injection (ES cell injection) $ 1,295 ES Cell Injection - Mid-Gestation Embryos (ES Cell Injection for Mid-Gestation Embryos) $ 1,099 ES Cell Injection - Preimplantation Embryos (ES Cell Injection for Pre-Implantation Embryos) $ 970 ES Cell Karyotyping (ES Cell Karyotyping) $ 198 Sperm cryopreservation - Basic (Basic Sperm Cryo) $ 520 Sperm cryopreservation - Plus (Sperm CryoPlus) $ 905 Embryo rederivation (Embryo Rederivation) $ 1,295 Shipment of Cryopreserved Sperm (Shipment of Cryopreserved Sperm) $ 171 Mouse Embryos (Mouse Embryos) $ 568 ES Cell Derivation from existing lines (ES Cell Derivation ) $ 3,120 ES Cell Subcloning (ES Cell Subcloning) $ 3,068 Germ-Free IVF Rederivation (IVF rederivation) $ 2,271 Germ-Free Embryo Rederivation (Embryo Rederivation) $ 2,271 Embryo rederivations or recovery $ 1,295 ES cell generation from existing lines $ 3,120 ES cell injection $ 1,295 ES Cell Injections for Mid-Gestation Embryos $ 1,099 ES Cell Injections for Pre-Implantation Embryos $ 970 ES cell Karyotyping (per clone) $ 198 ES cell subcloning $ 3,068 Germ-Free Embryo Rederivation $ 2,271 Germ-Free IVF Rederivation $ 2,271 Health Testing $ 125 IVF rederivations or recovery $ 1,534 Mouse Embryos $ 568 Pronuclear injection (hybrid) $ 3,068 Pronuclear injection (inbred) $ 3,838 Pronuclear Injection for Mid-Gestation Embryos: C57Bl/6 Hybrid or FVB Inbred $ 2,605 Pronuclear Injection for Preimplantation Embryos: C57Bl/6 Hybrid or FVB Inbred $ 2,299 Shipment of Cryopreserved Sperm $ 171 Sperm cryopreservation (basic/per male) $ 520 Sperm cryopreservation (plus/per male) $ *In addition to the service fees listed above, the cost of the mice used for each day of a project will be paid by the requesting investigator. All projects that result in the production of mice will also be assessed a health testing fee (health testing is required prior to transfer of animals from the CoRE production room to a requesting investigator s animal housing room). Page 5
6 qpcr Service Allelic discrimination run (qpcr plate read) CNV-Nanostring assays* Digital PCR: Droplet generator and reader* DNA/RNA extraction from FFPE DNA/RNA extraction from tissue DNA/RNA extraction from whole blood RNA extraction from cell using Qiagen Universal Biorobot Elements-Nanostring assays* IncRNA-Nanostring assays* mirna-nanostring assays* mrna-nanostring assays* Nanostring scanner usage PCR assay set up ussing Beckman Biobek robot (384 well) Pinworm/ Helicobacter Assays Plate Purchase -Multiples of 10 Primer design, synthesis, and validation (SYBR) Real-time PCR plate run (384 well) Real-time PCR plate run (96 well) # Reverse Transcription SNP assay development SYBR-green real-time PCR assays (in triplicates) Taqman assay development TaqMan probe acquisition Taqman real-time PCR assays (in triplicates) Unit 2019 Plate $10 12 Sample Min. $31 8 Sample Min. $2.06/Sample $31 $26 $36 Sample $15 12 Sample Min. $26 12 Sample Min. $26 12 Sample Min. $31 12 Sample Min. $26 Sample $12 Plate $32 $26 $77 Assay $77 Plate $32 Plate $42 Sample $12 Per SNP $618 Per Sample/Gene $4 Per Assay $309 Per probe $258 Per sample/gene $5 Page 6
7 Freezer Farm Box in -80 Freezer $ 5 Shelf in -80 Freezer $ 25 One -80 Freezer $ 200 Page 7
Microscopy Service 2019
Confocal (7) Leica STED 3X Microscopy Assisted 120.51 53.56 Self Use Off Hours 26.78 Leica SP5 DM Assisted 104.03 37.08 Leica SP5 DMI Assisted 114.33 47.38 Olympus FV0 Multiphoton Assisted 114.33 47.38
Reproductive Engineering Techniques in Mice
Reproductive Engineering Techniques in Mice Preface In recent years, the number of genetically engineered mice being produced has increased dramatically. Moreover, the rapid progress in the development
Genotype analysis by Southern blots of nine independent recombinated ES cell clones by
Supplemental Figure 1 Selected ES cell clones show a correctly recombined conditional Ngn3 allele Genotype analysis by Southern blots of nine independent recombinated ES cell clones by hybridization with
SUPPORTING MATREALS. Methods and Materials
SUPPORTING MATREALS Methods and Materials Cell Culture MC3T3-E1 (subclone 4) cells were maintained in -MEM with 10% FBS, 1% Pen/Strep at 37ºC in a humidified incubator with 5% CO2. MC3T3 cell differentiation
SUPPLEMENTARY INFORMATION
SUPPLEMENTARY INFORMATION FOR Liver X Receptor α mediates hepatic triglyceride accumulation through upregulation of G0/G1 Switch Gene 2 (G0S2) expression I: SUPPLEMENTARY METHODS II: SUPPLEMENTARY FIGURES
Paternal exposure and effects on microrna and mrna expression in developing embryo. Department of Chemical and Radiation Nur Duale
Paternal exposure and effects on microrna and mrna expression in developing embryo Department of Chemical and Radiation Nur Duale Our research question Can paternal preconceptional exposure to environmental
Index. Index 439. Aequorin, 84, 94 Affinity precipitation, 372, AP-1, 100 Asthma, 170, 305
Index 439 Index A Aequorin, 84, 94 Affinity precipitation, 372, 376 381 AP-1, 100 Asthma, 170, 305 B Bioassay, 185, comparison with ELISA, 318 GM-CSF bioassay, 351 IL-2 bioassay, 185 192, 300 IL-3 IL-6
Targeted qpcr. Debate on PGS Technology: Targeted vs. Whole genome approach. Discolsure Stake shareholder of GENETYX S.R.L
Antonio Capalbo, PhD Laboratory Director GENETYX, reproductive genetics laboratory, Italy PGT responsible GENERA centers for reproductive medicine, Italy Debate on PGS Technology: Targeted vs. Whole genome
(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-
1 Supplemental Figure Legends Figure S1. Mammary tumors of ErbB2 KI mice with 14-3-3σ ablation have elevated ErbB2 transcript levels and cell proliferation (A) PCR primers (arrows) designed to distinguish
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay
Hepatitis B Antiviral Drug Development Multi-Marker Screening Assay Background ImQuest BioSciences has developed and qualified a single-plate method to expedite the screening of antiviral agents against
HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury
J Mol Med 2015 HIF-P4H-2 deficiency protects against skeletal muscle ischemia-reperfusion injury Sara Karsikas; Mikko Myllymäki; Minna Heikkilä; Raija Sormunen; Kari I Kivirikko; Johanna Myllyharju; Raisa
HEK293FT cells were transiently transfected with reporters, N3-ICD construct and
Supplementary Information Luciferase reporter assay HEK293FT cells were transiently transfected with reporters, N3-ICD construct and increased amounts of wild type or kinase inactive EGFR. Transfections
Supplementary Figure 1.
Supplementary Figure 1. Visualization of endoplasmic reticulum-mitochondria interaction by in situ proximity ligation assay. A) Illustration of targeted proteins in mitochondria (M), endoplasmic reticulum
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken
Nature Genetics: doi: /ng Supplementary Figure 1
Supplementary Figure 1 MSI2 interactors are associated with the riboproteome and are functionally relevant. (a) Coomassie blue staining of FLAG-MSI2 immunoprecipitated complexes. (b) GO analysis of MSI2-interacting
Supplementary Information
Supplementary Information Supplementary Figure 1. CD4 + T cell activation and lack of apoptosis after crosslinking with anti-cd3 + anti-cd28 + anti-cd160. (a) Flow cytometry of anti-cd160 (5D.10A11) binding
Supplementary Information. Glycogen shortage during fasting triggers liver-brain-adipose. neurocircuitry to facilitate fat utilization
Supplementary Information Glycogen shortage during fasting triggers liver-brain-adipose neurocircuitry to facilitate fat utilization Supplementary Figure S1. Liver-Brain-Adipose neurocircuitry Starvation
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
Supplementary Figures
Supplementary Figures Supplementary Figure 1 Characterization of stable expression of GlucB and sshbira in the CT26 cell line (a) Live cell imaging of stable CT26 cells expressing green fluorescent protein
Supplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
T H E J O U R N A L O F C E L L B I O L O G Y
Supplemental material Edens and Levy, http://www.jcb.org/cgi/content/full/jcb.201406004/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. Nuclear shrinking does not depend on the cytoskeleton
Supporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS)
Supplementary Figure S1. Venn diagram analysis of mrna microarray data and mirna target analysis. (a) Western blot analysis of T lymphoblasts (CLS) and their exosomes (EXO) in resting (REST) and activated
Nature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
Patient Price List. t: e: w:
Patient Price List t: 0333 015 9774 e: enquires@ivi.uk w: www.ivi.uk fertility treatments Pre Treatment Medical Consultation 250 Nurse Planning 200 Baseline ultrasound scan of uterus and ovaries included
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy
Oncolytic Adenovirus Complexes Coated with Lipids and Calcium Phosphate for Cancer Gene Therapy Jianhua Chen, Pei Gao, Sujing Yuan, Rongxin Li, Aimin Ni, Liang Chu, Li Ding, Ying Sun, Xin-Yuan Liu, Yourong
Supplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
Nature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
ncounter TM Analysis System
ncounter TM Analysis System Molecules That Count TM www.nanostring.com Agenda NanoString Technologies History Introduction to the ncounter Analysis System CodeSet Design and Assay Principals System Performance
Macrophages form functional vascular mimicry channels in vivo. SI Figures and Legend
Macrophages form functional vascular mimicry channels in vivo Authors: *Faith H. Barnett, *Mauricio Rosenfeld, Malcolm Wood, William Kiosses, Yoshihiko Usui, Valentina Marchetti, Edith Aguilar, and Martin
MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved
1 Supplemental Figure Legends Supplemental Figure 1 ELISA scheme to measure plasma total, mature and furin-cleaved PCSK9 concentrations. 4 Plasma mature and furin-cleaved PCSK9s were measured by a sandwich
Supplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate,
Supplemental Tables and Figures The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate, tendon-specific protective mechanism against heterotopic ossification Timothy Mead et al Supplemental
The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
The subcortical maternal complex controls symmetric division of mouse zygotes by
The subcortical maternal complex controls symmetric division of mouse zygotes by regulating F-actin dynamics Xing-Jiang Yu 1,2, Zhaohong Yi 1, Zheng Gao 1,2, Dan-dan Qin 1,2, Yanhua Zhai 1, Xue Chen 1,
Single Cell Quantitative Polymer Chain Reaction (sc-qpcr)
Single Cell Quantitative Polymer Chain Reaction (sc-qpcr) Analyzing gene expression profiles from a bulk population of cells provides an average profile which may obscure important biological differences
WHO Prequalification of Diagnostics Programme PUBLIC REPORT. Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx
WHO Prequalification of Diagnostics Programme PUBLIC REPORT Product: VERSANT HIV-1 RNA 1.0 Assay (kpcr) Number: PQDx 0115-041-00 Abstract The VERSANT HIV-1 RNA 1.0 Assay (kpcr) with product codes 10375763,
Figure S1 Time-dependent down-modulation of HER3 by EZN No Treatment. EZN-3920, 2 μm. Time, h
Figure S1 Time-dependent down-modulation of HER3 by EZN-392 HE ER3 mrna A, %Contr rol 12 No Treatment EZN-392, 2 μm 1 8 6 4 2 2 8 24 Time, h Figure S2. Specific target down-modulation by HER3 (EZN-392)
JCB. Supplemental material. Gu et al.,
Supplemental material Gu et al., http://www.jcb.org/cgi/content/full/jcb.201010075/dc1 T H E J O U R N A L O F C E L L B I O L O G Y Figure S1. S1P directly induces actin assembly. Actin assembly at the
High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart.
High resolution structural evidence suggests the Sarcoplasmic Reticulum forms microdomains with Acidic Stores (lyososomes) in the heart. Daniel Aston, Rebecca A. Capel, Kerrie L. Ford, Helen C. Christian,
MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS)
MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS) The Power of One Adapted from Internet Single Cell Genomic Studies Ultra Low Sample Input Advances and applications of
Nature Protocols: doi: /nprot Supplementary Figure 1. Fluorescent titration of probe CPDSA.
Supplementary Figure 1 Fluorescent titration of probe CPDSA. Fluorescent titration of probe CPDSA (10 um) upon addition of GSH in HEPES (10 mm, ph = 7.4) containing 10% DMSO. Each spectrum was recorded
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein
Protection against doxorubicin-induced myocardial dysfunction in mice by cardiac-specific expression of carboxyl terminus of hsp70-interacting protein Lei Wang 1, Tian-Peng Zhang 1, Yuan Zhang 2, Hai-Lian
Supplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
Supplementary Materials and Methods
Supplementary Materials and Methods Whole Mount X-Gal Staining Whole tissues were collected, rinsed with PBS and fixed with 4% PFA. Tissues were then rinsed in rinse buffer (100 mm Sodium Phosphate ph
Serafino et al. Thymosin α1 activates complement receptor-mediated phagocytosis in human monocyte-derived macrophages. SUPPLEMENTARY FIGURES
Supplementary Fig. S1. Evaluation of the purity and maturation of macrophage cultures tested by flow cytometry. The lymphocytic/monocytic cellular fraction was isolated from buffy coats of healthy donors
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
Supplementary Material
Supplementary Material Summary: The supplementary information includes 1 table (Table S1) and 4 figures (Figure S1 to S4). Supplementary Figure Legends Figure S1 RTL-bearing nude mouse model. (A) Tumor
Avian Influenza A H5N8
TM Primerdesign Ltd Avian Influenza A H5N8 Hemagglutinin (HA) gene & Neuraminidase (NA) gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Avian Influenza
Human Rotavirus A. genesig Advanced Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Advanced Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus
QIAGEN's Growing Immuno-Oncology Testing Portfolio
QIAGEN's Growing Immuno-Oncology Testing Portfolio QIAGEN Your Partner in Translational Medicine Current Biomarkers of Immuno-Oncology Focus: Immuno-Oncology Testing Portfolio Tumor mutation burden (TMB)
Supplemental Information. Otic Mesenchyme Cells Regulate. Spiral Ganglion Axon Fasciculation. through a Pou3f4/EphA4 Signaling Pathway
Neuron, Volume 73 Supplemental Information Otic Mesenchyme Cells Regulate Spiral Ganglion Axon Fasciculation through a Pou3f4/EphA4 Signaling Pathway Thomas M. Coate, Steven Raft, Xiumei Zhao, Aimee K.
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
but it still needs a bit of work
but it still needs a bit of work jc@embryos.net Reprogenetics ART Institute of Washington Life Global Principle investigator of cytoplasmic transfer series (1996-2001) Is there an alternative to MRT? Lessons
Epstein-Barr Virus: Stimulation By 5 '-Iododeoxy uridine or 5 '-Brom odeoxy uridine in Human Lymphoblastoid Cells F ro m a Rhabdom yosarcom a*
A n n a ls o f C l i n i c a l L a b o r a t o r y S c i e n c e, Vol. 3, No. 6 Copyright 1973, Institute for Clinical Science Epstein-Barr Virus: Stimulation By 5 '-Iododeoxy uridine or 5 '-Brom odeoxy
EMMA Cryopreservation Workshop Novel concepts in mouse production and preservation
EMMA Cryopreservation Workshop Novel concepts in mouse production and preservation Consejo Superior de Investigaciones Cientificas Madrid, Espagna May 7-8, 2012 K. C. Kent Lloyd, DVM, PhD University of
CRYOPRESERVATION OF SEMEN FROM TESTICULAR TISSUE
INFERTILITY & IVF MEDICAL ASSOCIATES OF WESTERN NEW YORK CRYOPRESERVATION OF SEMEN FROM TESTICULAR TISSUE BUFFALOIVF.COM When you have scheduled your appointment with Dr Crickard or Dr Sullivan to sign
Supplemental Information. Fluorescence-based visualization of autophagic activity predicts mouse embryo
Supplemental Information Fluorescence-based visualization of autophagic activity predicts mouse embryo viability Satoshi Tsukamoto*, Taichi Hara, Atsushi Yamamoto, Seiji Kito, Naojiro Minami, Toshiro Kubota,
Influenza virus exploits tunneling nanotubes for cell-to-cell spread
Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,
Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1. Generation and validation of mtef4-knockout mice.
Supplementary Figure 1 Generation and validation of mtef4-knockout mice. (a) Alignment of EF4 (E. coli) with mouse, yeast and human EF4. (b) Domain structures of mouse mtef4 compared to those of EF4 (E.
Supplemental Figure 1. Egr1 expression in adult Achilles tendons. (A,B) Achilles tendons were isolated from 2 month-old Egr1 +/- mice and stained for
Supplemental Figure 1. Egr1 expression in adult Achilles tendons. (A,B) Achilles tendons were isolated from 2 month-old Egr1 +/- mice and stained for LacZ activity, which reflects Egr1 expression. (A)
Supplemental Information. T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism
Immunity, Volume 33 Supplemental Information T Cells Enhance Autoimmunity by Restraining Regulatory T Cell Responses via an Interleukin-23-Dependent Mechanism Franziska Petermann, Veit Rothhammer, Malte
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at
Supplementary Figure 1. EC-specific Deletion of Snail1 Does Not Affect EC Apoptosis. (a,b) Cryo-sections of WT (a) and Snail1 LOF (b) embryos at E10.5 were double-stained for TUNEL (red) and PECAM-1 (green).
Human Rotavirus A. genesig Standard Kit. Non structural protein 5 (NSP5) 150 tests. Primerdesign Ltd. For general laboratory and research use only
TM Primerdesign Ltd Human Rotavirus A Non structural protein 5 (NSP5) genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus A Rotavirus is a genus
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.
Supplemental Figure S1. PLAG1 kidneys contain fewer glomeruli (A) Quantitative PCR for Igf2 and PLAG1 in whole kidneys taken from mice at E15.5, E18.5, P4, and P8. Values shown are means from four technical
Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by
Nakano et al. Supplementary information 1. Supplementary Figure 2. Methods 3. References Bone marrow-derived mesenchymal stem cells improve diabetes-induced cognitive impairment by exosome transfer into
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.
Figure S1. Generation of inducible PTEN deficient mice and the BMMCs (A) B6.129 Pten loxp/loxp mice were mated with B6.129-Gt(ROSA)26Sor tm1(cre/ert2)tyj /J mice. To induce deletion of the Pten locus,
Cytogenetics Technologies, Companies & Markets
Cytogenetics Technologies, Companies & Markets By Prof. K. K. Jain MD, FRACS, FFPM Jain PharmaBiotech Basel, Switzerland November 2018 A Jain PharmaBiotech Report A U T H O R ' S B I O G R A P H Y Professor
Supporting Information
Supporting Information Bertolini et al. 10.1073/pnas.0905653106 SI Text Lung Tissue Disaggregation. Solid tissues were finely minced by razorblade, washed in DMEM/F12 (Lonza), and then incubated with Accumax
Avrahami et al., Suppression of p57kip2 allows successful replication of adult human -cells
Avrahami et al., Suppression of p57kip2 allows successful replication of adult human -cells Legends to Supplementary Figures Supplementary Figure 1. A. Suppression of p57 Kip2 in human islets does not
DRB666 Applied Developmental and Reproductive Biology (Spring 2013)
DRB666 Applied Developmental and Reproductive Biology (Spring 2013) Director: 651 Ilalo Street, BSB163-3 e-mail: yyamazak@hawaii.edu Phone: (808) 692-1416 Instructors (e-mail): Steve Ward Yusuke Marikawa
Supplemental information contains 7 movies and 4 supplemental Figures
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplemental information contains 7 movies and 4 supplemental Figures Movies: Movie 1. Single virus tracking of A4-mCherry-WR MV
Phosphate buffered saline (PBS) for washing the cells TE buffer (nuclease-free) ph 7.5 for use with the PrimePCR Reverse Transcription Control Assay
Catalog # Description 172-5080 SingleShot Cell Lysis Kit, 100 x 50 µl reactions 172-5081 SingleShot Cell Lysis Kit, 500 x 50 µl reactions For research purposes only. Introduction The SingleShot Cell Lysis
AmoyDx TM BRAF V600E Mutation Detection Kit
AmoyDx TM BRAF V600E Mutation Detection Kit Detection of V600E mutation in the BRAF oncogene Instructions For Use Instructions Version: B3.1 Date of Revision: April 2012 Store at -20±2 o C 1/5 Background
Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains
Genetic Analysis of Anxiety Related Behaviors by Gene Chip and In situ Hybridization of the Hippocampus and Amygdala of C57BL/6J and AJ Mice Brains INTRODUCTION To study the relationship between an animal's
Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT) and NQO1-null (NQO1-/-) mice.
competes with 20S proteasome for binding with C/EBP leading to its stabilization and Relative mrna levels Supplement Figure S1. Real Time PCR analysis of mrna levels of C/EBPα and PU.1 in wild type (WT)
Solid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery. against melanoma
Supplementary Information for Solid-in-oil peptide nanocarriers for transcutaneous cancer vaccine delivery against melanoma Rie Wakabayashi,,a,b Masato Sakuragi,,a Shuto Kozaka, a Yoshiro Tahara, a Noriho
MicroRNA and Male Infertility: A Potential for Diagnosis
Review Article MicroRNA and Male Infertility: A Potential for Diagnosis * Abstract MicroRNAs (mirnas) are small non-coding single stranded RNA molecules that are physiologically produced in eukaryotic
MEGA Assay. Modernizing quality control in IVF.
MEGA Assay Modernizing quality control in IVF MEGA assures product consistency through: Analysis of pre-implantation embryo development and health by gene expression in addition to morphology Increased
Pair-fed % inkt cells 0.5. EtOH 0.0
MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded
Extracellular Vesicle RNA isolation Kits
Extracellular Vesicle RNA isolation Kits Summary Section 4 Introduction 42 Exo-TotalRNA and TumorExo-TotalRNA isolation kits 43 Extracellular Vesicle RNA extraction kits Ordering information Products can
Figure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
Cryopreservation and rederivation of mouse strains
www.oulu.fi/biocenter/tg-core Cryopreservation and rederivation of mouse strains Raija Soininen Biocenter Oulu University of Oulu Finnish INFRAFRONTIER-EMMA node Insurance against loss Accident/Catastrophe
SUPPLEMENTARY INFORMATION
doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates
Hosoya et al. TRIM28 is essential for erythroblast differentiation in the mouse (supplemental information)
TaqMan assay Gene TRIM28 GATA-1 Applied Biosystems TaqMan assay Mm00495594_m1 Mm01352636_m1 SYBR Green assay Gene Forward primer Reverse primer Reference adult α-globin CCCGGTGCCTTGTCTGCT GTGAAATCGGCAGGGTGG
Temperature-Sensitive Mutants Isolated from Hamster and
JOURNAL OF VIROLOGY, Nov. 1975, p. 1332-1336 Copyright i 1975 American Society for Microbiology Vol. 16, No. 5 Printed in U.S.A. Temperature-Sensitive Mutants Isolated from Hamster and Canine Cell Lines
M.Sc. (Reproductive Biology & Clinical Embryology)
M.Sc. (Reproductive Biology & Clinical Embryology) ACADEMIC SCHEDULE Theory (Didactic) Lectures + Seminars + Journal Clubs Semester I & II (2 hours / day) Practicals (Hands-on + Demo) Semester I & II (first
Human Rotavirus B. Non structural protein 5 (NSP5) 150 tests. Quantification of Human Rotavirus B genomes Advanced kit handbook HB10.01.
PCR Max Ltd TM qpcr test Human Rotavirus B Non structural protein 5 (NSP5) 150 tests For general laboratory and research use only 1 Introduction to Human Rotavirus B Rotavirus is a genus of double-stranded
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.
Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation. (a) Embryonic fibroblasts isolated from wildtype (WT), BRAF -/-, or CRAF -/- mice were irradiated (6 Gy) and DNA damage
Supplementary Materials for
immunology.sciencemag.org/cgi/content/full/2/16/eaan6049/dc1 Supplementary Materials for Enzymatic synthesis of core 2 O-glycans governs the tissue-trafficking potential of memory CD8 + T cells Jossef
Human Rotavirus C. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Non structural protein 5 (NSP5) 150 tests
TM Primerdesign Ltd TM Primerdesign Ltd Human Rotavirus C Non structural protein 5 (NSP5) genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research
Template for Reporting Results of Biomarker Testing of Specimens From Patients With Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma
Template for Reporting Results of Biomarker Testing of Specimens From Patients With Chronic Lymphocytic Leukemia/Small Lymphocytic Lymphoma Version: CLLBiomarkers 1.0.0.2 Protocol Posting Date: June 2017
DNA methylation Dots(+) CxxC EGFP DAP
a 1.2 b 5mC PI Merge n level Relativ ve expressio 1.0 0.8 0.6 0.4 0.2 0 a b c Wildtype Gadd45 Gadd4 45b KO Figure S1. Gadd45b-deficiency does not affect paternal DNA demethylation (a) Relative expression
Avian influenza A virus subtype (H5)
TM Primerdesign Ltd Avian influenza A virus subtype (H5) Haemoglutinin H5 gene genesig Standard Kit 150 tests For general laboratory and research use only 1 Introduction to Avian influenza A virus subtype
ISOLATION OF A SARCOMA VIRUS FROM A SPONTANEOUS CHICKEN TUMOR
ISOLATION OF A SARCOMA VIRUS FROM A SPONTANEOUS CHICKEN TUMOR Shigeyoshi ITOHARA, Kouichi HIRATA, Makoto INOUE, Masanori Veterinary Pathology, Faculty of Agriculture, Yamaguchi University* HATSUOKA, and
Supporting Information
Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween
DRB666 Applied Developmental and Reproductive Biology Spring Semester, 2011
DRB666 Applied Developmental and Reproductive Biology Spring Semester, 2011 Director: 651 Ilalo Street, BSB163-3 e-mail: yyamazak@hawaii.edu Phone: (808) 692-1416 Instructors (e-mail): Steve Ward Yusuke
Identification of Microbes Lecture: 12
Diagnostic Microbiology Identification of Microbes Lecture: 12 Electron Microscopy 106 virus particles per ml required for visualization, 50,000-60,000 magnification normally used. Viruses may be detected