202002, India Author affiliations

Size: px
Start display at page:

Download "202002, India Author affiliations"

Transcription

1 Copy number variation and microdeletions of the Y chromosome linked genes and loci across different categories of Indian infertile males Anju Kumari 1, Sandeep Kumar Yadav 1, M.M. Misro 2, Jamal Ahmad 3, Sher Ali 1* 1 Molecular Genetics Laboratory, National Institute of Immunology, New Delhi , India 2 Department of Reproductive Biomedicine, National Institute of Health and Family Welfare, New Delhi , India. 3 Centre for Diabetes and Endocrinology, JN Medical College and Hospital, Aligarh Muslim University, Aligarh, Uttar Pradesh , India Author affiliations Corresponding author Dr. Sher Ali alisher@nii.ac.in; sheralib5@hotmail.com Molecular Genetics Laboratory National Institute of Immunology New Delhi , India Ph

2

3

4

5

6 sy1235 sy1260 sy1237 sy121 sy1322 sy280 sy1233 sy1682 sy627 sy142 sy1258 sy1161 sy1197 sy1191 sy1035 sy1318 sy254 sy1291 sy1125 sy1054 sy1190 sy1263 sy1206 sy1201 sy1246 Deletion recombination AZFc gr/gr b1/b2 b2/b3 P5-P1 proximal P5-P1 distal

7

8

9

10 LEGENDS TO FIGURES Figure 1. Diagrammatic illustration showing analysis of the MSY region in the patients samples. (a) Represents human Y chromosome. HT indicate the heterochromatin region of Y chromosome; CEN, centromere and PAR, psuedoautosomal regions. (b) Regions on the Y chromosome where STS were analyzed. Sample IDs are given on the left. NFM represent normal fertile males; OS, oligospermic; AZ, Azoospermic and INS, Infertile males with normal spermiogram. Black solid lines relates to the samples indicating the presence of the STS analyzed, whereas the dotted lines represent deletion of the same.

11 Figure 2. STS mapping of AZFa region of the patients. STS mapping of AZFa region was done using samples from infertile males of different categories (oligospermic OS, azoospermic AZ, infertile males with normal spermiogram INS) and normal fertile males (NFM). Presence of the corresponding STSs in the patients is indicated by solid line and absence by dotted lines; patient IDs and their categories are shown on the left. As expected, all the STSs were found to be intact in the fertile male samples used as control. Figure 3. STS mapping of AZFb and AZFc regions. (a) Diagrammatic illustration of human Y chromosome. (b) Representative gels (i-viii) showing STS mapping of AZFb region for some patients. β-actin was used as an internal control. The STSs analyzed are shown on the right side and the patients IDs, in the bottom. NTC and PTC indicate the negative and positive controls, respectively. NFM, OS, AZ and INS indicate normal fertile males, oligospermic, azoospermic and infertile males with normal spermiogram, respectively. (c) AZFc STS mapping results of some of the representative samples from each category of males. Presence of the corresponding STSs (given on the top) in the patients are indicated by solid line and absence by dotted ones. The patient IDs are shown on the left side. Figure 4. Deletion frequency in the AZF regions in the infertile males from different categories. X-axis depicts the deletions in different regions of the Y chromosome, whereas the Y-axis shows % of the patients. Black bars indicate the % of males (belonging to particular category) with deletions and grey bars correspond to % of males without deletions. Panels a, b and c are for the OS, AZ and INS respectively. No deletions were observed in the normal fertile males. Figure 5. Copy number analysis of DYZ1 arrays by qpcr. Representative amplification plot (a) and standard curve (b) used for the copy number calculation of DYZ1 arrays. The bar graphs (c-f) show the distribution of copies in the males of different categories including oligospermic (43), infertile males with normal spermiogram (40), azoospermic (34) and normal fertile males (55) respectively. All the reactions were performed in triplicates and the results shown here are average of these triplicates.

12 Figure 6. Localization of DYZ1 on metaphase chromosomes, interphase nuclei and spermatozoa using FISH. (a) DYZ1 probe was labeled with Texas red, whereas metaphases and interphase nuclei were stained with DAPI. (b) Sperm nuclei are stained with DAPI. The Y bearing sperms are showing red signal of DYZ1, whereas the X bearing sperms lack the DYZ1 signal. (c) Male blood metaphase and (e) sperm samples were processed together with the experimental samples under identical conditions but not hybridized with the DYZ1 probe to exclude the background signal. (d) Female sample hybridized with DYZ1 probe. Patient IDs are shown in green. OS indicates oligospermic; AZ, azoospermic; INS, infertile males with normal spermiogram and NFM, normal fertile males. Figure 7. Copy number estimation of SRY, BPY2 and DAZ genes using real time PCR. (a-d) Summarizes the distribution of copy number of SRY, BPY2 and DAZ in oligospermic (a), Azoospermic (b), infertile males with normal spermiogram (c) and normal fertile males (d), respectively. X-axis depicts the gene of interest analyzed and the copy number assessed using real time PCR while the Y- axis indicates the % of males with corresponding copies for the genes. Grey bars indicate the normal copy number for the particular gene and the white bars indicate the copy number variation observed. A total of 43 OS, 34 AZ and 40 INS patients were analyzed for copy numbers and each reaction was set in triplicates during real time PCR amplification. Figure 8. Chromosomal localization of SRY gene on metaphases, interphase nuclei and spermatozoa using Fluorescence in situ hybridization (FISH). (a) The metaphase and interphase nuclei are stained with DAPI. The SRY gene localized on the Y chromosome is showing red signal and X-centromere, fluorescent green signal. (b) Figure represents mapping of SRY gene on the individual sperm. All the Y bearing sperms are shown in red, whereas those of X-bearing ones are shown in green. (c) Male blood metaphase and (e) sperm samples were processed under identical conditions but not hybridized with the SRY probe to exclude the background signal. (d) Female sample hybridized with SRY probe. The spermatozoa are stained with DAPI. Patient IDs are shown in yellow. AZ indicates azoospermic; OS, oligospermic; INS, infertile males with normal spermiogram and NFM, normal fertile male.

THE Y-CHROMOSOME : Genetics of Male Infertility

THE Y-CHROMOSOME : Genetics of Male Infertility THE Y-CHROMOSOME : Genetics of Male Infertility Greeshma Gopalan***, Sadia Tabassum Khan**, Ketki Sharma** & Aparna Sarkar * *** Tutor at Physiology Department, Rama Medical College, Hapur, Ghaziabad.;**M.Sc

More information

SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A

SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A1-1011. This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix enables you to quantify genes

More information

Genetics Aspects of Male infertility

Genetics Aspects of Male infertility Genetics Aspects of Male infertility A. Ebrahimi, Molecular Genetic SM Kalantar, Prof. Molecular Cytogenetic Research & Clinical Centre for Infertility, Reproductive & Genetic Unit, Yazd Medical Sciences

More information

AZOOSPERMIA Chromosome Y

AZOOSPERMIA Chromosome Y AZOOSPERMIA Chromosome Y M i c r o d e l e t i o n Ref.: PI EDP003024-40 testspi EDP002024 1. INTRODUCTION In 1976, Tiepolo and Zuffardi reported de novo, microscopically detectable deletions of the distal

More information

MRC-Holland MLPA. Description version 10; 06 April 2018

MRC-Holland MLPA. Description version 10; 06 April 2018 Description version ; 6 April 8 mix P36-B Y-Chromosome Microdeletions Lot B-5. As compared to version A (Lot A-), all probes f DPY9L, one probe f RBMYCP and one probe f KDM5D have been removed, and one

More information

Citation for published version (APA): Lutke Holzik, M. F. (2007). Genetic predisposition to testicular cancer s.n.

Citation for published version (APA): Lutke Holzik, M. F. (2007). Genetic predisposition to testicular cancer s.n. University of Groningen Genetic predisposition to testicular cancer Lutke Holzik, Martijn Frederik IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite

More information

Article Genetic association between AZF region polymorphism and Klinefelter syndrome

Article Genetic association between AZF region polymorphism and Klinefelter syndrome RBMOnline - Vol 19. No 4. 2009 547 551 Reproductive BioMedicine Online; www.rbmonline.com/article/3741 on web 21 August 2009 Article Genetic association between AZF region polymorphism and Klinefelter

More information

ASCERTAINING THE GENETIC STATUS OF THE CHROMIUM EXPOSED HUMAN Y CHROMOSOME

ASCERTAINING THE GENETIC STATUS OF THE CHROMIUM EXPOSED HUMAN Y CHROMOSOME ASCERTAINING THE GENETIC STATUS OF THE CHROMIUM EXPOSED HUMAN Y CHROMOSOME 1 Safdar Ali, 2 Sudhir Kumar, 3 Sher Ali 1,2,3 Molecular Genetics Laboratory National Institute of Immunology, Aruna Asaf Ali

More information

I n 1976, the cytogenetic analysis of six azoospermic

I n 1976, the cytogenetic analysis of six azoospermic 814 ORIGINAL ARTICLE Sequence family variant loss from the AZFc interval of the human Y chromosome, but not gene copy loss, is strongly associated with male infertility N Machev, N Saut, G Longepied, P

More information

Y Chromosome Microdeletions and Alterations of Spermatogenesis*

Y Chromosome Microdeletions and Alterations of Spermatogenesis* 0163-769X/01/$03.00/0 Endocrine Reviews 22(2): 226 239 Copyright 2001 by The Endocrine Society Printed in U.S.A. Y Chromosome Microdeletions and Alterations of Spermatogenesis* CARLO FORESTA, ENRICO MORO,

More information

Cytogenetic and Y chromosome microdeletion screening of a random group of infertile males

Cytogenetic and Y chromosome microdeletion screening of a random group of infertile males FERTILITY AND STERILITY VOL. 79, NO. 2, FEBRUARY 2003 Copyright 2003 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Cytogenetic and Y

More information

Elucigene Male Factor Infertility Products Guide to Interpretation

Elucigene Male Factor Infertility Products Guide to Interpretation Elucigene Male Factor Infertility Products Guide to Interpretation Manufactured by: Elucigene Diagnostics Citylabs Nelson Street Manchester M13 9NQ For Sales, Customer Service and Technical Support:- T:

More information

AZF, SRY Microdeletions and Hormonal Disturbances among Azoospermic Iraqi men

AZF, SRY Microdeletions and Hormonal Disturbances among Azoospermic Iraqi men 92 Moyet Al-Faisal et al. IJPS Vol. 6, No.2, May-Aug 2010 Original Article AZF, SRY Microdeletions and Hormonal Disturbances among Azoospermic Iraqi men Abdul Hussein Moyet Al-Faisal 1*, Ali Fadel Alnajar

More information

Reduced copy number of DAZ genes in subfertile and infertile men

Reduced copy number of DAZ genes in subfertile and infertile men MALE FACTOR FERTILITY AND STERILITY VOL. 77, NO. 1, JANUARY 2002 Copyright 2002 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Reduced

More information

Supplementary figures

Supplementary figures Supplementary figures Supplementary Figure 1. B cells stimulated with pokeweed mitogen display normal mitotic figures but not cells infected with B95-8. The figures show cells stimulated with pokeweed

More information

Chapter 3 To investigate the Y chromosome AZFc partial deletion types and its association in spermatogenic impairment and male infertility

Chapter 3 To investigate the Y chromosome AZFc partial deletion types and its association in spermatogenic impairment and male infertility Chapter 3 To investigate the Y chromosome AZFc partial deletion types and its association in spermatogenic impairment and male infertility 3.1 Introduction Classically, infertility is defined as the inability

More information

Startling Mosaicism of the Y-Chromosome and Tandem Duplication of the SRY and DAZ Genes in Patients with Turner Syndrome

Startling Mosaicism of the Y-Chromosome and Tandem Duplication of the SRY and DAZ Genes in Patients with Turner Syndrome Startling Mosaicism of the Y-Chromosome and Tandem Duplication of the SRY and DAZ Genes in Patients with Turner Syndrome Sanjay Premi, Jyoti Srivastava, Ganesan Panneer, Sher Ali* Molecular Genetics Laboratory,

More information

Routine screening for classical azoospermia factor deletions of the Y chromosome in azoospermic patients with Klinefelter syndrome

Routine screening for classical azoospermia factor deletions of the Y chromosome in azoospermic patients with Klinefelter syndrome Asian J Androl 2007; 9 (6): 815 820 DOI: 10.1111/j.1745-7262.2007.00315.x www.asiaandro.com. Original Article. Routine screening for classical azoospermia factor deletions of the Y chromosome in azoospermic

More information

Molecular screening for Yq microdeletion in men with idiopathic oligozoospermia and azoospermia

Molecular screening for Yq microdeletion in men with idiopathic oligozoospermia and azoospermia Molecular screening for Yq microdeletion in men with idiopathic oligozoospermia and azoospermia RIMA DADA, N P GUPTA* and K KUCHERIA Department of Anatomy and *Department of Urology, All India Institute

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Isodicentric Y Chromosomes and Sex Disorders as Byproducts of Homologous Recombination that Maintains Palindromes

Isodicentric Y Chromosomes and Sex Disorders as Byproducts of Homologous Recombination that Maintains Palindromes Isodicentric Y Chromosomes and Sex Disorders as Byproducts of Homologous Recombination that Maintains Palindromes Julian Lange, 1 Helen Skaletsky, 1 Saskia K.M. van Daalen, 2 Stephanie L. Embry, 3 Cindy

More information

WAO9 P-32 August 1, 2008 Bank Characterization Report

WAO9 P-32 August 1, 2008 Bank Characterization Report WAO9 P-32 August 1, 2008 Bank Characterization Report Cell Line description 3 Karyotype.. 4 5 Fluorescent in Situ Hybridization 6 7 Teratoma Assay 8 10 Flow Cytometry.. 11 Post Thaw Recovery 12 2 Cell

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from

More information

S.J.Qureshi 1, A.R.Ross 1, K.Ma 1, H.J.Cooke 1, M.A.M c lntyre 2, A.C.Chandley 1 and T.B.Hargreave Introduction

S.J.Qureshi 1, A.R.Ross 1, K.Ma 1, H.J.Cooke 1, M.A.M c lntyre 2, A.C.Chandley 1 and T.B.Hargreave Introduction Molecular Human Reproduction vol. no. pp. 775779, 1996 Polymerase chain reaction screening for Y chromosome microdeletions: a first step towards the diagnosis of geneticallydetermined spermatogenic failure

More information

The frequency of Yq microdeletion in azoospermic and oligospermic Iranian infertile men

The frequency of Yq microdeletion in azoospermic and oligospermic Iranian infertile men Iran J Reprod Med Vol. 11. No. 6. pp: 453-458, June 2013 Original article The frequency of Yq microdeletion in azoospermic and oligospermic Iranian infertile men Mohammad Ali Zaimy 1, 2 M.Sc., Seyyed Mehdi

More information

Y-chromosome microdeletions and recurrent pregnancy loss

Y-chromosome microdeletions and recurrent pregnancy loss RECURRENT PREGNANCY LOSS Y-chromosome microdeletions and recurrent pregnancy loss Sheri Dewan, M.S., a Elizabeth E. Puscheck, M.D., b Carolyn B. Coulam, M.D., c Alexander J. Wilcox, B.S., d and Rajasingam

More information

Y CHROMOSOME MICRODELETION Detection System v.4.0

Y CHROMOSOME MICRODELETION Detection System v.4.0 Y CHROMOSOME MICRODELETION Detection System v.4.0 India Contact: Life Technologies (India) Pvt. Ltd. 306, Aggarwal City Mall, Opposite M2K Pitampura, Delhi 110034 (INDIA). Ph: +91-11-42208000, 42208111,

More information

A family of human Y chromosomes has dispersed throughout northern Eurasia despite a 1.8-Mb deletion in the azoospermia factor c region

A family of human Y chromosomes has dispersed throughout northern Eurasia despite a 1.8-Mb deletion in the azoospermia factor c region Genomics 83 (2004) 1046 1052 www.elsevier.com/locate/ygeno A family of human Y chromosomes has dispersed throughout northern Eurasia despite a 1.8-Mb deletion in the azoospermia factor c region Sjoerd

More information

Uniform deletion junctions of complete azoospermia factor region c deletion in infertile men in Taiwan

Uniform deletion junctions of complete azoospermia factor region c deletion in infertile men in Taiwan DOI: 10.1111/j.1745-7262.2006.00109.x. Original Article. Uniform deletion junctions of complete azoospermia factor region c deletion in infertile men in Taiwan Chao-Chin Hsu 1, Pao-Lin Kuo 2, Louise Chuang

More information

Annals of RSCB Vol. XV, Issue 2

Annals of RSCB Vol. XV, Issue 2 COMPLEX CYTOGENETIC AND MOLECULAR EVALUATION IN MEN WITH OLIGO/AZOOSPERMIA IN THE WESTERN PART OF ROMANIA Cristina Gug 1, 2, Delia Huţanu 3, L. Tămaş 4, Anda Alexa 4, A. Anghel 4 1 GENETICS DEPARTMENT,

More information

Male infertility in Northeast China: molecular detection of Y chromosome microdeletions in azoospermic patients with Klinefelter s syndrome

Male infertility in Northeast China: molecular detection of Y chromosome microdeletions in azoospermic patients with Klinefelter s syndrome Male infertility in Northeast China: molecular detection of Y chromosome microdeletions in azoospermic patients with Klinefelter s syndrome H.-G. Zhang, Z.-B. Zhang, R.-X. Wang, Y. Yu, X.-W. Yu, E. Fadlalla

More information

Y-chromosome AZFc structural architecture and relationship to male fertility

Y-chromosome AZFc structural architecture and relationship to male fertility Y-chromosome AZFc structural architecture and relationship to male fertility Celia Ravel, M.D., Ph.D., a,b,c Sandra Chantot-Bastaraud, M.D., Ph.D., a,b,d Brahim El Houate, Ph.D., e Hassan Rouba, Ph.D.,

More information

Y chromosome microdeletion in a father and his four infertile sons

Y chromosome microdeletion in a father and his four infertile sons Human Reproduction vol.14 no.11 pp.2689 2694, 1999 OUTSTANDING CONTRIBUTION Y chromosome microdeletion in a father and his four infertile sons Peter L.Chang, Mark V.Sauer 1 and Stephen Brown of the Y chromosome

More information

Analysis of Yq microdeletions in infertile males by PCR and DNA hybridization techniques

Analysis of Yq microdeletions in infertile males by PCR and DNA hybridization techniques Molecular Human Reproduction vol.4 no.12 pp. 1116 1121, 1998 Analysis of Yq microdeletions in infertile males by PCR and DNA hybridization techniques Paola Grimaldi 1, Claudia Scarponi 1, Pellegrino Rossi

More information

Screening for microdeletions of Y chromosome genes in patients undergoing intracytoplasmic sperm injection

Screening for microdeletions of Y chromosome genes in patients undergoing intracytoplasmic sperm injection Human Reproduction vol.14 no.7 pp.1717 1721, 1999 Screening for microdeletions of Y chromosome genes in patients undergoing intracytoplasmic sperm injection C.Krausz 1,3,4, C.Bussani-Mastellone 2, S.Granchi

More information

CYTOGENETICS Dr. Mary Ann Perle

CYTOGENETICS Dr. Mary Ann Perle CYTOGENETICS Dr. Mary Ann Perle I) Mitosis and metaphase chromosomes A) Chromosomes are most fully condensed and clearly distinguishable during mitosis. B) Mitosis (M phase) takes 1 to 2 hrs and is divided

More information

Quadruplex real-time polymerase chain reaction assay for molecular diagnosis of Y-chromosomal microdeletions

Quadruplex real-time polymerase chain reaction assay for molecular diagnosis of Y-chromosomal microdeletions Quadruplex real-time polymerase chain reaction assay for molecular diagnosis of Y-chromosomal microdeletions Qiwei Guo, M.S., a Fenghua Lan, M.D., b Liangpu Xu, B.S., c Yu Jiang, M.S., a Li Xiao, M.S.,

More information

Asian J Androl 2006; 8 (1): DOI: /j x

Asian J Androl 2006; 8 (1): DOI: /j x Asian J Androl 2006; 8 (1): 39 44 DOI: 10.1111/j.1745-7262.2006.00100.x. Original Article. Y-chromosomal microdeletions and partial deletions of the Azoospermia Factor c (AZFc) region in normozoospermic,

More information

Y chromosome microdeletions are not associated with spontaneous recurrent pregnancy loss in a Sinhalese population in Sri Lanka

Y chromosome microdeletions are not associated with spontaneous recurrent pregnancy loss in a Sinhalese population in Sri Lanka Human Reproduction, Vol.25, No.12 pp. 3152 3156, 2010 Advanced Access publication on October 13, 2010 doi:10.1093/humrep/deq271 ORIGINAL ARTICLE Reproductive genetics Y chromosome microdeletions are not

More information

Prevalence and patterns of Y chromosome microdeletion in infertile men with azoospermia and oligzoospermia in Northeast China

Prevalence and patterns of Y chromosome microdeletion in infertile men with azoospermia and oligzoospermia in Northeast China Iran J Reprod Med Vol. 12. No. 6. pp: 383-388, June 2014 Original article Prevalence and patterns of Y chromosome microdeletion in infertile men with azoospermia and oligzoospermia in Northeast China Fadlalla

More information

Genetics of the human Y chromosome and its association with male infertility

Genetics of the human Y chromosome and its association with male infertility Colaco and Modi Reproductive Biology and Endocrinology (2018) 16:14 https://doi.org/10.1186/s12958-018-0330-5 REVIEW Genetics of the human Y chromosome and its association with male infertility Stacy Colaco

More information

GENETIC TESTING: IN WHOM AND WHEN

GENETIC TESTING: IN WHOM AND WHEN GENETIC TESTING: IN WHOM AND WHEN Robert D Oates, M.D. Boston University School of Medicine My background in this field I was the first to link Cystic Fibrosis Mutations with Congenital Absence of the

More information

Molecular cytogenetic analysis of a ring-y infertile male patient

Molecular cytogenetic analysis of a ring-y infertile male patient Characterization of a ring-y infertile male patient 59 A case report Molecular cytogenetic analysis of a ring-y infertile male patient F.M. Carvalho 1*, E.V. Wolfgramm 1*, I. Degasperi 2, B.M. Verbeno

More information

Understanding the Human Karyotype Colleen Jackson Cook, Ph.D.

Understanding the Human Karyotype Colleen Jackson Cook, Ph.D. Understanding the Human Karyotype Colleen Jackson Cook, Ph.D. SUPPLEMENTAL READING Nussbaum, RL, McInnes, RR, and Willard HF (2007) Thompson and Thompson Genetics in Medicine, 7th edition. Saunders: Philadelphia.

More information

Short Report. B Lakhal a, R Braham b, R Berguigua a, N Bouali a, M Zaouali c, M Chaieb b, RA Veitia d,e,f, A Saad a,g and H Elghezal a,g

Short Report. B Lakhal a, R Braham b, R Berguigua a, N Bouali a, M Zaouali c, M Chaieb b, RA Veitia d,e,f, A Saad a,g and H Elghezal a,g Clin Genet 2010: 78: 181 185 Printed in Singapore. All rights reserved Short Report 2010 John Wiley & Sons A/S CLINICAL GENETICS doi: 10.1111/j.1399-0004.2009.01359.x Cytogenetic analyses of premature

More information

Intrachromosomal homologous recombination between inverted amplicons on opposing Y-chromosome arms

Intrachromosomal homologous recombination between inverted amplicons on opposing Y-chromosome arms Intrachromosomal homologous recombination between inverted amplicons on opposing Y-chromosome arms The MIT Faculty has made this article openly available. Please share how this access benefits you. Your

More information

Genetic evaluation of infertile men

Genetic evaluation of infertile men Human Reproduction vol.14 no.1 pp.33 38, 1999 Genetic evaluation of infertile men S.E.Kleiman 1, L.Yogev, R.Gamzu, R.Hauser, A.Botchan, J.B.Lessing, G.Paz and H.Yavetz Institute for the Study of Fertility,

More information

MATERIALS AND METHODS

MATERIALS AND METHODS www.kjurology.org http://dx.doi.org/1.4111/kju.213.54.2.111 Male Infertility Detection of Y Chromosome Microdeletion is Valuable in the Treatment of Patients With Nonobstructive Azoospermia and Oligoasthenoteratozoospermia:

More information

INFERTILITY GENETIC TESTING. Dr. Ahmad Ebrahimi Molecular Medical Genetics,PhD Yass Medical Genetics Lab. Tehran University of Medical Science

INFERTILITY GENETIC TESTING. Dr. Ahmad Ebrahimi Molecular Medical Genetics,PhD Yass Medical Genetics Lab. Tehran University of Medical Science INFERTILITY GENETIC TESTING Dr. Ahmad Ebrahimi Molecular Medical Genetics,PhD Yass Medical Genetics Lab. Tehran University of Medical Science INFERTILITY GENETIC TESTING It is estimated that genetics are

More information

HIMANSHU SHARMA. POSITION APPLIED FOR Postdoctoral Fellow

HIMANSHU SHARMA. POSITION APPLIED FOR Postdoctoral Fellow HIMANSHU SHARMA POSITION APPLIED FOR Postdoctoral Fellow Research Interests: Biochemistry and molecular cell biology Molecular Genetic Quality control and trafficking mechanism of misfolded proteins Therapeutic

More information

at least 5 probes standard 8 probes (13, 15, 16, 18, 21, 22, 15, X, Y) at least 5 probes standard 8 probes (13, 15, 16, 18, 21, 22, X, Y)

at least 5 probes standard 8 probes (13, 15, 16, 18, 21, 22, 15, X, Y) at least 5 probes standard 8 probes (13, 15, 16, 18, 21, 22, X, Y) Management of FISH probe testing Petra Musilová et al. Repromeda, Brno, Czech Rep. Veterinary Research Institute, Brno Genprogress, Brno, Czech Rep. Aneuploidy screening at least 5 probes standard 8 probes

More information

Correlation between chromosomal polymorphisms and male infertility in a Northeast Chinese population

Correlation between chromosomal polymorphisms and male infertility in a Northeast Chinese population Correlation between chromosomal polymorphisms and male infertility in a Northeast Chinese population L.L. Li 1, D. Peng 1, R.X. Wang 1, H.B. Zhu 1, W.J. Wang 2 and R.Z. Liu 1 1 Center for Reproductive

More information

DAPI ASY1 DAPI/ASY1 DAPI RAD51 DAPI/RAD51. Supplementary Figure 1. Additional information on meiosis in R. pubera. a) The

DAPI ASY1 DAPI/ASY1 DAPI RAD51 DAPI/RAD51. Supplementary Figure 1. Additional information on meiosis in R. pubera. a) The a % 10 Number of crossover per bivalent b 0 1 c DAPI/telomere 80 1 60 40 1 2 20 d 0 0 1 2 >=3 DAPI ASY1 DAPI/ASY1 e DAPI RAD51 DAPI/RAD51 Supplementary Figure 1. Additional information on meiosis in R.

More information

Mosaic loss of chromosome Y in peripheral blood is associated with shorter survival and higher risk of cancer

Mosaic loss of chromosome Y in peripheral blood is associated with shorter survival and higher risk of cancer Supplementary Information Mosaic loss of chromosome Y in peripheral blood is associated with shorter survival and higher risk of cancer Lars A. Forsberg, Chiara Rasi, Niklas Malmqvist, Hanna Davies, Saichand

More information

HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer

HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer P A T H O L O G Y HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer For In Vitro Diagnostic Use FDA approved as an aid in the assessment of patients for whom Herceptin TM (trastuzumab) treatment

More information

RECENTLY, CONSIDERABLE attention has focused on

RECENTLY, CONSIDERABLE attention has focused on 0021-972X/01/$03.00/0 Vol. 86, No. 6 The Journal of Clinical Endocrinology & Metabolism Printed in U.S.A. Copyright 2001 by The Endocrine Society Double-Blind Y Chromosome Microdeletion Analysis in Men

More information

Y chromosome microdeletions in azoospermic patients with Klinefelter's syndrome

Y chromosome microdeletions in azoospermic patients with Klinefelter's syndrome Asian J Androl 2006; 8 (1): 81 88 DOI: 10.1111/j.1745-7262.2006.00083.x. Original Article. Y chromosome microdeletions in azoospermic patients with Klinefelter's syndrome Anurag Mitra 1, Rima Dada 2, Rajeev

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

PDF hosted at the Radboud Repository of the Radboud University Nijmegen

PDF hosted at the Radboud Repository of the Radboud University Nijmegen PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/24403

More information

Elucigene Male Factor Infertility Products Instructions for Use

Elucigene Male Factor Infertility Products Instructions for Use Elucigene Male Factor Infertility Products Instructions for Use Product Size Catalogue Code Elucigene Male Factor Infertility 25 tests AZFXYB1 Elucigene MFI-Yplus 10 tests AZFPLBX For In-Vitro Diagnostic

More information

Human Y-chromosome variation and male dysfunction

Human Y-chromosome variation and male dysfunction 63 REVIEW Human Y-chromosome variation and male dysfunction Cláudia Márcia Benedetto de Carvalho 1,2 and Fabrício Rodrigues Santos 2* 1 Departamento de Bioquímica e Imunologia, and 2 Departamento de Biologia

More information

REVIEW The Y chromosome and male fertility and infertility 1

REVIEW The Y chromosome and male fertility and infertility 1 international journal of andrology, 26:70 75 (2003) REVIEW The Y chromosome and male fertility and infertility 1 CSILLA KRAUSZ,* G. FORTI* and KEN MCELREAVEY *Andrology Unit, Department of Clinical Physiopathology,

More information

A. Incorrect! All the cells have the same set of genes. (D)Because different types of cells have different types of transcriptional factors.

A. Incorrect! All the cells have the same set of genes. (D)Because different types of cells have different types of transcriptional factors. Genetics - Problem Drill 21: Cytogenetics and Chromosomal Mutation No. 1 of 10 1. Why do some cells express one set of genes while other cells express a different set of genes during development? (A) Because

More information

What about gr/gr deletions and male infertility? Systematic review and meta-analysis

What about gr/gr deletions and male infertility? Systematic review and meta-analysis Human Reproduction Update, Vol.17, No.2 pp. 197 209, 2011 Advanced Access publication on October 19, 2010 doi:10.1093/humupd/dmq046 What about gr/gr deletions and male infertility? Systematic review and

More information

Yq MICRODELETIONS IN IDIOPATHIC MALE INFERTILITY

Yq MICRODELETIONS IN IDIOPATHIC MALE INFERTILITY Original Research Article Yq MICRODELETIONS IN IDIOPATHIC MALE INFERTILITY Dinesh Kumar. V * 1, Swetasmita Mishra 2, Rima Dada 2. ABSTRACT International Journal of Anatomy and Research, Int J Anat Res

More information

Significance of Chromosome Changes in Hematological Disorders and Solid Tumors

Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Size of Components of Human Genome Size of haploid genome! Estimated genetic constitution! Size of average chromosome

More information

Significance of Chromosome Changes in Hematological Disorders and Solid Tumors

Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Size of Components of Human Genome Size of haploid genome 3.3 X 10 9 DNA basepairs Estimated genetic constitution 30,000

More information

Screening for microdeletions in human Y chromosome - AZF candidate genes and male infertility

Screening for microdeletions in human Y chromosome - AZF candidate genes and male infertility J.Cell.Mol.Med. Vol 7, No 1, 2003 pp. 43-48 Screening for microdeletions in human Y chromosome - AZF candidate genes and male infertility Florina Raicu a, L. Popa a, Pompilia Apostol a, D. Cimponeriu a,

More information

The study of relationship between chromosomal abnormality in lymphocyte cells of infertile men with intra-cytoplasmic sperm injection outcomes

The study of relationship between chromosomal abnormality in lymphocyte cells of infertile men with intra-cytoplasmic sperm injection outcomes The study of relationship between chromosomal abnormality in lymphocyte cells of infertile men with intra-cytoplasmic sperm injection outcomes Fallahi P, Rezaeian Z, *Moghbelinejad S Fertility and infertility

More information

Name Date Class. Interphase. (1) The. grows. DNA is duplicated.

Name Date Class. Interphase. (1) The. grows. DNA is duplicated. Concept Mapping The Cell Cycle Complete the cycle map about the cell cycle. These terms may be used more than once: cell, cytoplasm, metaphase, nuclear membrane, nucleoli, poles. (1) The Interphase grows.

More information

Y chromosome microdeletions in Brazilian fertility clinic patients

Y chromosome microdeletions in Brazilian fertility clinic patients Y chromosome microdeletions in Brazilian fertility clinic patients J.T. Arruda 1, B.M. Bordin 1, P.R. Santos 1, W.E.J.C. Mesquita 1, R.C.P.C. Silva 2, M.C.S. Maia 2, M.S. Approbato 2, R.S. Florêncio 2,

More information

CLL Complete SM Report

CLL Complete SM Report Reported: 02/01/2012 Σ CGI ID No:5 Client:r Client Address: CLINICAL DATA: Lymphoma No CBC results provided. CLL Complete SM Report FINAL DIAGNOSIS: CD19+ B cell lymphoma, ZAP-70 + (44%), with borderline

More information

Influenza virus exploits tunneling nanotubes for cell-to-cell spread

Influenza virus exploits tunneling nanotubes for cell-to-cell spread Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,

More information

Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was

Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was performed on a total of 85 SS patients. Data filtration

More information

Figure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022

Figure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022 96 APPENDIX B. Supporting Information for chapter 4 "changes in genome content generated via segregation of non-allelic homologs" Figure S1. Potential de novo CNV probes and sizes of apparently de novo

More information

Chromosome Abnormalities

Chromosome Abnormalities Chromosome Abnormalities Chromosomal abnormalities vs. molecular mutations Simply a matter of size Chromosomal abnormalities are big errors Two types of abnormalities 1. Constitutional problem present

More information

About 15% of couples are infertile because of several

About 15% of couples are infertile because of several Journal of Andrology, Vol. 24, No. 4, July/August 2003 Copyright American Society of Andrology Y Chromosome Deletions in Azoospermic Men in India KUMARASAMY THANGARAJ, NALINI J. GUPTA, KADUPU PAVANI, ALLA

More information

No association of the A260G and A386G DAZL single nucleotide polymorphisms with male infertility in a Caucasian population

No association of the A260G and A386G DAZL single nucleotide polymorphisms with male infertility in a Caucasian population Human Reproduction Page 1 of 6 Hum. Reprod. Advance Access published November 1, 2004 doi:10.1093/humrep/deh522 No association of the A260G and A386G DAZL single nucleotide polymorphisms with male infertility

More information

UNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA

UNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA UNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA SITI SHUHADA MOKHTAR Thesis submitted in fulfillment of the requirements for the degree of Master of Science

More information

A Journey on Y Chromosomal Genes and Male Infertility

A Journey on Y Chromosomal Genes and Male Infertility Kamla-Raj 0 Int J Hum Genet, (4): 03-5 (0) A Journey on Y Chromosomal Genes and Male Infertility V.S. Vineeth and Suttur S. Malini Human Genetics Laboratory, Department of Studies in Zoology, University

More information

Molecular Biology Research Communications 2016; 5(4):

Molecular Biology Research Communications 2016; 5(4): Molecular Biology Research Communications 2016; 5(4):247-255 Original Article Open Access Partial and complete microdeletions of Y chromosome in infertile males from South of Iran Raheleh Masoudi *, Liusa

More information

Table S1. STSs Used in Detecting and Characterizing Deletions Involving AZFc. GenBank Accession a STSs used to detect deletions in first-stage screen:

Table S1. STSs Used in Detecting and Characterizing Deletions Involving AZFc. GenBank Accession a STSs used to detect deletions in first-stage screen: Table S1. STSs Used in Detecting and Characterizing Deletions Involving AZFc STS Identifier GenBank Accession a STSs used to detect deletions in first-stage screen: sy1191 b G73809 sy1291 G72340 STSs used

More information

The questions below refer to the following terms. Each term may be used once, more than once, or not at all.

The questions below refer to the following terms. Each term may be used once, more than once, or not at all. The questions below refer to the following terms. Each term may be used once, more than once, or not at all. a) telophase b) anaphase c) prometaphase d) metaphase e) prophase 1) DNA begins to coil and

More information

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.

Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12. Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.

More information

Loss of the AZFc region due to a human Y-chromosome microdeletion in infertile male patients

Loss of the AZFc region due to a human Y-chromosome microdeletion in infertile male patients Loss of the AZFc region due to a human Y-chromosome microdeletion in infertile male patients L.K. Pandey 2, S. Pandey 2, J. Gupta 1 and A.K. Saxena 1 1 Human Cytogenetic and Molecular Genetic Laboratory,

More information

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)

BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,

More information

Deletion of azoospermia factor a (AZFa) regionof human Y chromosome caused by recombination between HERV15 proviruses

Deletion of azoospermia factor a (AZFa) regionof human Y chromosome caused by recombination between HERV15 proviruses 2000 Oxford University Press Human Molecular Genetics, 2000, Vol. 9, No. 15 2291 2296 Deletion of azoospermia factor a (AZFa) regionof human Y chromosome caused by recombination between HERV15 proviruses

More information

Original Article Study of chromosome detection and influencing factors in infertile patients with varicocele

Original Article Study of chromosome detection and influencing factors in infertile patients with varicocele Int J Clin Exp Med 2018;11(7):7088-7095 www.ijcem.com /ISSN:1940-5901/IJCEM0074955 Original Article Study of chromosome detection and influencing factors in infertile patients with varicocele Bing Wang

More information

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a

Supplementary Figure 1. BMS enhances human T cell activation in vitro in a Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated

More information

Cytogenetic and Y Chromosome Microdeletions Screening in Tunisian Infertile Men

Cytogenetic and Y Chromosome Microdeletions Screening in Tunisian Infertile Men Donnish Journal of Genetics and Molecular Biology Vol 1(1) pp. 001-005 October, 2015. http:///djgmb Copyright 2015 Donnish Journals Original Research Article Cytogenetic and Y Chromosome Microdeletions

More information

Meiosis. Formation of gamete = egg & sperm. Occurs only in ovaries and tees. Makes cells with haploid chromosome number

Meiosis. Formation of gamete = egg & sperm. Occurs only in ovaries and tees. Makes cells with haploid chromosome number Meiosis Formation of gamete = egg & sperm Occurs only in ovaries and tees Makes cells with haploid chromosome number Meiosis Diploid= Full set of chromosomes 46 chromosomes in humans Found in most body

More information

Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor

Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor Figures Part of introduction Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor supressor gene deletion in the induction of thyroid carcinoma. ( by James A Fagin, M.D.)

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

Supplemental Information. Figures. Figure S1

Supplemental Information. Figures. Figure S1 Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the

More information

Fluorescent in situ hybridization studies in multiple myeloma

Fluorescent in situ hybridization studies in multiple myeloma Fluorescent in situ hybridization studies in multiple myeloma Ozge Ozalp Yuregir 1, Feride Iffet Sahin 1, Zerrin Yilmaz 1, Ebru Kizilkilic 2, Sema Karakus 2 and Hakan Ozdogu 2 1 Department of Medical Genetics

More information

HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer

HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer P A T H O L O G Y HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer FROM CERTAINTY COMES TRUST For in vitro diagnostic use HER2 CISH pharmdx Kit HER2 CISH pharmdx Kit is intended for dual-color

More information

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these

More information

Index 333. GRTH, see Gonadotropinregulated

Index 333. GRTH, see Gonadotropinregulated Index 329 Index A ADAM2, see Fertilin ADAM3, see Cyritestin ADAM24, see Testase Androgen receptor, CAG repeat, 254, 255,275,321,322 gene polymorphisms, 275, 276 genetic screening, 322 Andrology, genomics

More information

Chromosome Study Lab 26 Answers

Chromosome Study Lab 26 Answers Study Lab 26 Free PDF ebook Download: Study Lab 26 Download or Read Online ebook chromosome study lab 26 answers in PDF Format From The Best User Guide Database Honors Biology Karyotype Lab. A Study. In

More information