202002, India Author affiliations
|
|
- Suzan Wilcox
- 5 years ago
- Views:
Transcription
1 Copy number variation and microdeletions of the Y chromosome linked genes and loci across different categories of Indian infertile males Anju Kumari 1, Sandeep Kumar Yadav 1, M.M. Misro 2, Jamal Ahmad 3, Sher Ali 1* 1 Molecular Genetics Laboratory, National Institute of Immunology, New Delhi , India 2 Department of Reproductive Biomedicine, National Institute of Health and Family Welfare, New Delhi , India. 3 Centre for Diabetes and Endocrinology, JN Medical College and Hospital, Aligarh Muslim University, Aligarh, Uttar Pradesh , India Author affiliations Corresponding author Dr. Sher Ali alisher@nii.ac.in; sheralib5@hotmail.com Molecular Genetics Laboratory National Institute of Immunology New Delhi , India Ph
2
3
4
5
6 sy1235 sy1260 sy1237 sy121 sy1322 sy280 sy1233 sy1682 sy627 sy142 sy1258 sy1161 sy1197 sy1191 sy1035 sy1318 sy254 sy1291 sy1125 sy1054 sy1190 sy1263 sy1206 sy1201 sy1246 Deletion recombination AZFc gr/gr b1/b2 b2/b3 P5-P1 proximal P5-P1 distal
7
8
9
10 LEGENDS TO FIGURES Figure 1. Diagrammatic illustration showing analysis of the MSY region in the patients samples. (a) Represents human Y chromosome. HT indicate the heterochromatin region of Y chromosome; CEN, centromere and PAR, psuedoautosomal regions. (b) Regions on the Y chromosome where STS were analyzed. Sample IDs are given on the left. NFM represent normal fertile males; OS, oligospermic; AZ, Azoospermic and INS, Infertile males with normal spermiogram. Black solid lines relates to the samples indicating the presence of the STS analyzed, whereas the dotted lines represent deletion of the same.
11 Figure 2. STS mapping of AZFa region of the patients. STS mapping of AZFa region was done using samples from infertile males of different categories (oligospermic OS, azoospermic AZ, infertile males with normal spermiogram INS) and normal fertile males (NFM). Presence of the corresponding STSs in the patients is indicated by solid line and absence by dotted lines; patient IDs and their categories are shown on the left. As expected, all the STSs were found to be intact in the fertile male samples used as control. Figure 3. STS mapping of AZFb and AZFc regions. (a) Diagrammatic illustration of human Y chromosome. (b) Representative gels (i-viii) showing STS mapping of AZFb region for some patients. β-actin was used as an internal control. The STSs analyzed are shown on the right side and the patients IDs, in the bottom. NTC and PTC indicate the negative and positive controls, respectively. NFM, OS, AZ and INS indicate normal fertile males, oligospermic, azoospermic and infertile males with normal spermiogram, respectively. (c) AZFc STS mapping results of some of the representative samples from each category of males. Presence of the corresponding STSs (given on the top) in the patients are indicated by solid line and absence by dotted ones. The patient IDs are shown on the left side. Figure 4. Deletion frequency in the AZF regions in the infertile males from different categories. X-axis depicts the deletions in different regions of the Y chromosome, whereas the Y-axis shows % of the patients. Black bars indicate the % of males (belonging to particular category) with deletions and grey bars correspond to % of males without deletions. Panels a, b and c are for the OS, AZ and INS respectively. No deletions were observed in the normal fertile males. Figure 5. Copy number analysis of DYZ1 arrays by qpcr. Representative amplification plot (a) and standard curve (b) used for the copy number calculation of DYZ1 arrays. The bar graphs (c-f) show the distribution of copies in the males of different categories including oligospermic (43), infertile males with normal spermiogram (40), azoospermic (34) and normal fertile males (55) respectively. All the reactions were performed in triplicates and the results shown here are average of these triplicates.
12 Figure 6. Localization of DYZ1 on metaphase chromosomes, interphase nuclei and spermatozoa using FISH. (a) DYZ1 probe was labeled with Texas red, whereas metaphases and interphase nuclei were stained with DAPI. (b) Sperm nuclei are stained with DAPI. The Y bearing sperms are showing red signal of DYZ1, whereas the X bearing sperms lack the DYZ1 signal. (c) Male blood metaphase and (e) sperm samples were processed together with the experimental samples under identical conditions but not hybridized with the DYZ1 probe to exclude the background signal. (d) Female sample hybridized with DYZ1 probe. Patient IDs are shown in green. OS indicates oligospermic; AZ, azoospermic; INS, infertile males with normal spermiogram and NFM, normal fertile males. Figure 7. Copy number estimation of SRY, BPY2 and DAZ genes using real time PCR. (a-d) Summarizes the distribution of copy number of SRY, BPY2 and DAZ in oligospermic (a), Azoospermic (b), infertile males with normal spermiogram (c) and normal fertile males (d), respectively. X-axis depicts the gene of interest analyzed and the copy number assessed using real time PCR while the Y- axis indicates the % of males with corresponding copies for the genes. Grey bars indicate the normal copy number for the particular gene and the white bars indicate the copy number variation observed. A total of 43 OS, 34 AZ and 40 INS patients were analyzed for copy numbers and each reaction was set in triplicates during real time PCR amplification. Figure 8. Chromosomal localization of SRY gene on metaphases, interphase nuclei and spermatozoa using Fluorescence in situ hybridization (FISH). (a) The metaphase and interphase nuclei are stained with DAPI. The SRY gene localized on the Y chromosome is showing red signal and X-centromere, fluorescent green signal. (b) Figure represents mapping of SRY gene on the individual sperm. All the Y bearing sperms are shown in red, whereas those of X-bearing ones are shown in green. (c) Male blood metaphase and (e) sperm samples were processed under identical conditions but not hybridized with the SRY probe to exclude the background signal. (d) Female sample hybridized with SRY probe. The spermatozoa are stained with DAPI. Patient IDs are shown in yellow. AZ indicates azoospermic; OS, oligospermic; INS, infertile males with normal spermiogram and NFM, normal fertile male.
THE Y-CHROMOSOME : Genetics of Male Infertility
THE Y-CHROMOSOME : Genetics of Male Infertility Greeshma Gopalan***, Sadia Tabassum Khan**, Ketki Sharma** & Aparna Sarkar * *** Tutor at Physiology Department, Rama Medical College, Hapur, Ghaziabad.;**M.Sc
More informationSALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A
SALSA MLPA probemix P360-A1 Y-Chromosome Microdeletions Lot A1-1011. This SALSA MLPA probemix is for basic research and intended for experienced MLPA users only! This probemix enables you to quantify genes
More informationGenetics Aspects of Male infertility
Genetics Aspects of Male infertility A. Ebrahimi, Molecular Genetic SM Kalantar, Prof. Molecular Cytogenetic Research & Clinical Centre for Infertility, Reproductive & Genetic Unit, Yazd Medical Sciences
More informationAZOOSPERMIA Chromosome Y
AZOOSPERMIA Chromosome Y M i c r o d e l e t i o n Ref.: PI EDP003024-40 testspi EDP002024 1. INTRODUCTION In 1976, Tiepolo and Zuffardi reported de novo, microscopically detectable deletions of the distal
More informationMRC-Holland MLPA. Description version 10; 06 April 2018
Description version ; 6 April 8 mix P36-B Y-Chromosome Microdeletions Lot B-5. As compared to version A (Lot A-), all probes f DPY9L, one probe f RBMYCP and one probe f KDM5D have been removed, and one
More informationCitation for published version (APA): Lutke Holzik, M. F. (2007). Genetic predisposition to testicular cancer s.n.
University of Groningen Genetic predisposition to testicular cancer Lutke Holzik, Martijn Frederik IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite
More informationArticle Genetic association between AZF region polymorphism and Klinefelter syndrome
RBMOnline - Vol 19. No 4. 2009 547 551 Reproductive BioMedicine Online; www.rbmonline.com/article/3741 on web 21 August 2009 Article Genetic association between AZF region polymorphism and Klinefelter
More informationASCERTAINING THE GENETIC STATUS OF THE CHROMIUM EXPOSED HUMAN Y CHROMOSOME
ASCERTAINING THE GENETIC STATUS OF THE CHROMIUM EXPOSED HUMAN Y CHROMOSOME 1 Safdar Ali, 2 Sudhir Kumar, 3 Sher Ali 1,2,3 Molecular Genetics Laboratory National Institute of Immunology, Aruna Asaf Ali
More informationI n 1976, the cytogenetic analysis of six azoospermic
814 ORIGINAL ARTICLE Sequence family variant loss from the AZFc interval of the human Y chromosome, but not gene copy loss, is strongly associated with male infertility N Machev, N Saut, G Longepied, P
More informationY Chromosome Microdeletions and Alterations of Spermatogenesis*
0163-769X/01/$03.00/0 Endocrine Reviews 22(2): 226 239 Copyright 2001 by The Endocrine Society Printed in U.S.A. Y Chromosome Microdeletions and Alterations of Spermatogenesis* CARLO FORESTA, ENRICO MORO,
More informationCytogenetic and Y chromosome microdeletion screening of a random group of infertile males
FERTILITY AND STERILITY VOL. 79, NO. 2, FEBRUARY 2003 Copyright 2003 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Cytogenetic and Y
More informationElucigene Male Factor Infertility Products Guide to Interpretation
Elucigene Male Factor Infertility Products Guide to Interpretation Manufactured by: Elucigene Diagnostics Citylabs Nelson Street Manchester M13 9NQ For Sales, Customer Service and Technical Support:- T:
More informationAZF, SRY Microdeletions and Hormonal Disturbances among Azoospermic Iraqi men
92 Moyet Al-Faisal et al. IJPS Vol. 6, No.2, May-Aug 2010 Original Article AZF, SRY Microdeletions and Hormonal Disturbances among Azoospermic Iraqi men Abdul Hussein Moyet Al-Faisal 1*, Ali Fadel Alnajar
More informationReduced copy number of DAZ genes in subfertile and infertile men
MALE FACTOR FERTILITY AND STERILITY VOL. 77, NO. 1, JANUARY 2002 Copyright 2002 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Reduced
More informationSupplementary figures
Supplementary figures Supplementary Figure 1. B cells stimulated with pokeweed mitogen display normal mitotic figures but not cells infected with B95-8. The figures show cells stimulated with pokeweed
More informationChapter 3 To investigate the Y chromosome AZFc partial deletion types and its association in spermatogenic impairment and male infertility
Chapter 3 To investigate the Y chromosome AZFc partial deletion types and its association in spermatogenic impairment and male infertility 3.1 Introduction Classically, infertility is defined as the inability
More informationStartling Mosaicism of the Y-Chromosome and Tandem Duplication of the SRY and DAZ Genes in Patients with Turner Syndrome
Startling Mosaicism of the Y-Chromosome and Tandem Duplication of the SRY and DAZ Genes in Patients with Turner Syndrome Sanjay Premi, Jyoti Srivastava, Ganesan Panneer, Sher Ali* Molecular Genetics Laboratory,
More informationRoutine screening for classical azoospermia factor deletions of the Y chromosome in azoospermic patients with Klinefelter syndrome
Asian J Androl 2007; 9 (6): 815 820 DOI: 10.1111/j.1745-7262.2007.00315.x www.asiaandro.com. Original Article. Routine screening for classical azoospermia factor deletions of the Y chromosome in azoospermic
More informationMolecular screening for Yq microdeletion in men with idiopathic oligozoospermia and azoospermia
Molecular screening for Yq microdeletion in men with idiopathic oligozoospermia and azoospermia RIMA DADA, N P GUPTA* and K KUCHERIA Department of Anatomy and *Department of Urology, All India Institute
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationIsodicentric Y Chromosomes and Sex Disorders as Byproducts of Homologous Recombination that Maintains Palindromes
Isodicentric Y Chromosomes and Sex Disorders as Byproducts of Homologous Recombination that Maintains Palindromes Julian Lange, 1 Helen Skaletsky, 1 Saskia K.M. van Daalen, 2 Stephanie L. Embry, 3 Cindy
More informationWAO9 P-32 August 1, 2008 Bank Characterization Report
WAO9 P-32 August 1, 2008 Bank Characterization Report Cell Line description 3 Karyotype.. 4 5 Fluorescent in Situ Hybridization 6 7 Teratoma Assay 8 10 Flow Cytometry.. 11 Post Thaw Recovery 12 2 Cell
More informationSupplementary Figure 1
Supplementary Figure 1 Supplementary Fig. 1: Quality assessment of formalin-fixed paraffin-embedded (FFPE)-derived DNA and nuclei. (a) Multiplex PCR analysis of unrepaired and repaired bulk FFPE gdna from
More informationS.J.Qureshi 1, A.R.Ross 1, K.Ma 1, H.J.Cooke 1, M.A.M c lntyre 2, A.C.Chandley 1 and T.B.Hargreave Introduction
Molecular Human Reproduction vol. no. pp. 775779, 1996 Polymerase chain reaction screening for Y chromosome microdeletions: a first step towards the diagnosis of geneticallydetermined spermatogenic failure
More informationThe frequency of Yq microdeletion in azoospermic and oligospermic Iranian infertile men
Iran J Reprod Med Vol. 11. No. 6. pp: 453-458, June 2013 Original article The frequency of Yq microdeletion in azoospermic and oligospermic Iranian infertile men Mohammad Ali Zaimy 1, 2 M.Sc., Seyyed Mehdi
More informationY-chromosome microdeletions and recurrent pregnancy loss
RECURRENT PREGNANCY LOSS Y-chromosome microdeletions and recurrent pregnancy loss Sheri Dewan, M.S., a Elizabeth E. Puscheck, M.D., b Carolyn B. Coulam, M.D., c Alexander J. Wilcox, B.S., d and Rajasingam
More informationY CHROMOSOME MICRODELETION Detection System v.4.0
Y CHROMOSOME MICRODELETION Detection System v.4.0 India Contact: Life Technologies (India) Pvt. Ltd. 306, Aggarwal City Mall, Opposite M2K Pitampura, Delhi 110034 (INDIA). Ph: +91-11-42208000, 42208111,
More informationA family of human Y chromosomes has dispersed throughout northern Eurasia despite a 1.8-Mb deletion in the azoospermia factor c region
Genomics 83 (2004) 1046 1052 www.elsevier.com/locate/ygeno A family of human Y chromosomes has dispersed throughout northern Eurasia despite a 1.8-Mb deletion in the azoospermia factor c region Sjoerd
More informationUniform deletion junctions of complete azoospermia factor region c deletion in infertile men in Taiwan
DOI: 10.1111/j.1745-7262.2006.00109.x. Original Article. Uniform deletion junctions of complete azoospermia factor region c deletion in infertile men in Taiwan Chao-Chin Hsu 1, Pao-Lin Kuo 2, Louise Chuang
More informationAnnals of RSCB Vol. XV, Issue 2
COMPLEX CYTOGENETIC AND MOLECULAR EVALUATION IN MEN WITH OLIGO/AZOOSPERMIA IN THE WESTERN PART OF ROMANIA Cristina Gug 1, 2, Delia Huţanu 3, L. Tămaş 4, Anda Alexa 4, A. Anghel 4 1 GENETICS DEPARTMENT,
More informationMale infertility in Northeast China: molecular detection of Y chromosome microdeletions in azoospermic patients with Klinefelter s syndrome
Male infertility in Northeast China: molecular detection of Y chromosome microdeletions in azoospermic patients with Klinefelter s syndrome H.-G. Zhang, Z.-B. Zhang, R.-X. Wang, Y. Yu, X.-W. Yu, E. Fadlalla
More informationY-chromosome AZFc structural architecture and relationship to male fertility
Y-chromosome AZFc structural architecture and relationship to male fertility Celia Ravel, M.D., Ph.D., a,b,c Sandra Chantot-Bastaraud, M.D., Ph.D., a,b,d Brahim El Houate, Ph.D., e Hassan Rouba, Ph.D.,
More informationY chromosome microdeletion in a father and his four infertile sons
Human Reproduction vol.14 no.11 pp.2689 2694, 1999 OUTSTANDING CONTRIBUTION Y chromosome microdeletion in a father and his four infertile sons Peter L.Chang, Mark V.Sauer 1 and Stephen Brown of the Y chromosome
More informationAnalysis of Yq microdeletions in infertile males by PCR and DNA hybridization techniques
Molecular Human Reproduction vol.4 no.12 pp. 1116 1121, 1998 Analysis of Yq microdeletions in infertile males by PCR and DNA hybridization techniques Paola Grimaldi 1, Claudia Scarponi 1, Pellegrino Rossi
More informationScreening for microdeletions of Y chromosome genes in patients undergoing intracytoplasmic sperm injection
Human Reproduction vol.14 no.7 pp.1717 1721, 1999 Screening for microdeletions of Y chromosome genes in patients undergoing intracytoplasmic sperm injection C.Krausz 1,3,4, C.Bussani-Mastellone 2, S.Granchi
More informationCYTOGENETICS Dr. Mary Ann Perle
CYTOGENETICS Dr. Mary Ann Perle I) Mitosis and metaphase chromosomes A) Chromosomes are most fully condensed and clearly distinguishable during mitosis. B) Mitosis (M phase) takes 1 to 2 hrs and is divided
More informationQuadruplex real-time polymerase chain reaction assay for molecular diagnosis of Y-chromosomal microdeletions
Quadruplex real-time polymerase chain reaction assay for molecular diagnosis of Y-chromosomal microdeletions Qiwei Guo, M.S., a Fenghua Lan, M.D., b Liangpu Xu, B.S., c Yu Jiang, M.S., a Li Xiao, M.S.,
More informationAsian J Androl 2006; 8 (1): DOI: /j x
Asian J Androl 2006; 8 (1): 39 44 DOI: 10.1111/j.1745-7262.2006.00100.x. Original Article. Y-chromosomal microdeletions and partial deletions of the Azoospermia Factor c (AZFc) region in normozoospermic,
More informationY chromosome microdeletions are not associated with spontaneous recurrent pregnancy loss in a Sinhalese population in Sri Lanka
Human Reproduction, Vol.25, No.12 pp. 3152 3156, 2010 Advanced Access publication on October 13, 2010 doi:10.1093/humrep/deq271 ORIGINAL ARTICLE Reproductive genetics Y chromosome microdeletions are not
More informationPrevalence and patterns of Y chromosome microdeletion in infertile men with azoospermia and oligzoospermia in Northeast China
Iran J Reprod Med Vol. 12. No. 6. pp: 383-388, June 2014 Original article Prevalence and patterns of Y chromosome microdeletion in infertile men with azoospermia and oligzoospermia in Northeast China Fadlalla
More informationGenetics of the human Y chromosome and its association with male infertility
Colaco and Modi Reproductive Biology and Endocrinology (2018) 16:14 https://doi.org/10.1186/s12958-018-0330-5 REVIEW Genetics of the human Y chromosome and its association with male infertility Stacy Colaco
More informationGENETIC TESTING: IN WHOM AND WHEN
GENETIC TESTING: IN WHOM AND WHEN Robert D Oates, M.D. Boston University School of Medicine My background in this field I was the first to link Cystic Fibrosis Mutations with Congenital Absence of the
More informationMolecular cytogenetic analysis of a ring-y infertile male patient
Characterization of a ring-y infertile male patient 59 A case report Molecular cytogenetic analysis of a ring-y infertile male patient F.M. Carvalho 1*, E.V. Wolfgramm 1*, I. Degasperi 2, B.M. Verbeno
More informationUnderstanding the Human Karyotype Colleen Jackson Cook, Ph.D.
Understanding the Human Karyotype Colleen Jackson Cook, Ph.D. SUPPLEMENTAL READING Nussbaum, RL, McInnes, RR, and Willard HF (2007) Thompson and Thompson Genetics in Medicine, 7th edition. Saunders: Philadelphia.
More informationShort Report. B Lakhal a, R Braham b, R Berguigua a, N Bouali a, M Zaouali c, M Chaieb b, RA Veitia d,e,f, A Saad a,g and H Elghezal a,g
Clin Genet 2010: 78: 181 185 Printed in Singapore. All rights reserved Short Report 2010 John Wiley & Sons A/S CLINICAL GENETICS doi: 10.1111/j.1399-0004.2009.01359.x Cytogenetic analyses of premature
More informationIntrachromosomal homologous recombination between inverted amplicons on opposing Y-chromosome arms
Intrachromosomal homologous recombination between inverted amplicons on opposing Y-chromosome arms The MIT Faculty has made this article openly available. Please share how this access benefits you. Your
More informationGenetic evaluation of infertile men
Human Reproduction vol.14 no.1 pp.33 38, 1999 Genetic evaluation of infertile men S.E.Kleiman 1, L.Yogev, R.Gamzu, R.Hauser, A.Botchan, J.B.Lessing, G.Paz and H.Yavetz Institute for the Study of Fertility,
More informationMATERIALS AND METHODS
www.kjurology.org http://dx.doi.org/1.4111/kju.213.54.2.111 Male Infertility Detection of Y Chromosome Microdeletion is Valuable in the Treatment of Patients With Nonobstructive Azoospermia and Oligoasthenoteratozoospermia:
More informationINFERTILITY GENETIC TESTING. Dr. Ahmad Ebrahimi Molecular Medical Genetics,PhD Yass Medical Genetics Lab. Tehran University of Medical Science
INFERTILITY GENETIC TESTING Dr. Ahmad Ebrahimi Molecular Medical Genetics,PhD Yass Medical Genetics Lab. Tehran University of Medical Science INFERTILITY GENETIC TESTING It is estimated that genetics are
More informationHIMANSHU SHARMA. POSITION APPLIED FOR Postdoctoral Fellow
HIMANSHU SHARMA POSITION APPLIED FOR Postdoctoral Fellow Research Interests: Biochemistry and molecular cell biology Molecular Genetic Quality control and trafficking mechanism of misfolded proteins Therapeutic
More informationat least 5 probes standard 8 probes (13, 15, 16, 18, 21, 22, 15, X, Y) at least 5 probes standard 8 probes (13, 15, 16, 18, 21, 22, X, Y)
Management of FISH probe testing Petra Musilová et al. Repromeda, Brno, Czech Rep. Veterinary Research Institute, Brno Genprogress, Brno, Czech Rep. Aneuploidy screening at least 5 probes standard 8 probes
More informationCorrelation between chromosomal polymorphisms and male infertility in a Northeast Chinese population
Correlation between chromosomal polymorphisms and male infertility in a Northeast Chinese population L.L. Li 1, D. Peng 1, R.X. Wang 1, H.B. Zhu 1, W.J. Wang 2 and R.Z. Liu 1 1 Center for Reproductive
More informationDAPI ASY1 DAPI/ASY1 DAPI RAD51 DAPI/RAD51. Supplementary Figure 1. Additional information on meiosis in R. pubera. a) The
a % 10 Number of crossover per bivalent b 0 1 c DAPI/telomere 80 1 60 40 1 2 20 d 0 0 1 2 >=3 DAPI ASY1 DAPI/ASY1 e DAPI RAD51 DAPI/RAD51 Supplementary Figure 1. Additional information on meiosis in R.
More informationMosaic loss of chromosome Y in peripheral blood is associated with shorter survival and higher risk of cancer
Supplementary Information Mosaic loss of chromosome Y in peripheral blood is associated with shorter survival and higher risk of cancer Lars A. Forsberg, Chiara Rasi, Niklas Malmqvist, Hanna Davies, Saichand
More informationHER2 FISH pharmdx TM Interpretation Guide - Breast Cancer
P A T H O L O G Y HER2 FISH pharmdx TM Interpretation Guide - Breast Cancer For In Vitro Diagnostic Use FDA approved as an aid in the assessment of patients for whom Herceptin TM (trastuzumab) treatment
More informationRECENTLY, CONSIDERABLE attention has focused on
0021-972X/01/$03.00/0 Vol. 86, No. 6 The Journal of Clinical Endocrinology & Metabolism Printed in U.S.A. Copyright 2001 by The Endocrine Society Double-Blind Y Chromosome Microdeletion Analysis in Men
More informationY chromosome microdeletions in azoospermic patients with Klinefelter's syndrome
Asian J Androl 2006; 8 (1): 81 88 DOI: 10.1111/j.1745-7262.2006.00083.x. Original Article. Y chromosome microdeletions in azoospermic patients with Klinefelter's syndrome Anurag Mitra 1, Rima Dada 2, Rajeev
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationPDF hosted at the Radboud Repository of the Radboud University Nijmegen
PDF hosted at the Radboud Repository of the Radboud University Nijmegen The following full text is a publisher's version. For additional information about this publication click this link. http://hdl.handle.net/2066/24403
More informationElucigene Male Factor Infertility Products Instructions for Use
Elucigene Male Factor Infertility Products Instructions for Use Product Size Catalogue Code Elucigene Male Factor Infertility 25 tests AZFXYB1 Elucigene MFI-Yplus 10 tests AZFPLBX For In-Vitro Diagnostic
More informationHuman Y-chromosome variation and male dysfunction
63 REVIEW Human Y-chromosome variation and male dysfunction Cláudia Márcia Benedetto de Carvalho 1,2 and Fabrício Rodrigues Santos 2* 1 Departamento de Bioquímica e Imunologia, and 2 Departamento de Biologia
More informationREVIEW The Y chromosome and male fertility and infertility 1
international journal of andrology, 26:70 75 (2003) REVIEW The Y chromosome and male fertility and infertility 1 CSILLA KRAUSZ,* G. FORTI* and KEN MCELREAVEY *Andrology Unit, Department of Clinical Physiopathology,
More informationA. Incorrect! All the cells have the same set of genes. (D)Because different types of cells have different types of transcriptional factors.
Genetics - Problem Drill 21: Cytogenetics and Chromosomal Mutation No. 1 of 10 1. Why do some cells express one set of genes while other cells express a different set of genes during development? (A) Because
More informationWhat about gr/gr deletions and male infertility? Systematic review and meta-analysis
Human Reproduction Update, Vol.17, No.2 pp. 197 209, 2011 Advanced Access publication on October 19, 2010 doi:10.1093/humupd/dmq046 What about gr/gr deletions and male infertility? Systematic review and
More informationYq MICRODELETIONS IN IDIOPATHIC MALE INFERTILITY
Original Research Article Yq MICRODELETIONS IN IDIOPATHIC MALE INFERTILITY Dinesh Kumar. V * 1, Swetasmita Mishra 2, Rima Dada 2. ABSTRACT International Journal of Anatomy and Research, Int J Anat Res
More informationSignificance of Chromosome Changes in Hematological Disorders and Solid Tumors
Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Size of Components of Human Genome Size of haploid genome! Estimated genetic constitution! Size of average chromosome
More informationSignificance of Chromosome Changes in Hematological Disorders and Solid Tumors
Significance of Chromosome Changes in Hematological Disorders and Solid Tumors Size of Components of Human Genome Size of haploid genome 3.3 X 10 9 DNA basepairs Estimated genetic constitution 30,000
More informationScreening for microdeletions in human Y chromosome - AZF candidate genes and male infertility
J.Cell.Mol.Med. Vol 7, No 1, 2003 pp. 43-48 Screening for microdeletions in human Y chromosome - AZF candidate genes and male infertility Florina Raicu a, L. Popa a, Pompilia Apostol a, D. Cimponeriu a,
More informationThe study of relationship between chromosomal abnormality in lymphocyte cells of infertile men with intra-cytoplasmic sperm injection outcomes
The study of relationship between chromosomal abnormality in lymphocyte cells of infertile men with intra-cytoplasmic sperm injection outcomes Fallahi P, Rezaeian Z, *Moghbelinejad S Fertility and infertility
More informationName Date Class. Interphase. (1) The. grows. DNA is duplicated.
Concept Mapping The Cell Cycle Complete the cycle map about the cell cycle. These terms may be used more than once: cell, cytoplasm, metaphase, nuclear membrane, nucleoli, poles. (1) The Interphase grows.
More informationY chromosome microdeletions in Brazilian fertility clinic patients
Y chromosome microdeletions in Brazilian fertility clinic patients J.T. Arruda 1, B.M. Bordin 1, P.R. Santos 1, W.E.J.C. Mesquita 1, R.C.P.C. Silva 2, M.C.S. Maia 2, M.S. Approbato 2, R.S. Florêncio 2,
More informationCLL Complete SM Report
Reported: 02/01/2012 Σ CGI ID No:5 Client:r Client Address: CLINICAL DATA: Lymphoma No CBC results provided. CLL Complete SM Report FINAL DIAGNOSIS: CD19+ B cell lymphoma, ZAP-70 + (44%), with borderline
More informationInfluenza virus exploits tunneling nanotubes for cell-to-cell spread
Supplementary Information Influenza virus exploits tunneling nanotubes for cell-to-cell spread Amrita Kumar 1, Jin Hyang Kim 1, Priya Ranjan 1, Maureen G. Metcalfe 2, Weiping Cao 1, Margarita Mishina 1,
More informationSupplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was
Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was performed on a total of 85 SS patients. Data filtration
More informationFigure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022
96 APPENDIX B. Supporting Information for chapter 4 "changes in genome content generated via segregation of non-allelic homologs" Figure S1. Potential de novo CNV probes and sizes of apparently de novo
More informationChromosome Abnormalities
Chromosome Abnormalities Chromosomal abnormalities vs. molecular mutations Simply a matter of size Chromosomal abnormalities are big errors Two types of abnormalities 1. Constitutional problem present
More informationAbout 15% of couples are infertile because of several
Journal of Andrology, Vol. 24, No. 4, July/August 2003 Copyright American Society of Andrology Y Chromosome Deletions in Azoospermic Men in India KUMARASAMY THANGARAJ, NALINI J. GUPTA, KADUPU PAVANI, ALLA
More informationNo association of the A260G and A386G DAZL single nucleotide polymorphisms with male infertility in a Caucasian population
Human Reproduction Page 1 of 6 Hum. Reprod. Advance Access published November 1, 2004 doi:10.1093/humrep/deh522 No association of the A260G and A386G DAZL single nucleotide polymorphisms with male infertility
More informationUNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA
UNIVERSITI TEKNOLOGI MARA COPY NUMBER VARIATIONS OF ORANG ASLI (NEGRITO) FROM PENINSULAR MALAYSIA SITI SHUHADA MOKHTAR Thesis submitted in fulfillment of the requirements for the degree of Master of Science
More informationA Journey on Y Chromosomal Genes and Male Infertility
Kamla-Raj 0 Int J Hum Genet, (4): 03-5 (0) A Journey on Y Chromosomal Genes and Male Infertility V.S. Vineeth and Suttur S. Malini Human Genetics Laboratory, Department of Studies in Zoology, University
More informationMolecular Biology Research Communications 2016; 5(4):
Molecular Biology Research Communications 2016; 5(4):247-255 Original Article Open Access Partial and complete microdeletions of Y chromosome in infertile males from South of Iran Raheleh Masoudi *, Liusa
More informationTable S1. STSs Used in Detecting and Characterizing Deletions Involving AZFc. GenBank Accession a STSs used to detect deletions in first-stage screen:
Table S1. STSs Used in Detecting and Characterizing Deletions Involving AZFc STS Identifier GenBank Accession a STSs used to detect deletions in first-stage screen: sy1191 b G73809 sy1291 G72340 STSs used
More informationThe questions below refer to the following terms. Each term may be used once, more than once, or not at all.
The questions below refer to the following terms. Each term may be used once, more than once, or not at all. a) telophase b) anaphase c) prometaphase d) metaphase e) prophase 1) DNA begins to coil and
More informationSupplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.
Supplementary Figure 1: Hsp60 / IEC mice are embryonically lethal (A) Light microscopic pictures show mouse embryos at developmental stage E12.5 and E13.5 prepared from uteri of dams and subsequently genotyped.
More informationLoss of the AZFc region due to a human Y-chromosome microdeletion in infertile male patients
Loss of the AZFc region due to a human Y-chromosome microdeletion in infertile male patients L.K. Pandey 2, S. Pandey 2, J. Gupta 1 and A.K. Saxena 1 1 Human Cytogenetic and Molecular Genetic Laboratory,
More informationBRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information)
BRaf V600E cooperates with Pten silencing to elicit metastatic melanoma (Nature Genetics Supplementary Information) David Dankort, David P. Curley, Robert A. Cartlidge, Betsy Nelson, Anthony N. Karnezis,
More informationDeletion of azoospermia factor a (AZFa) regionof human Y chromosome caused by recombination between HERV15 proviruses
2000 Oxford University Press Human Molecular Genetics, 2000, Vol. 9, No. 15 2291 2296 Deletion of azoospermia factor a (AZFa) regionof human Y chromosome caused by recombination between HERV15 proviruses
More informationOriginal Article Study of chromosome detection and influencing factors in infertile patients with varicocele
Int J Clin Exp Med 2018;11(7):7088-7095 www.ijcem.com /ISSN:1940-5901/IJCEM0074955 Original Article Study of chromosome detection and influencing factors in infertile patients with varicocele Bing Wang
More informationSupplementary Figure 1. BMS enhances human T cell activation in vitro in a
Supplementary Figure 1. BMS98662 enhances human T cell activation in vitro in a concentration-dependent manner. Jurkat T cells were activated with anti-cd3 and anti-cd28 antibody in the presence of titrated
More informationCytogenetic and Y Chromosome Microdeletions Screening in Tunisian Infertile Men
Donnish Journal of Genetics and Molecular Biology Vol 1(1) pp. 001-005 October, 2015. http:///djgmb Copyright 2015 Donnish Journals Original Research Article Cytogenetic and Y Chromosome Microdeletions
More informationMeiosis. Formation of gamete = egg & sperm. Occurs only in ovaries and tees. Makes cells with haploid chromosome number
Meiosis Formation of gamete = egg & sperm Occurs only in ovaries and tees Makes cells with haploid chromosome number Meiosis Diploid= Full set of chromosomes 46 chromosomes in humans Found in most body
More informationFigure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor
Figures Part of introduction Figure 1. Possible role of oncogene activation, receptor, G-protein mutation, or tumor supressor gene deletion in the induction of thyroid carcinoma. ( by James A Fagin, M.D.)
More informationSupplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
More informationSupplemental Information. Figures. Figure S1
Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the
More informationFluorescent in situ hybridization studies in multiple myeloma
Fluorescent in situ hybridization studies in multiple myeloma Ozge Ozalp Yuregir 1, Feride Iffet Sahin 1, Zerrin Yilmaz 1, Ebru Kizilkilic 2, Sema Karakus 2 and Hakan Ozdogu 2 1 Department of Medical Genetics
More informationHER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer
P A T H O L O G Y HER2 CISH pharmdx TM Kit Interpretation Guide Breast Cancer FROM CERTAINTY COMES TRUST For in vitro diagnostic use HER2 CISH pharmdx Kit HER2 CISH pharmdx Kit is intended for dual-color
More informationCytogenetics 101: Clinical Research and Molecular Genetic Technologies
Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these
More informationIndex 333. GRTH, see Gonadotropinregulated
Index 329 Index A ADAM2, see Fertilin ADAM3, see Cyritestin ADAM24, see Testase Androgen receptor, CAG repeat, 254, 255,275,321,322 gene polymorphisms, 275, 276 genetic screening, 322 Andrology, genomics
More informationChromosome Study Lab 26 Answers
Study Lab 26 Free PDF ebook Download: Study Lab 26 Download or Read Online ebook chromosome study lab 26 answers in PDF Format From The Best User Guide Database Honors Biology Karyotype Lab. A Study. In
More information