Quadruplex real-time polymerase chain reaction assay for molecular diagnosis of Y-chromosomal microdeletions

Transcription

1 Quadruplex real-time polymerase chain reaction assay for molecular diagnosis of Y-chromosomal microdeletions Qiwei Guo, M.S., a Fenghua Lan, M.D., b Liangpu Xu, B.S., c Yu Jiang, M.S., a Li Xiao, M.S., a Hailong Huang, Ph.D., c and Yulin Zhou, Ph.D. a a Molecular Diagnostics Laboratory, Department of Medical Genetics, Prenatal Diagnosis Center, Maternal and Child Health Hospital, Xiamen; b Molecular Diagnostics Laboratory, Department of Clinical Genetics and Experimental Medicine, Fuzhou General Hospital, Fuzhou; and c Molecular Diagnostics Laboratory, Prenatal Diagnosis Center, Fujian Provincial Maternal and Child Health Hospital, Fuzhou, People s Republic of China Objective: To develop a rapid and reliable method for molecular diagnosis of Y-chromosomal microdeletions. Design: Study of diagnostic accuracy. Setting: Molecular diagnostics laboratories in three hospitals. Patient(s): A total of 701 men with nonobstructive azoospermia or oligozoospermia from three hospitals. Intervention(s): We developed a quadruplex real-time polymerase chain reaction (PCR) assay and evaluated its performance in molecular diagnosis of Y-chromosomal microdeletions. Main Outcome Measure(s): Analytic sensitivity, analytic specificity, clinical sensitivity, and clinical specificity. Result(s): The limit of detection of quadruplex real-time PCR assay was 100 pg genomic DNA. The method attained 100% analytic specificity, 100% clinical sensitivity, and 100% clinical specificity. Conclusion(s): We have successfully upgraded the diagnostic method published by the European Academy of Andrology and the European Molecular Genetics Quality Network. Our method was validated to be fast, simple, contamination free, of high analytic sensitivity and specificity. Therefore, it is strongly suggested that such quadruplex real-time PCR assay can be readily applied as clinical routine in the near future. (Fertil Steril Ò 2012;97: Ó2012 by American Society for Reproductive Medicine.) Key Words: Y-Chromosomal microdeletions, real-time PCR, EAA/EMQN guidelines, HANDS, azoospermia, oligozoospermia Y-Chromosomal microdeletions (YCMD) are the second most frequent genetic cause of spermatogenetic failure in infertile men after Klinefelter syndrome (1). Nowadays, the molecular mechanism resulting in such deletions had been clarified that it is due to the homologous recombination between identical repeated sequences in the male-specific region of the Y chromosome (MSY) which was classically subdivided into three regions: AZFa, AZFb and AZFc, respectively (2, 3). Deletions in the entire AZFa region invariably result in complete Sertoli cell only (SCO) syndrome and azoospermia (4, 5), which implies the virtual impossibility to retrieve testicular sperm for intracytoplasmic sperm injection (ICSI). Similarly, complete deletions of AZFb and AZFbþc result in azoospermia such that no sperm can be obtained by testicular sperm extraction (TESE) Received October 1, 2011; revised December 9, 2011; accepted January 2, 2012; published online January 21, Q.G., Y.J., and Y.Z. have applied for a patent relating to the method described in this study. F.L. has nothing to disclose. L. Xu. has nothing to disclose. L. Xiao has nothing to disclose. H.H. has nothing to disclose. Supported by Xiamen Medical Science Project (WSK0634). Reprint requests: Yulin Zhou, Ph.D., Molecular Diagnostics Laboratory, Department of Medical Genetics, Prenatal Diagnosis Center, Maternal and Child Health Hospital, Xiamen, Fujian , People s Republic of China ( zhou_yulin@126.com). Fertility and Sterility Vol. 97, No. 4, April /$36.00 Copyright 2012 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert (5, 6). AZFc deletions can be found in men with azoospermia or severe oligozoospermia and, rarely, can even be transmitted naturally to the male offspring (7 9), which means that such deletions are compatible with residue spermatogenesis. In general, TESE and ICSI should not be recommended to those patients who carried microdeletions covering the entire AZFa or AZFb regions. In contrast, in men with azoospermia and AZFc deletion, there is a fairly good chance of retrieving sperm from TESE and that children can be conceived by ICSI (7, 8, 10, 11). Diagnosis of YCMD may clarify the cause of nonobstructive azoospermia or oligozoospermia, may have prognostic value, and may influence therapeutic options (12 14). Because there are no clinical parameters beyond azoospermia or severe oligozoospermia that can be 864 VOL. 97 NO. 4 / APRIL 2012

2 Fertility and Sterility used to predict its occurrence, YCMD only can be diagnosed by molecular methods. Currently, molecular testing of such deletions is mainly based on polymerase chain reaction (PCR) amplification of selected sequence-tagged sites (STSs) within specific AZF regions. Considering that different diagnostic protocols might result in inaccurate or wrong diagnoses, guidelines were published by the European Academy of Andrology (EAA) and the European Molecular Genetics Quality Network (EMQN) to provide standardization for molecular diagnosis of such deletions, and it is well recognized so far (15). The method in those guidelines performed two quintuplex PCR reactions to detect six STS regions: sy84 and sy86 for AZFa, sy127 and sy134 for AZFb, and sy254 and sy255 for AZFc. SRY and ZFX/Y regions are also involved as internal controls. The primer sets in the guidelines, enabling the detection of almost all of the clinically relevant deletions and >95% of the deletions reported in the literature in the three AZF regions (15), thus meet the demand of routine diagnosis. However, some technical issues remain to be solved in the method proposed by the guidelines. First, multiplex primer pairs in one reaction facilitate the formation and accumulation of nonspecific PCR products, which would lower the analytic sensitivity and specificity. Moreover, relative long products amplification followed by electrophoresis makes the method time consuming and labor intensive. Finally, and the most important, the use of electrophoresis for product analysis makes the method vulnerable to carryover contamination which can be fatal to diagnosis. To address these problems, we developed a quadruplex realtime PCR assay for molecular diagnosis of YCMD based on the EAA/EMQN guidelines. In this assay, the real-time PCR platform allows detection of amplification through fluorescence intensity accumulation in a closed-tube setting, thus eliminating the carryover contaminations and reducing the time consumption and labor intensity. For alleviating primer dimer formation in the quadruplex reaction, a homotag-assisted nondimer system (HANDS) (16) was introduced in the assay. MATERIALS AND METHODS Samples Peripheral blood samples from 701 men with nonobstructive azoospermia or oligozoospermia were obtained from Xiamen Maternal and Child Health Hospital (n ¼ 451), Fuzhou General Hospital (n ¼ 72), and Fujian Provincial Maternal and Child Health Hospital (n ¼ 178). The Research Ethics Committees of the three hospitals approved the study protocols. All samples were coded, and the code numbers were known only to the technician who collected and coded the samples. Genomic DNA were extracted from 200-mL blood samples with the QIAamp DNA Mini Kit (Qiagen) according to the manufacturer s protocol. The concentration of extracted genomic DNA was determined by measuring the UV absorbance at 260 nm with the Nanovue plus spectrophotometer (GE Healthcare). Primers and Probes According to the EAA/EMQN guidelines, six STS regions, sy84, sy86, sy127, sy134, sy254 and sy255, were chosen as targets. SRY and ZFX/Y regions were also involved as TABLE 1 Information of primers and probes. Name Sequence (5 0 to 3 0 ) Concentration (nmol/l) Reaction A SRY-F GCAAGCCCTCACGTAGCGAATAGAGAATCCCAGAATGCGAAA 200 SRY-R GCAAGCCCTCACGTAGCGAACTGTGCCTCCTGGAAGAAT 200 SRY-P FAM-AAGCAGCTGGGATACCAGTGGAAAATGCT-BHQ1 200 sy86-f GCAAGCCCTCACGTAGCGAACTCACAGTCCTTGAGGCTA 40 sy86-r GCAAGCCCTCACGTAGCGAAAAGACAGCATCTACAACCCA 40 sy86-p HEX-ATCAAGCTATGGCCAGGGCTGGTTCC-BHQ1 200 sy127-f GCAAGCCCTCACGTAGCGAAGGCTCACAAACGAAAAGAAA 400 sy127-r GCAAGCCCTCACGTAGCGAACTTTTGTATAATTAGCATCTCATGAA 400 sy127-p ROX-ACTGGAATCTACCAAAGCCCACTGTGTTCATG-BHQ2 200 sy254-f GCAAGCCCTCACGTAGCGAAGGGTGTTACCAGAAGGCAA 40 sy254-r GCAAGCCCTCACGTAGCGAAGTACGAATACAATACCCTAGCA 40 sy254-p CY5-TCGTGCCAAACACTGTTTTTGTTGGTGGAA-BHQ2 200 Reaction B ZFX/Y-F GCAAGCCCTCACGTAGCGAACCACCTGGAGAGCCACAA 200 ZFX/Y-R GCAAGCCCTCACGTAGCGAAACAAAGCCCCTGCATGAGA 200 ZFX/Y-P FAM-ACCAGCAAGGCAGAGAAGGCCATTGA-BHQ1 200 sy84-f GCAAGCCCTCACGTAGCGAAGATTCAGTGGGACCCTTTCTT 200 sy84-r GCAAGCCCTCACGTAGCGAAGGAGGCTTCATCAGCAAGA 200 sy84-p HEX-AAGCTGGCTAACTCCTTTCAAAAGGTTTTGTCTT-BHQ1 200 sy134-f GCAAGCCCTCACGTAGCGAAGAGGAATAGTACAGGTCAAAGGAA 200 sy134-r GCAAGCCCTCACGTAGCGAATCTTTCAGTCACAGAACGCTT 200 sy134-p ROX-ATAGATGGGGTTGATACTAAAGTTTAAAACATCTGGAACATTCTACT-BHQ2 200 sy255-f GCAAGCCCTCACGTAGCGAAGTTACAGGATTCGGCGTGAT 40 sy255-r GCAAGCCCTCACGTAGCGAACTCGTCATGTGCAGCCAC 40 sy255-p CY5-AGGTAGGTTTCAGTGTTTGGATTCCGCA-BHQ2 200 Universal primer GCAAGCCCTCACGTAGCGAA 1,600 VOL. 97 NO. 4 / APRIL

3 ORIGINAL ARTICLE: ANDROLOGY FIGURE 1 Reaction A Unaffected male Female - AZF a sy86 - sy AZF b SRY - sy86 - AZF c AZF bc AZF abc NTC sy127 sy Reaction B Unaffected male Female - AZF a sy86 - sy AZF b ZFX/Y - sy84 sy134 sy255 - AZF c AZF bc AZF abc NTC Specificity validation of quadruplex assay against six samples with known genotypes and two control samples. internal controls. Following the principle of HANDS, all of the primers had a common sequence at their 5 0 ends to generate a universal primer binding site, and that sequence was used as the universal primer. After comparison of several universal primer sequences, a sequence used in a previous study was chosen (17). Eight hydrolysis probes were designed for detection of eight amplicons respectively. Primers and probes were designed using Primer Premier 5.0 (Premier Biosoft Int.), and the sequences was listed in Table 1. Quadruplex Real-Time PCR Assay The assay was carried out in two quadruplex reactions. Reaction A consisted of sy86, sy127, sy254, and SRY primers and probes, and reaction B consisted of sy84, sy134, sy255, and ZFX/Y primers and probes. Hydrolysis probes within a reaction were labeled with FAM, HEX, ROX, and CY5. The 25-mL reaction contained 10 mmol/l Tris-HCl (ph 8.3), 50 mmol/l KCl, 1 U TaqHS (Takara), 3.0 mmol/l Mg 2þ, mmol/l of each deoxynucleoside triphosphate, 1.6 mmol/l universal primer. The concentration of primers and probes was listed in Table 1. The cycling conditions were 95 C for 3 minutes, followed by 40 cycles of 95 C for 15 seconds, 63 C for 20 seconds, and 72 C for 20 seconds. data from the four corresponding channels were collected at the end of the annealing step on a LightCycler 480 II (Roche Diagnostics) or Stratagene Mx3005P (Agilent Technologies) thermocycler. RESULTS Validation of Quadruplex Assay Five male samples that carried different known types of microdeletion, an unaffected male sample, a female control sample, and a no-template control sample were examined with quadruplex real-time PCR assay. As shown in Figure 1, 866 VOL. 97 NO. 4 / APRIL 2012

4 Fertility and Sterility FIGURE 2 Reaction A FAM HEX ROX CY Reaction B FAM HEX ROX CY5 0 NTC 0.1 ng 0.3 ng 1 ng 3 ng 10 ng 30 ng 100 ng 300 ng Analytic sensitivity analysis of quadruplex real-time polymerase chain reaction assay. all types of microdeletion and unaffected control were differentiated unambiguously, and no false-positive signals were obtained with female control or no-template control. Consequently, the quadruplex assay achieved 100% analytic specificity. Analytic Sensitivity Studies To evaluate the analytic sensitivity of the quadruplex assay, genomic DNA from an unaffected man, ranging from 100 pg to 300 ng per reaction, were tested in duplicate. As shown in Figure 2, the entire range of DNA concentrations can be robustly detected. The limit of detection was 100 pg genomic DNA within 40 amplification cycles, which meets the demands of a regular blood test. Application to Clinical Samples We analyzed 701 blinded clinical samples whose genotypes had been previously characterized by EAA/EMQN guidelines method in three independent medical laboratories. As presented in Table 2, 81 samples were designated to carry microdeletions and 620 samples were designated as unaffected, which attained 100% clinical sensitivity and 100% clinical specificity in all three laboratories. DISCUSSION Molecular diagnosis of YCMD, which has prognostic value and can influence therapeutic options, has become a routine test for nonobstructive azoospermia and oligozoospermia patients. To eliminating the inaccurate or wrong diagnoses, EAA/EMQN guidelines were published to provide standardization (15). Although the diagnostic method proposed in the guidelines is well recognized so far, it tends to be relative time consuming, labor intensive, and susceptible to carryover contamination. In the present work, to overcome such drawbacks, we successfully developed a quadruplex real-time PCR assay that was able to simultaneously detect six STS regions TABLE 2 Application of quadruplex assay with clinical samples in three medical laboratories. Sample Xiamen Maternal and Child Health Hospital Fuzhou General Hospital Fujian Provincial Maternal and Child Health Hospital Method 1 Method 2 Method 1 Method 2 Method 1 Method 2 Affected AZFa AZFb AZFc AZFbþc AZFaþbþc Unaffected Note: Method 1: quadruplex real-time PCR assay; method 2: EAA/EMQN guidelines method. VOL. 97 NO. 4 / APRIL

5 ORIGINAL ARTICLE: ANDROLOGY and two internal controls in two reactions. Compared with the EAA/EMON guidelines method, each amplicon in our quadruplex assay was shortened to 150 bp by redesigning the primer sets, consequently saving the elongation time and balancing the amplification efficiencies. We also replaced the electrophoresis analysis with real-time PCR, which eliminates the risk of contamination, lowers the labor intensity, and shortens the turnaround time from about 5 hours to 1 hour. In the past few years, several approaches has been developed to constitute the important adjuncts to the EAA/EMON guidelines method for the rapid diagnosis of YCMD (18 20), but the performance or throughput limitations of these methods constrain their use in routine testing. For example, Zhu et al. (18) reported a novel YCMD detection method based on multianalyte suspension array technology, but the method could not be applied widely in a short time owing to the high cost and relatively complicated operation. Plaseski et al. (19) used another platform, quantitative fluorescent PCR, to examine the AZF deletions/duplications, in which sex chromosome aneuploidy can be simultaneously detected. However, the demand of capillary electrophoresis for product analysis constrains the testing throughput by the capillary capacity. Recently, Kozina et al. (20) have also reported a realtime PCR based method for YCMD detection using melting curve analysis strategy. Even though the adoption of realtime PCR overcomes the drawbacks of postmanipulation of PCR products, their method was still exposed to many problems. One notable problem is that nonspecific products such as primer dimers could also generate similar melting curves, which cannot be distinguished from those of specific products by the DNA-binding dyes, thus lowering the accuracy and sensitivity of the assay. In contrast, we used hydrolysis probes to capture and indicate the specific products, therefore ensuring accuracy. Furthermore, compared with a sensitivity of 350 pg/ml in the melting curve based method (20), the limit of detection for our quadruplex real-time PCR assay was 100 pg (20 pg/ml) genomic DNA per reaction, amounting to 15 copies of the Y-chromosome targets, which is more than sufficient for a routine blood test. In practice, the concentrations of genomic DNA extracted from peripheral blood mostly range from 1 to 100 ng/ml, which means that the wide analytic range of the quadruplex assay (100 pg 300 ng per reaction) allows detection of DNA samples without precise quantification and dilution (Fig. 2). We attribute such high analytic sensitivity of the quadruplex assay to the adoption of HANDS (16), the principle of which is simply described as follows. In multiplex PCR assays, nonspecific PCR product formation, such as primer dimers, is ubiquitous, which exhausts the reaction components, resulting in low sensitivity and specificity. However, when a common sequence is added to the 5 0 ends of all primers, any primer dimer generated at the beginning of PCR is converted into a stable hairpin structure, which prevents further replication. Such a common sequence was also used as the universal primer, which can elevate and balance the amplification efficiencies among different targets in multiplex assay. Following this principle, adoption of HANDS should facilitate the setup of most multiplex real-time PCR systems (17). Another drawback of the melting curve based method is that the assay is relative complicated to execute. So many issues, such as product length, GC contents, etc., must be taken into account to generate multiple distinct melting curves within a narrow temperature range. That is the reason that one-half of the target regions recommended by the EAA/ EMQN guidelines were replaced in the melting curve based method (20). In contrast, with the use of HANDS and hydrolysis probes, our method can be easily set up and optimized, along with distinct result export. Considering that target regions of our assay were designed based on those of EAA/ EMQN guidelines, the results of the two methods were highly consistent, which can be validated by the attaining of 100% analytic specificity, 100% clinical sensitivity, and 100% clinical specificity for our quadruplex assay (Fig. 1; Table 2) Therefore, almost all of the clinically relevant deletions can be detected by use of our quadruplex assay, which is sufficient for routine screening. In summary, we have upgraded the diagnostic method in the EAA/EMQN guidelines to a quadruplex real-time PCR assay for molecular diagnosis of YCMD. The assay was validated to be fast, simple, contamination free, and of high sensitivity and specificity. Moreover, its clinical application capability was confirmed by the test of 701 blinded clinical samples in three independent medical laboratories. Therefore, it is highly suggested that such quadruplex real-time PCR assay can be readily applied as clinical routine in the near future. Acknowledgments: The authors thank Profs. Qingge Li and Zhenghong Zuo for their kind support and Drs. Yanwei Sha, Honggen Ou yang, Aizhen Yan, and Xiangdong Tu for sample collection. REFERENCES 1. Foresta C, Moro E, Ferlin A. Y Chromosome microdeletions and alterations of spermatogenesis. Endocr Rev 2001;22: Skaletsky H, Kuroda-Kawaguchi T, Minx PJ, Cordum HS, Hillier L, Brown LG, et al. The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature 2003;423: Vogt PH, Edelmann A, Kirsch S, Henegariu O, Hirschmann P, Kiesewetter F, et al. Human Y chromosome azoospermia factors (AZF) mapped to different subregions in Yq11. Hum Mol Genet 1996;5: Kamp C, Huellen K, Fernandes S, Sousa M, Schlegel PN, Mielnik A, et al. High deletion frequency of the complete AZFa sequence in men with Sertoli-cell only syndrome. Mol Hum Reprod 2001;7: Hopps CV, Mielnik A, Goldstein M, Palermo GD, Rosenwaks Z, Schlegel PN. Detection of sperm in men with Y chromosome microdeletions of the AZFa, AZFb and AZFc regions. Hum Reprod 2003;18: Krausz C, Quintana-Murci L, McElreavey K. Prognostic value of Y deletion analysis: what is the clinical prognostic value of Y chromosome microdeletion analysis? Hum Reprod 2000;15: Gambera L, Governini L, de Leo V, Luddi A, Morgante G, Tallis V, et al. Successful multiple pregnancy achieved after transfer of frozen embryos obtained via intracytoplasmic sperm injection with testicular sperm from an AZFc-deleted man. Fertil Steril 2010;94:2330.e Oates RD, Silber S, Brown LG, Page DC. Clinical characterization of 42 oligospermic or azoospermic men with microdeletion of the AZFc region of the Y chromosome, and of 18 children conceived via ICSI. Hum Reprod 2002;17: VOL. 97 NO. 4 / APRIL 2012

6 Fertility and Sterility 9. Rodovalho RG, Arruda JT, Moura KK. Tracking microdeletions of the AZF region in a patrilineal line of infertile men. Genet Mol Res 2008;7: Patrat C, Bienvenu T, Janny L, Faure AK, Fauque P, Aknin-Seifer I, et al. Clinical data and parenthood of 63 infertile and Y-microdeleted men. Fertil Steril 2010;93: Chiang HS, Yeh SD, Wu CC, Huang BC, Tsai HJ, Fang CL. Clinical and pathological correlation of the microdeletion of Y chromosome for the 30 patients with azoospermia and severe oligoasthenospermia. Asian J Androl 2004;6: Stahl PJ, Masson P, Mielnik A, Marean MB, Schlegel PN, Paduch DA. A decade of experience emphasizes that testing for Y microdeletions is essential in American men with azoospermia and severe oligozoospermia. Fertil Steril 2010;94: Sadeghi-Nejad H, Oates RD. The Y chromosome and male infertility. Curr Opin Urol 2008;18: Ferlin A, Arredi B, Speltra E, Cazzadore C, Selice R, Garolla A, et al. Molecular and clinical characterization of Y chromosome microdeletions in infertile men: a 10-year experience in Italy. J Clin Endocrinol Metab 2007;92: Simoni M, Bakker E, Krausz C. EAA/EMQN best practice guidelines for molecular diagnosis of Y-chromosomal microdeletions. State of the art Int J Androl 2004;27: Brownie J, Shawcross S, Theaker J, Whitcombe D, Ferrie R, Newton C, et al. The elimination of primer-dimer accumulation in PCR. Nucleic Acids Res 1997;25: Huang J, Zhu Y, Wen H, Zhang J, Huang S, Niu J, et al. Quadruplex real-time PCR assay for detection and identification of Vibrio cholerae O1 and O139 strains and determination of their toxigenic potential. Appl Environ Microbiol 2009;75: Zhu YJ, Liu SY, Wang H, Wei P, Ding XP. The prevalence of azoospermia factor microdeletion on the Y chromosome of Chinese infertile men detected by multi-analyte suspension array technology. Asian J Androl 2008;10: Plaseski T, Noveski P, Trivodalieva S, Efremov GD, Plaseska-Karanfilska D. Quantitative fluorescent-pcr detection of sex chromosome aneuploidies and AZF deletions/duplications. Genet Test 2008;12: Kozina V, Cappallo-Obermann H, Gromoll J, Spiess AN. A one-step real-time multiplex PCR for screening Y-chromosomal microdeletions without downstream amplicon size analysis. PLoS One 2011;6:e VOL. 97 NO. 4 / APRIL