More than 98 countries affected by Leishmaniasis

Transcription

1

2

3 More than 98 countries affected by Leishmaniasis

4 ACL In many urban & sub urban areas (8 provinces) Tehran, Mashhad, Neishabur, Shiraz, Kerman, Bam (Sharifi et al. 2011) ZCL In 2012, totally ( ZCL & ACL) 20,947 cases were reported ( Shirzadi et al. 2015) In many rural areas in 17 out of 31 provinces. (Akhavan et al. 2010) North- Eastern Center West & South- western South of Iran

5 Diagnosis Parasitological methods Serological methods Molecular methods

6 Different genome Cyto b kdna ITS Leishmania spp COI, COII HSP70

7 20 bp Intergenic spacer Cyto b CB1 : 439bp CB3 : 499bp Intergenic spacer : 20bp

8 Material & Methods

9 Parasitologically negative (based on lab report) Among positive samples, 20% were sequenced

10 Molecular methods

11 DNA Extraction by DynaBio Tm Blood/Tissue DNA Extraction MiniKit (Takapoozist, Iran

12 cytochrome b PCR

13 Primers used in cytochrome b PCR Primer Name LCBF1 Sequence 5'GGTGTAGGTTTTAGTTTAGG3' Length of (bp) Primer 21 LCBR2 5' CTACAATAAACAAATCATAATATACAATT3' 29

14 Materials Primer (Ex) Volume 1 µl Run(PCR 1) Step Cycle Tem. (Cº) Time MM 7.5 µl Initial 95 5m Denaturation DNA 2 µl Denaturation sec D.D.W 4.5 µl Annealing sec Extension m Final Extension 72 5m

15 PCR- RFLP Material Requirements Amounts PCR products 10 µl Ssp1 enzymes restriction enzyme buffer 1 1 µl µl DDW 18 µl Total 30 µl incubated at 37 C for 7 hours. products were separated by using 1.5% agarose gels in TAE buffer and visualized after staining by gel red.

16 The Ssp1 enzyme activities at the end of 5 overhang location of Leishmania species. Leishmania species Number of fragments Digestion position in 5 ' end Size (bp) Leishmania major , 480 Leishmania tropica 3 218, , 215, 535

17 L. major MHOM/IR/75/ER

18 Among positive samples, 20% were sequenced

19 Results

20

21 Gel electrophoresis of cytochrome b PCR product Figure 1. The cytochrome b electrophoresis. Line 1: 100 bp Ladder Lines 2 to 5: 880 bp bands of suspicious samples Line 6: negative control Line 7: positive control

22 Gel electrophoresis of PCR- RFLP products The electrophoresis results of cytochrome b in Leishmania species in the Sistan- Baluchestan province under the effect of Ssp1 enzymes. Line 1: 100 bp Ladder Line 2: 400 and 480 bp of Leishmania major Line 3: 130, 215 and 535 bp of Leishmania tropica Line 4: 880 bp not under the influence of enzyme.

23 Analysis of sequences determined three nucleotide differences in positions 11, 283, 419 and 642. In the isolated Leishmania major there were 3-5 nucleotide changes between cytochrome b, predominantly in 4 place of nucleotide codons (Wobble site) that did not lead to new amino-acid creation.

24

25 Leishmaniasis in Iran CL VL

26 Early & Accurate diagnosis Precise prognosis & Proper treatment

27 Usually, diagnosis of Cutaneous Leishmaniasis is based on microscopic methods or cultivation of Leishmania from skin samples or aspirated wounds. But these methods are insensitive and time-consuming (Schalling et al. 2002); The common PCR method for detection and identification of Leishmania is more sensitive than conventional direct microscopic observation and in vitro culture several Leishmania species may be simultaneously present in one area (Marfurt et al. 2003). In this case, comparison of ISO enzymes and using DNA of the parasite is the gold standard to differentiate the species of Leishmania (Schonian et al. 2003). Determination of Leishmania species based on clinical signs and symptoms can be problematic,cutaneous Leishmaniasis needs differential diagnosis due to diverse clinical features (Bailey et al. 2007). however, easily possible by providing slides from the patient s wound and Giemsa staining, but diagnosis will be difficult in the case of chronic wound, where the parasite numbers are low. (AL- jawabereh et al. 2006

28 Two points

29 cytochrome b can detect 0.01 parasite/ ml Its position in areas with the largest ring mode in kinetoplast, where there are about 50 copies of it

30

31 SO

32

33 Useful for detecting Leishmania in samples with low amount of parasite A reliable marker for fast determination of parasite species of the disease agent.

34