Supplemental Data. Deinlein et al. Plant Cell. (2012) /tpc

Transcription

1 µm Zn µm Zn 2+ Growth (% of control) empty vector NS1 NS2 NS3 NS4 S. pombe zhfδ Supplemental Figure 1. Functional characterization of. halleri NS genes in Zn 2+ hypersensitive S. pombe Δzhf mutant cells. Functional characterization of. halleri NS genes in S. pombe. Cells of the Zn 2+ hypersensitive Δzhf mutant carrying either the empty psgp72 plasmid or expressing an NS gene were grown in EMM medium without (=control) or with added Zn 2+ ( µm, grey bars, or 15 µm, black bars) as described by Weber et al. (4). OD was measured after 24 hrs and is shown here as % of growth in medium without added Zn 2+. Shown are the means of 2 (15 µm Zn 2+ ) to 4 ( µm Zn 2+ ) independent experiments. Error bars indicate SD. Statistical significances were determined using one-way analysis of variance followed by a Tukey test. sterisks denote significant differences compared to the empty-vector mean, P <.5, P <.1, P <.1. Expression constructs were generated in psgp72 using the following primers: hns1-hc5 : cgcggcggccgctggcttgccctc, hns1-hc3 : cgcggcggccgcactcgtggcctctcttc; hns2-hc5 : gcgcgcggccgctggcttgcggccctc, hns2-hc3 : gcgcgcggccgcactcgtggcctctcttc; hns3-hc5 : cgcggcggccgctgggttccgcgc, hns3-hc3 : cgcggcggccgcagcctgttcttccctg; hns4-hc5 : cgcggcggccgctgggttttgccgcg, hns4-hc3 : cgcggcggccgcagtgttgttcttcttg 1

2 Relative Transcript Level in roots Relative Transcript Level in leaves Control + 1 µm Zn 2+ NS1 NS2 NS3 NS4 Control + 1 µm Zn 2+ NS1 NS2 NS3 NS4 Supplemental Figure 2. Expression of NS genes in. halleri roots and leaves. Transcript levels of the four known NS genes were determined in roots () and leaves () of hydroponically grown. halleri wild-type plants. Clones of an individual from the Langelsheim population were harvested after five weeks of cultivation either in control medium (grey bars) or in medium with extra 1 µm Zn 2+ (black bars) and analyzed by real-time RT-PCR. Transcript abundance is expressed relative to EF1α. Values are means ± SD of n = 2 independent samples (three replicate clones per genotype were pooled for each sample). 2

3 Relative Transcript Level in roots NS1 NS3 NS4 Relative Transcript Level in leaves 1 1 WT Control hns2-suppressed. halleri hns2-rni lines NS1 NS3 NS4 WT Control hns2-suppressed. halleri hns2-rni lines Supplemental Figure 3. Effects of hns2-rni on NS1, NS3, and NS4 transcript abundance. Transcript levels of NS1 (light grey bars), NS3 (dark grey bars), and NS4 (black bars) were analyzed in roots () and leaves () of hydroponically grown. halleri (Langelsheim) wild-type plants, the two control transformants, and the three hns2-rni lines. Tissue was harvested after five weeks of cultivation in control medium and analyzed by real-time RT-PCR. Transcript abundance is expressed relative to EF1α. Values are means ± SD of n = 3 independent experiments (three replicate clones per genotype were pooled for each data point). 3

4 Root N concentration (µg g -1 f. w.) WT Control RNi lines hns2-suppressed RNi lines Relative Transcript Level hns2 in roots Supplemental Figure 4. Correlation of NS2 transcript level and root N concentrations in. halleri wild-type and hns2-rni plants grown in the presence of 1 µm Zn 2+.. halleri wild-type (Langelsheim) plants, the two control transformants, and the three hns2-suppressed lines were grown hydroponically. NS2 transcript levels were determined by real-time RT-PCR. Transcript abundance is expressed relative to EF1α. N was quantified after Fmoc-derivatization via UPLC-ESI-QTOF-MS and stable isotope dilution analysis. Values are means ± SD of n = 3 independent experiments (for each data point three replicate clones per genotype were pooled) (r =.75, P <.1). 4

5 Leaf N concentration (µg g -1 f.w.) Leaf N concentration (µg g -1 f.w.) Control WT Control hns2-suppressed. halleri hns2-rni lines + 1 µm Zn 2+ WT Control hns2-suppressed. halleri hns2-rni lines Supplemental Figure 5. N concentration in leaves of. halleri wild-type and hns2-rni plants. N was quantified in leaves of. halleri wild-type (Langelsheim) plants, the two control transformants, and the three hns2- suppressed lines grown hydroponically either in control medium () or in medium with extra 1 µm Zn 2+ () after Fmoc-derivatization via UPLC-ESI-QTOF-MS and stable isotope dilution analysis. Shown are means ± SD of three independent experiments (three replicate clones per genotype were pooled for each data point). Statistical significances were determined using one-way analysis of variance followed by a Tukey test. sterisks denote significant differences compared to the wild-type mean, P <.5. 5

6 C Root Zn concentration (µg g -1 d.w.) Shoot Zn concentration (µg g -1 d.w.) Zn concentration shoot/root ratio WT Control hns2-suppressed. halleri hns2-rni lines WT Control hns2-suppressed. halleri hns2-rni lines WT Control hns2-suppressed. halleri hns2-rni lines Supplemental Figure 6. Zn concentrations in roots and leaves of. halleri wild-type and hns2-rni plants grown in control medium. Zn accumulation was determined in hydroponically grown. halleri wild-type (Langelsheim), the two control transformants, and the three hns2-rni lines cultivated in control medium (.77 µm ZnSO 4 ). Tissues were harvested after 5 weeks, digested and analyzed by ICP- OES. Shown in () and () are values for roots and leaves, respectively. For (C) shoot/root ratios of Zn concentrations were calculated from the data shown above. ll values are arithmetic means ± SD, n = 4 to 6 with 3 replicate clones of each genotype pooled per experiment. 6

7 Relative intensity (%) Relative intensity (%) Relative intensity (%) % % % [N +H] COOH N [GSH +H] + COOH N H [des γglu PC 2 +H] + COOH NH 2 m/z m/z m/z Supplemental Figure 7. HILIC-ESI-TOF-MS analysis of SEC low molecular weight Zn fractions. Low molecular weight Zn fractions revealed by SEC-ICP-MS analysis of hns2-rni line 1-2 roots (see Fig. 6, peak with retention time around s) were analyzed by HILIC-ESI-TOF-MS (positive mode). Spectra were recorded for samples collected from the SEC column. High ion counts for GSH (38.916; eluting after 2-3 min) were observed while N (34.159; eluting after about 18.6 min) only was present in trace amounts. Note that in lowmolecular weight Zn fractions obtained from wild-type plants a much stronger N signal was recorded (please compare N concentrations shown in Fig. 2). In addition, des-γglu-pc2 was identified by direct injection into the ESI-TOF- MS. n internal sample of N (Lee et al., 11) and a commercial sample of GSH were used for mass calibration and verification of elution time. 7

8 C Leaf Mn concentration (µg g -1 d.w.) Leaf Cu concentration (µg g -1 d.w.) Leaf Fe concentration (µg g -1 d.w.) No Zn contamination WT No Zn contamination WT No Zn contamination Intermediate Intermediate Supplemental Figure 8. Leaf Mn, Cu, and Fe concentrations of. halleri wildtype and hns2-rni plants grown in native. halleri soils. Elemental analysis was performed of wild-type (Langelsheim) plants (light yellow), the control transformant line -7 (dark yellow) and the three hns2-suppressed lines 1-2 (green), 7-12 (blue) and 11-1 (red) grown on three types of untreated soil collected at sites of native. halleri populations in the Harz Mountains in Germany with different soil Zn levels ranging from background levels of heavy metals to heavily Zn contaminated (for extractable and exchangeable Zn and Cd level of soils see Tab. 4). Leaf Mn (), Cu () and Fe (C) concentrations were analyzed by ICP-OES. Values are arithmetic means ± SD of n = 3 to 9 individual plants from three independent experiments. Intermediate WT Heavy Heavy Heavy 8

9 Supplemental Table 1. Sequences of primers used for transcript analysis by real-time RT-PCR. Name hns1-fw hns1-rev hns2-fw hns2-rev hns3-fw hns3-rev hns4-fw hns4-rev tns2-fw tns2-rev EF1α-fw EF1α-rev IRT1-fw IRT1-rev ZIP9-fw ZIP9-rev Sequence TGTCTTCCCCCGGCGTC CGCGTCTTTGGTCGGC CCTGTGTGTTCGCTG GCTTTGCCTTTGCTCTTTTCC TCTGTCCGCTCTCTCCGG TCTGTCCGTCCTTTTCCGG TGGCCTGGCGTTTCTCTTCCC CCGTCTTGGCCTTGG CTGCGCGTGGTTTTCGG TGCCTCGGCTCCTTTG TGGCCGCTCTTCTTGCTTTC GGTGGTGGCTCCTCTTGTTC CCCCGCTGTGTTCCTT GGTTCGCGGTTGTGCT CCTCCTCTCCCTCGGTGT CCCTGCGCCGCTT 9