Supplemental Data. Deinlein et al. Plant Cell. (2012) /tpc
|
|
- Laureen Wilkinson
- 5 years ago
- Views:
Transcription
1 µm Zn µm Zn 2+ Growth (% of control) empty vector NS1 NS2 NS3 NS4 S. pombe zhfδ Supplemental Figure 1. Functional characterization of. halleri NS genes in Zn 2+ hypersensitive S. pombe Δzhf mutant cells. Functional characterization of. halleri NS genes in S. pombe. Cells of the Zn 2+ hypersensitive Δzhf mutant carrying either the empty psgp72 plasmid or expressing an NS gene were grown in EMM medium without (=control) or with added Zn 2+ ( µm, grey bars, or 15 µm, black bars) as described by Weber et al. (4). OD was measured after 24 hrs and is shown here as % of growth in medium without added Zn 2+. Shown are the means of 2 (15 µm Zn 2+ ) to 4 ( µm Zn 2+ ) independent experiments. Error bars indicate SD. Statistical significances were determined using one-way analysis of variance followed by a Tukey test. sterisks denote significant differences compared to the empty-vector mean, P <.5, P <.1, P <.1. Expression constructs were generated in psgp72 using the following primers: hns1-hc5 : cgcggcggccgctggcttgccctc, hns1-hc3 : cgcggcggccgcactcgtggcctctcttc; hns2-hc5 : gcgcgcggccgctggcttgcggccctc, hns2-hc3 : gcgcgcggccgcactcgtggcctctcttc; hns3-hc5 : cgcggcggccgctgggttccgcgc, hns3-hc3 : cgcggcggccgcagcctgttcttccctg; hns4-hc5 : cgcggcggccgctgggttttgccgcg, hns4-hc3 : cgcggcggccgcagtgttgttcttcttg 1
2 Relative Transcript Level in roots Relative Transcript Level in leaves Control + 1 µm Zn 2+ NS1 NS2 NS3 NS4 Control + 1 µm Zn 2+ NS1 NS2 NS3 NS4 Supplemental Figure 2. Expression of NS genes in. halleri roots and leaves. Transcript levels of the four known NS genes were determined in roots () and leaves () of hydroponically grown. halleri wild-type plants. Clones of an individual from the Langelsheim population were harvested after five weeks of cultivation either in control medium (grey bars) or in medium with extra 1 µm Zn 2+ (black bars) and analyzed by real-time RT-PCR. Transcript abundance is expressed relative to EF1α. Values are means ± SD of n = 2 independent samples (three replicate clones per genotype were pooled for each sample). 2
3 Relative Transcript Level in roots NS1 NS3 NS4 Relative Transcript Level in leaves 1 1 WT Control hns2-suppressed. halleri hns2-rni lines NS1 NS3 NS4 WT Control hns2-suppressed. halleri hns2-rni lines Supplemental Figure 3. Effects of hns2-rni on NS1, NS3, and NS4 transcript abundance. Transcript levels of NS1 (light grey bars), NS3 (dark grey bars), and NS4 (black bars) were analyzed in roots () and leaves () of hydroponically grown. halleri (Langelsheim) wild-type plants, the two control transformants, and the three hns2-rni lines. Tissue was harvested after five weeks of cultivation in control medium and analyzed by real-time RT-PCR. Transcript abundance is expressed relative to EF1α. Values are means ± SD of n = 3 independent experiments (three replicate clones per genotype were pooled for each data point). 3
4 Root N concentration (µg g -1 f. w.) WT Control RNi lines hns2-suppressed RNi lines Relative Transcript Level hns2 in roots Supplemental Figure 4. Correlation of NS2 transcript level and root N concentrations in. halleri wild-type and hns2-rni plants grown in the presence of 1 µm Zn 2+.. halleri wild-type (Langelsheim) plants, the two control transformants, and the three hns2-suppressed lines were grown hydroponically. NS2 transcript levels were determined by real-time RT-PCR. Transcript abundance is expressed relative to EF1α. N was quantified after Fmoc-derivatization via UPLC-ESI-QTOF-MS and stable isotope dilution analysis. Values are means ± SD of n = 3 independent experiments (for each data point three replicate clones per genotype were pooled) (r =.75, P <.1). 4
5 Leaf N concentration (µg g -1 f.w.) Leaf N concentration (µg g -1 f.w.) Control WT Control hns2-suppressed. halleri hns2-rni lines + 1 µm Zn 2+ WT Control hns2-suppressed. halleri hns2-rni lines Supplemental Figure 5. N concentration in leaves of. halleri wild-type and hns2-rni plants. N was quantified in leaves of. halleri wild-type (Langelsheim) plants, the two control transformants, and the three hns2- suppressed lines grown hydroponically either in control medium () or in medium with extra 1 µm Zn 2+ () after Fmoc-derivatization via UPLC-ESI-QTOF-MS and stable isotope dilution analysis. Shown are means ± SD of three independent experiments (three replicate clones per genotype were pooled for each data point). Statistical significances were determined using one-way analysis of variance followed by a Tukey test. sterisks denote significant differences compared to the wild-type mean, P <.5. 5
6 C Root Zn concentration (µg g -1 d.w.) Shoot Zn concentration (µg g -1 d.w.) Zn concentration shoot/root ratio WT Control hns2-suppressed. halleri hns2-rni lines WT Control hns2-suppressed. halleri hns2-rni lines WT Control hns2-suppressed. halleri hns2-rni lines Supplemental Figure 6. Zn concentrations in roots and leaves of. halleri wild-type and hns2-rni plants grown in control medium. Zn accumulation was determined in hydroponically grown. halleri wild-type (Langelsheim), the two control transformants, and the three hns2-rni lines cultivated in control medium (.77 µm ZnSO 4 ). Tissues were harvested after 5 weeks, digested and analyzed by ICP- OES. Shown in () and () are values for roots and leaves, respectively. For (C) shoot/root ratios of Zn concentrations were calculated from the data shown above. ll values are arithmetic means ± SD, n = 4 to 6 with 3 replicate clones of each genotype pooled per experiment. 6
7 Relative intensity (%) Relative intensity (%) Relative intensity (%) % % % [N +H] COOH N [GSH +H] + COOH N H [des γglu PC 2 +H] + COOH NH 2 m/z m/z m/z Supplemental Figure 7. HILIC-ESI-TOF-MS analysis of SEC low molecular weight Zn fractions. Low molecular weight Zn fractions revealed by SEC-ICP-MS analysis of hns2-rni line 1-2 roots (see Fig. 6, peak with retention time around s) were analyzed by HILIC-ESI-TOF-MS (positive mode). Spectra were recorded for samples collected from the SEC column. High ion counts for GSH (38.916; eluting after 2-3 min) were observed while N (34.159; eluting after about 18.6 min) only was present in trace amounts. Note that in lowmolecular weight Zn fractions obtained from wild-type plants a much stronger N signal was recorded (please compare N concentrations shown in Fig. 2). In addition, des-γglu-pc2 was identified by direct injection into the ESI-TOF- MS. n internal sample of N (Lee et al., 11) and a commercial sample of GSH were used for mass calibration and verification of elution time. 7
8 C Leaf Mn concentration (µg g -1 d.w.) Leaf Cu concentration (µg g -1 d.w.) Leaf Fe concentration (µg g -1 d.w.) No Zn contamination WT No Zn contamination WT No Zn contamination Intermediate Intermediate Supplemental Figure 8. Leaf Mn, Cu, and Fe concentrations of. halleri wildtype and hns2-rni plants grown in native. halleri soils. Elemental analysis was performed of wild-type (Langelsheim) plants (light yellow), the control transformant line -7 (dark yellow) and the three hns2-suppressed lines 1-2 (green), 7-12 (blue) and 11-1 (red) grown on three types of untreated soil collected at sites of native. halleri populations in the Harz Mountains in Germany with different soil Zn levels ranging from background levels of heavy metals to heavily Zn contaminated (for extractable and exchangeable Zn and Cd level of soils see Tab. 4). Leaf Mn (), Cu () and Fe (C) concentrations were analyzed by ICP-OES. Values are arithmetic means ± SD of n = 3 to 9 individual plants from three independent experiments. Intermediate WT Heavy Heavy Heavy 8
9 Supplemental Table 1. Sequences of primers used for transcript analysis by real-time RT-PCR. Name hns1-fw hns1-rev hns2-fw hns2-rev hns3-fw hns3-rev hns4-fw hns4-rev tns2-fw tns2-rev EF1α-fw EF1α-rev IRT1-fw IRT1-rev ZIP9-fw ZIP9-rev Sequence TGTCTTCCCCCGGCGTC CGCGTCTTTGGTCGGC CCTGTGTGTTCGCTG GCTTTGCCTTTGCTCTTTTCC TCTGTCCGCTCTCTCCGG TCTGTCCGTCCTTTTCCGG TGGCCTGGCGTTTCTCTTCCC CCGTCTTGGCCTTGG CTGCGCGTGGTTTTCGG TGCCTCGGCTCCTTTG TGGCCGCTCTTCTTGCTTTC GGTGGTGGCTCCTCTTGTTC CCCCGCTGTGTTCCTT GGTTCGCGGTTGTGCT CCTCCTCTCCCTCGGTGT CCCTGCGCCGCTT 9
Supporting Information
Supporting Information Lee et al. 10.1073/pnas.0910950106 Fig. S1. Fe (A), Zn (B), Cu (C), and Mn (D) concentrations in flag leaves from WT, osnas3-1, and OsNAS3-antisense (AN-2) plants. Each measurement
More informationA bts-1 (SALK_016526)
Electronic Supplementary Material (ESI) for Metallomics. This journal is The Royal Society of Chemistry 217 A ts-1 (SALK_16526) BTS (At3g1829) ATG tsl1 (SALK_1554) 2 p BTSL1 (At1g7477) ATG tsl2 (SAIL_615_HO1)
More informationSupplemental Data. Wang et al. (2013). Plant Cell /tpc
Supplemental Data. Wang et al. (2013). Plant Cell 10.1105/tpc.112.108993 Supplemental Figure 1. 3-MA Treatment Reduces the Growth of Seedlings. Two-week-old Nicotiana benthamiana seedlings germinated on
More informationAccumulation and transformation of inorganic and organic arsenic in rice and role of
Supplementary Information: Accumulation and transformation of inorganic and organic arsenic in rice and role of thiol-complexation to restrict their translocation to shoot Seema Mishra 1,2 *, Jürgen Mattusch
More information[ APPLICATION NOTE ] High Sensitivity Intact Monoclonal Antibody (mab) HRMS Quantification APPLICATION BENEFITS INTRODUCTION WATERS SOLUTIONS KEYWORDS
Yun Wang Alelyunas, Henry Shion, Mark Wrona Waters Corporation, Milford, MA, USA APPLICATION BENEFITS mab LC-MS method which enables users to achieve highly sensitive bioanalysis of intact trastuzumab
More informationSupplementary Figure 1. Gene expression analysis of GSNOR1 and NIA2 in genotypes with altered NO signalling. Relative expression of GSNOR1 in leaves
Supplementary Figure 1. Gene expression analysis of GSNOR1 and NIA2 in genotypes with altered NO signalling. Relative expression of GSNOR1 in leaves (a) and roots (b) and NIA2 in leaves (c) and roots (d)
More informationArsenate Exposure Affects Amino Acids, Mineral Nutrient Status and Antioxidant
1 Supporting Information 2 3 4 Arsenate Exposure Affects Amino ids, Mineral Nutrient Status and Antioxidant in Rice (Oryza sativa L.) Genotypes 5 6 7 8 9 1 11 12 13 14 15 16 17 18 19 2 S. Dwivedi, R.D.
More informationSupporting Information
Supporting Information Mass Spectrometry Imaging Shows Cocaine and Methylphenidate have Opposite Effects on Major Lipids in Drosophila Brain Mai H. Philipsen *, Nhu T. N. Phan *, John S. Fletcher *, Per
More informationElectronic Supporting Information
Electronic Supporting Information Detection of Hg 2+ by Cyanobacteria in Aqueous media. Moorthy Suresh, Sanjiv K. Mishra, Sandhya Mishra* and Amitava Das* Contents 1. Absorption spectrum of C-Phycocyanin
More informationTyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis
Supplementary information Tyrosine phosphorylation and protein degradation control the transcriptional activity of WRKY involved in benzylisoquinoline alkaloid biosynthesis Yasuyuki Yamada, Fumihiko Sato
More informationSupplementary Figures
Supplementary Figures 9 10 11 Supplementary Figure 1. Old plants are more resistant to insect herbivores than young plants. (a) Image of young (1-day-old, 1D) and old (-day-old, D) plants of Arabidopsis
More informationCloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation. Sarah J. MacDonald Assistant Professor Missouri Valley College
Cloning and Expression of a Bacterial CGTase and Impacts on Phytoremediation Sarah J. MacDonald Assistant Professor Missouri Valley College Phytoremediation of Organic Compounds Phytodegradation: Plants
More informationTREE ESSENTIAL ELEMENT. ZINC (Zn)
Pub. No. 17 April 2016 TREE ESSENTIAL ELEMENT ZINC (Zn) By Dr. Kim D. Coder, Professor of Tree Biology & Health Care Warnell School of Forestry & Natural Resources, University of Georgia Zinc (Zn) is a
More informationSupplemental Data. Müller-Xing et al. (2014). Plant Cell /tpc
Supplemental Figure 1. Phenotypes of iclf (clf-28 swn-7 CLF pro :CLF-GR) plants. A, Late rescue of iclf plants by renewed DEX treatment; senescent inflorescence with elongated siliques (arrow; 90 DAG,
More informationTable I: PHT1 transporter family comparison at the amino acid level. BLAST program was used to obtain percentage of similarity and identity (in bold).
Supplemental Tables Table I: PHT1 transporter family comparison at the amino acid level. BLAST program was used to obtain percentage of similarity and identity (in bold). PHT1;1 PHT1;2 PHT1;3 PHT1;4 PHT1;5
More informationSupporting Information. Lysine Propionylation to Boost Proteome Sequence. Coverage and Enable a Silent SILAC Strategy for
Supporting Information Lysine Propionylation to Boost Proteome Sequence Coverage and Enable a Silent SILAC Strategy for Relative Protein Quantification Christoph U. Schräder 1, Shaun Moore 1,2, Aaron A.
More informationMetal swap between Zn 7 metallothionein 3 and amyloid β Cu protects against amyloid β toxicity
Metal swap between Zn 7 metallothionein 3 and amyloid β Cu protects against amyloid β toxicity Supplementary Information Gabriele Meloni 1, Vanessa Sonois 2,3, Tamara Delaine 2, Luc Guilloreau 2, Audrey
More informationA -GLS Arabidopsis Cuscuta gronovii
-GLS Arabidopsis Cuscuta gronovii internal standard 4MS Wildtype Arabidopsis Cuscuta gronovii base Cuscuta gronovii apex 3MSP internal standard MSP 4MT 8MSO 4MO 1MO Figure S1. Representative HPLC-DAD chromatograms
More informationNote: The use of different equipment configurations (standard, XI, PlasmaScreen...) will treat different experiment Other services ICP- MS
Prices in Euros. 2018 Concepto USE OPI EXT./PRIV Multielemental and isotopic analysis by ICP MS ª Sample Preparation Acid digestion. For every 10 samples or fraction 387,66 488,47 586,16 Filtering. For
More informationLipidomic Analysis by UPLC-QTOF MS
Lipidomic Analysis by UPLC-QTOF MS Version: 1 Edited by: Oliver Fiehn Summary Reagents and Materials Protocol Summary:Lipidomic analysis by UPLC-QTOF mass spectrometry Reagents and Materials: Reagent/Material
More informationSupplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein
Supplementary Figure 1. AdipoR1 silencing and overexpression controls. (a) Representative blots (upper and lower panels) showing the AdipoR1 protein content relative to GAPDH in two independent experiments.
More informationCharacterization of the DNA-mediated Oxidation of Dps, a Bacterial Ferritin
SUPPORTING INFORMATION Characterization of the DNA-mediated Oxidation of Dps, a Bacterial Ferritin Anna R. Arnold, Andy Zhou, and Jacqueline K. Barton Division of Chemistry and Chemical Engineering, California
More informationSupporting Information for. revealed defense and detoxification mechanism of. cucumber plant under nano-cu stress
Supporting Information for 1 H NMR and GC-MS based metabolomics revealed defense and detoxification mechanism of cucumber plant under nano-cu stress Lijuan Zhao, Yuxiong Huang, Jerry Hu, ǂ Hongjun Zhou,
More informationMASS SPECTROMETRY BASED METABOLOMICS. Pavel Aronov. ABRF2010 Metabolomics Research Group March 21, 2010
MASS SPECTROMETRY BASED METABOLOMICS Pavel Aronov ABRF2010 Metabolomics Research Group March 21, 2010 Types of Experiments in Metabolomics targeted non targeted Number of analyzed metabolites is limited
More informationZinc Deficiency-Inducible OsZIP8 Encodes a Plasma Membrane-Localized Zinc Transporter in Rice
Mol. Cells 29, 551-558, June 30, 2010 DOI/10.1007/s10059-010-0069-0 Molecules and Cells 2010 KSMCB Zinc Deficiency-Inducible OsZIP8 Encodes a Plasma Membrane-Localized Zinc Transporter in Rice Sichul Lee
More informationSupplemental Information. Figures. Figure S1
Supplemental Information Figures Figure S1 Identification of JAGGER T-DNA insertions. A. Positions of T-DNA and Ds insertions in JAGGER are indicated by inverted triangles, the grey box represents the
More informationHigh-sensitivity Orbitrap mass analysis of intact macromolecular assemblies. R. J. Rose, E. Damoc, E. Denisov, A. Makarov, A. J. R.
High-sensitivity Orbitrap mass analysis of intact macromolecular assemblies R. J. Rose, E. Damoc, E. Denisov, A. Makarov, A. J. R. Heck SUPPLEMENTARY INFORMATION HCD multipole C -trap Transport octapole
More informationPhosphorylated glycosphingolipids essential for cholesterol mobilization in C. elegans
SUPPLEMENTARY INFORMATION Phosphorylated glycosphingolipids essential for cholesterol mobilization in C. elegans Sebastian Boland, Ulrike Schmidt, Vyacheslav Zagoriy, Julio L. Sampaio, Raphael Fritsche,
More informationKeywords: hydroponic, media, soilless culture, zeolite
EXPLORING THE POSSIBILITY OF USING A ZEOPONIC-BASED MEDIUM FOR NUTRIENT MANAGEMENT OF GREENHOUSE TOMATOES 1 Richard G. Snyder, Boyett Graves, and Arthur Bufogle Mississippi State University P.O. Box 231,
More informationSUPPLEMENTARY DATA. Materials and Methods
SUPPLEMENTARY DATA Materials and Methods HPLC-UV of phospholipid classes and HETE isomer determination. Fractionation of platelet lipid classes was undertaken on a Spherisorb S5W 150 x 4.6 mm column (Waters
More informationSupporting information
Supporting information Rhabdopeptide/Xenortide-like Peptides from Xenorhabdus innexi with Terminal Amines Showing Potent Anti-protozoal Activity Lei Zhao,, Marcel Kaiser,, Helge B. Bode *,, Molekulare
More informationCadmium tolerance and hyperaccumulation in a new Zn-hyperaccumulating plant species (Sedum alfredii Hance)
Plant and Soil 259: 181 189, 2004. 2004 Kluwer Academic Publishers. Printed in the Netherlands. 181 Cadmium tolerance and hyperaccumulation in a new Zn-hyperaccumulating plant species (Sedum alfredii Hance)
More informationEVALUATION OF THE PERFORMANCE OF HUMIC ACID PRODUCTS IN TURFGRASS MANAGEMENT. K. Carey and E. Gunn
EVALUATION OF THE PERFORMANCE OF HUMIC ACID PRODUCTS IN TURFGRASS MANAGEMENT K. Carey and E. Gunn Guelph Turfgrass Institute and Dept. of Plant Agriculture, Horticulture Division Sponsor:Luscar Ltd. OBJECTIVE
More informationZinc isotopes in the Seine River water, France: a probe of. anthropogenic contamination
Zinc isotopes in the Seine River water, France: a probe of anthropogenic contamination Jiubin Chen*, Jérôme Gaillardet and Pascale Louvat Equipe Géochimie et Cosmochimie, Institut de Physique du Globe
More informationJ. A. Mayfield et al. FIGURE S1. Methionine Salvage. Methylthioadenosine. Methionine. AdoMet. Folate Biosynthesis. Methylation SAH.
FIGURE S1 Methionine Salvage Methionine Methylthioadenosine AdoMet Folate Biosynthesis Methylation SAH Homocysteine Homocystine CBS Cystathionine Cysteine Glutathione Figure S1 Biochemical pathway of relevant
More informationSUPPLEMENTARY INFORMATION
DOI: 10.1038/ncb3311 A B TSC2 -/- MEFs C Rapa Hours WCL 0 6 12 24 36 pakt.s473 AKT ps6k S6K CM IGF-1 Recipient WCL - + - + - + pigf-1r IGF-1R pakt ps6 AKT D 1 st SILAC 2 nd SILAC E GAPDH FGF21 ALKPGVIQILGVK
More informationSupplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants
Supplementary Table 1. Properties of lysates of E. coli strains expressing CcLpxI point mutants Species UDP-2,3- diacylglucosamine hydrolase specific activity (nmol min -1 mg -1 ) Fold vectorcontrol specific
More informationLime Fertilizer Interactions Affecting Vegetable Crop Production' Delbert D. Hemphill, Jr., and T. L. ABSTRACT
109 Lime Fertilizer Interactions Affecting Vegetable Crop Production' Delbert D. Hemphill, Jr., and T. L. Jackson2 ABSTRACT Experiments at the North Willamette Experiment Station have evaluated response
More informationCitrus Greening Symposium Bartow, April 7, 2009
Leaf Nutritional Analysis of Symptomatic HLB Trees AW A.W. SchumannandTM and T.M. Spann Citrus Research and Education Center University of Florida Citrus Greening Symposium g y p Bartow, April 7, 2009
More informationIRON (Fe) PRESENTATION. Prepared by: Market Development Department Doktor Tarsa
IRON (Fe) PRESENTATION Prepared by: Market Development Department Doktor Tarsa Index Introduction Role of iron in plant What is chelate? Iron chelate products Trials Conclusion Introduction General Problems:
More informationOpen Flower. Juvenile leaf Flowerbud. Carpel 35 NA NA NA NA 61 NA 95 NA NA 15 NA 41 3 NA
PaxDB Root Juvenile leaf Flowerbud Open Flower Carpel Mature Pollen Silique Seed Sec3a Sec3b Sec5a Sec5b Sec6 Sec8 Sec10a/b Sec15a Sec15b Exo84a Exo84b Exo84c Exo70A1 Exo70A2 Exo70A3 49 47 8 75 104 79
More informationApplying a Novel Glycan Tagging Reagent, RapiFluor-MS, and an Integrated UPLC-FLR/QTof MS System for Low Abundant N-Glycan Analysis
Applying a Novel Glycan Tagging Reagent, RapiFluor-MS, and an Integrated UPLC-FLR/QTof MS System for Low Abundant N-Glycan Analysis Ying Qing Yu Waters Corporation, Milford, MA, USA APPLICATION BENEFITS
More informationCharacterisation of a Cu selective resin for use in the production of Cu isotopes
Characterisation of a Cu selective resin for use in the production of Cu isotopes Resin characterisation Selectivity Interferences with Ni or Zn Column Experiments Optimisation Simulated targets Decontamination
More informationA NOVEL METHOD OF M/Z DRIFT CORRECTION FOR OA-TOF MASS SPECTROMETERS BASED ON CONSTRUCTION OF LIBRARIES OF MATRIX COMPONENTS.
A NOVEL METHOD OF M/Z DRIFT CORRECTION FOR OA-TOF MASS SPECTROMETERS BASED ON CONSTRUCTION OF LIBRARIES OF MATRIX COMPONENTS. Martin R Green*, Keith Richardson, John Chipperfield, Nick Tomczyk, Martin
More informationSuppl. Table 1: CV of pooled lipoprotein fractions analysed by ESI-MS/MS
Supplement VLDL LDL HDL PC 3.3 1.77 1.3 LPC 4.82 2.5.35 SM 3.1 4.6 1.92 CER 2.17 6.3 4.15 PE 3.18 1.93 2.79 PE-pl 13.18 1.9 2.32 CE 2.9.65.4 FC.36 3.5 2.54 Suppl. Table 1: CV of pooled lipoprotein fractions
More informationManganese Toxicity in Avocado (Persea americana Mill.)
California Avocado Society 1991 Yearbook 75:147-158. Manganese Toxicity in Avocado (Persea americana Mill.) Jonathan Edward Tracy Candidate for degree of Master of Science in Soil Science from University
More informationGeneral Single Ion Calibration. Pete 14-May-09
General Single Ion Calibration Pete 14-May-09 Purpose of SI calibration Measure the instrument response of a single ion. Necessary for understanding of error in instrument (counting statistics) Calculation
More informationSupplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells
Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells (b). TRIM33 was immunoprecipitated, and the amount of
More informationSupplemental Data. Wu et al. (2010). Plant Cell /tpc
Supplemental Figure 1. FIM5 is preferentially expressed in stamen and mature pollen. The expression data of FIM5 was extracted from Arabidopsis efp browser (http://www.bar.utoronto.ca/efp/development/),
More informationIntroducing.. PIKA (Ochotona princeps)
Introducing.. PIKA (Ochotona princeps) Pikas are hearty little mammals who live in rock piles high in the mountains of western North America. PIKA, or Peak Integration by Key Analysis is a software tool
More informationMS/MS as an LC Detector for the Screening of Drugs and Their Metabolites in Race Horse Urine
Application Note: 346 MS/MS as an LC Detector for the Screening of Drugs and Their Metabolites in Race Horse Urine Gargi Choudhary and Diane Cho, Thermo Fisher Scientific, San Jose, CA Wayne Skinner and
More informationSupplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid.
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Supplementary Figure 1. SC35M polymerase activity in the presence of Bat or SC35M NP encoded from the phw2000 rescue plasmid. HEK293T
More informationDetermination of N-Nitrososarcosine (NSAR) in tobacco
JTI-Ökolab Vienna, Austria Determination of N-Nitrososarcosine (NSAR) in tobacco Madeleine Werneth, Jutta Pani, Bernhard Mayer-Helm 2014 CORESTA CONGRESS - ST46 Québec City, Canada 12-16 October 2014 Background
More informationIon-exchange technique (IET) for measuring Cu 2+, Ni 2+ and Zn 2+ activities in soils contaminated with metal mixtures
, 14, 55 63 Supplementary material Ion-exchange technique (IET) for measuring Cu 2+, Ni 2+ and Zn 2+ activities in soils contaminated with metal mixtures D. M. Schwertfeger A,B and W. H. Hendershot A,C
More informationThe uptake of nutrients occurs at both the roots and the leaves.
CHAPTER 37: WHAT DO PLANTS NEED TO LIVE AND HOW DO THEY GET IT? Elemental Composition of Living Organisms WHAT ARE ORGANISMS MADE OF? Element Human Alfalfa Bacterium Carbon 19.37% 11.34% 12.14% Hydrogen
More informationNoora Perkola Finnish Environment Institute. Nordic MS Symposium November 9, 2011, Båstad, Sweden
Noora Perkola Finnish Environment Institute Nordic MS Symposium November 9, 2011, Båstad, Sweden Artificial Sweeteners Used as additives in various food products to replace sugar 4 non-caloric sweeteners
More informationBenefits and Characteristic Applications of High Resolution GC/MS and LC/MS. Frank David RIC and Ghent University
Benefits and Characteristic Applications of High Resolution GC/MS and LC/MS. Frank David RIC and Ghent University Mass Spectrometry Structure Elucidation Selective and Sensitive Detection Identification
More informationSupplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random
S1 Supplementary Figure 1 (previous page). EM analysis of full-length GCGR. (a) Exemplary tilt pair images of the GCGR mab23 complex acquired for Random Conical Tilt (RCT) reconstruction (left: -50,right:
More informationRapid Analysis of Water-Soluble Vitamins in Infant Formula by Standard-Addition
Rapid Analysis of Water-Soluble Vitamins in Infant Formula by Standard-Addition Evelyn Goh Waters Pacific, Singapore APPLICATION BENEFITS This method allows for the simultaneous analysis of 12 water-soluble
More informationYaraTera KRISTALON. Premium water soluble NPK fertilizer. Growth stage based formulas. Top grade Crop Nutrition
YaraTera KRISTALON Premium water soluble NPK fertilizer Top grade Crop Nutrition Growth stage based formulas YaraTera KRISTALON The best nutrient solutions is a growth stage based, fully water soluble
More informationReport for using aquatic plant as phytoremediation for removing heavy metals
Report for using aquatic plant as phytoremediation for removing heavy metals Vu Thi Dieu Huong (M2) 1. INTRODUCTION Charophytes are submerged macrophytes grown in wide range of water bodies and its existence
More informationAnalysis of Uncomplexed and Copper-complexed Methanobactin with UV/Visible Spectrophotometry, Mass Spectrometry and NMR Spectrometry
Analysis of Uncomplexed and Copper-complexed Methanobactin with UV/Visible Spectrophotometry, Mass Spectrometry and NMR Spectrometry Lee Behling, Alan DiSpirito, Scott Hartsel, Larry Masterson, Gianluigi
More informationSupporting Information
Supporting Information Harries et al. 1.173/pnas.9923916 A Fig. S1. Disruption of microfilaments within epidermal cells after treatment with 5 M Lat. Images of N. benthamiana cells are from plants expressing
More informationTHE EFFECT OF ENVIRONMENTAL POLLUTION, ACIDIC RAINS, ALUMINIUM CONTAINING PACKAGING ON THE GROWTH OF WHEAT
Analele Universităţii din Oradea, Fascicula Protecţia Mediului Vol. XXV, 2015 THE EFFECT OF ENVIRONMENTAL POLLUTION, ACIDIC RAINS, ALUMINIUM CONTAINING PACKAGING ON THE GROWTH OF WHEAT Szabó-Nagy Andrea*,
More informationSupplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS
Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS nucleotide sequences (a, b) or amino acid sequences (c) from
More informationDevelopment and Validation of an UPLC-MS/MS Method for Quantification of Mycotoxins in Tobacco and Smokeless Tobacco Products
Development and Validation of an UPLC-MS/MS Method for Quantification of Mycotoxins in Tobacco and Smokeless Tobacco Products Johan Lindholm, Anna Wiernik, Birgitta Grandin, Margareta Curvall Swedish Match
More informationSupplementary Figures
Supplementary Figures a miel1-2 (SALK_41369).1kb miel1-1 (SALK_978) b TUB MIEL1 Supplementary Figure 1. MIEL1 expression in miel1 mutant and S:MIEL1-MYC transgenic plants. (a) Mapping of the T-DNA insertion
More informationApplication Note # LCMS-89 High quantification efficiency in plasma targeted proteomics with a full-capability discovery Q-TOF platform
Application Note # LCMS-89 High quantification efficiency in plasma targeted proteomics with a full-capability discovery Q-TOF platform Abstract Targeted proteomics for biomarker verification/validation
More informationLarry Stein, Texas A & M AgriLife Extension Service. Nitrogen fertilization materials, rates and timing
Larry Stein, Texas A & M AgriLife Extension Service Nitrogen fertilization materials, rates and timing Nitrogen deficiency Fertilizers Not miracle products Nutrition is just one of the components of
More informationMeasuring Lipid Composition LC-MS/MS
Project: Measuring Lipid Composition LC-MS/MS Verification of expected lipid composition in nanomedical controlled release systems by liquid chromatography tandem mass spectrometry AUTHORED BY: DATE: Sven
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationHow to Use TOF and Q-TOF Mass Spectrometers
How to Use TOF and Q-TOF Mass Spectrometers October 2011 What do TOF and Q-TOF offer? TOF Fast scanning of full spectrum High resolution full scan spectra Accurate mass measurements Q-TOF Fast scanning
More informationSulfur fertilization influences the sulphur species composition in Allium sativum: sulfomics using HPLC-ICP-MS/MS-ESI-MS/MS
Electronic upplementary Material (EI) for Metallomics. This journal is The Royal ociety of Chemistry 2017 Electronic supplement for ulfur fertilization influences the sulphur species composition in Allium
More informationUltra High Definition Optimizing all Analytical Dimensions
Ultra High Definition Optimizing all Analytical Dimensions Sensitivity Dynamic Range Signal Response Linearity Separation Speed Peak Capacity Chromatogram Mass Spectrum Mass Accuracy Resolving Power Acquisition
More informationIron depletion enhances production of antimicrobials by Pseudomonas
Iron depletion enhances production of antimicrobials by Pseudomonas aeruginosa. Angela T. Nguyen 1, Jace W. Jones 1, Max A. Ruge 1, Maureen A. Kane 1, and Amanda G. Oglesby-Sherrouse 1,2 * University of
More informationABREU Cleide Aparecida de (1), BERTON Ronaldo Severiano (1), KOEKKOEK Edwin Peter Josef (2)
Scientific registration number: 2207 Symposium number: 25 Presentation : poster Validation of annual and total cumulative loading limits stipulated by USEPA for Zn on oxisol. Validation des apports-limites
More informationDetection of Low Level of Chloramphenicol in Milk and Honey with MIP SPE and LC-MS-MS
Detection of Low Level of Chloramphenicol in Milk and Honey with MIP SPE and LC-MS-MS Olga Shimelis, An Trinh, and Michael Ye Supelco, Div. of Sigma-Aldrich, Bellefonte, PA T407125 Introduction Molecularly
More informationUSERS GUIDE for the. report
USERS GUIDE for the report November, 2015 INTRODUCTION: AgVita has been conducting expresssoil analyses since the mid 1990 s, being a pioneer of this method of soil analysis in Australia. This test has
More informationAZOMITE and Coffee & Cacao
AZOMITE and Coffee & Cacao AZOMITE TESTING ON THE GROWTH OF COFFEE AND CACAO By : The Indonesian Center for Coffee and Cacao Research Report Summary Nutrients loss in coffee and cocoa farming system is
More informationBOTANY AND PLANT GROWTH Lesson 9: PLANT NUTRITION. MACRONUTRIENTS Found in air and water carbon C oxygen hydrogen
BOTANY AND PLANT GROWTH Lesson 9: PLANT NUTRITION Segment One Nutrient Listing Plants need 17 elements for normal growth. Carbon, oxygen, and hydrogen are found in air and water. Nitrogen, phosphorus,
More informationMike Hinds, Royal Canadian Mint
Experience in the Use of the LBMA Reference Materials Mike Hinds Royal Canadian Mint LBMA Assayer and Refiner March 2011 1 LBMA RM Project 2007-2010 2 Gold Reference Materials AuRM1 and AuRM2 Available
More informationEffects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion
Supplementary Figure S1. Effects of UBL5 knockdown on cell cycle distribution and sister chromatid cohesion A. Representative examples of flow cytometry profiles of HeLa cells transfected with indicated
More informationElemental Scientific. seafast S2. Elution Profiles. Elemental Scientific
Elemental Scientific seafast S2 seafast S2 TM Authors: Nathan Saetveit (nathan@icpms.com) Brief The seafast S2 is an automated sample introduction system for multi-mode determination of ultra-trace metals
More informationSupplementary Fig. S1. Schematic diagram of minigenome segments.
open reading frame 1565 (segment 5) 47 (-) 3 5 (+) 76 101 125 149 173 197 221 246 287 open reading frame 890 (segment 8) 60 (-) 3 5 (+) 172 Supplementary Fig. S1. Schematic diagram of minigenome segments.
More informationEffects of FGD-Gypsum, Used-Wallboard and Calcium Sulfate on Corn and Soybean Root Growth
World of Coal Ash (WOCA) Conference - May 9-12, 211, in Denver, CO, USA http://www.flyash.info/ Effects of FGD-Gypsum, Used-Walloard and Calcium Sulfate on Corn and Soyean Root Growth Eton E. Codling USDA-ARS
More informationComparison of mass spectrometers performances
Comparison of mass spectrometers performances Instrument Mass Mass Sensitivity resolution accuracy Quadrupole 1 x 10 3 0.1 Da* 0.5-1.0 pmol DE-MALDI 2 x 10 4 20 ppm 1-10 fmol peptide 1-5 pmol protein Ion
More informationSupporting Information for
Supporting Information for CuO Nanoparticle Interaction with Arabidopsis: Toxicity, Parent-Progeny Transfer and Gene Expression Zhenyu Wang,, Lina Xu, Jian Zhao,,, Xiangke Wang, Jason C. White, and Baoshan
More informationCRY2 binding to CIB1N w/ MTHF
Supplemental Figures: CRY2 binding to CIB1N w/ MTHF.36 Polarization.34.32.3.28 Blue.26 5 1 15 [Cry2] in nm Figure S1: Addition of MTHF does not significantly change CRY2- CIB1N binding. Direct fluorescence
More informationA Simple and Accurate Method for the Rapid Quantitation of Drugs of Abuse in Urine Using Liquid Chromatography
Application Note LCMS-109 A Simple and Accurate Method for the Rapid Quantitation of Drugs of Abuse in Urine Using Liquid Chromatography Time of Flight (LC-TOF) Mass Spectrometry Introduction Many clinical
More informationPerformance Characteristics of the Agilent High Matrix Sample Introduction (HMI) Accessory for the 7500 Series ICP-MS. Product Overview.
Performance Characteristics of the Agilent High Matrix Sample Introduction (HMI) Accessory for the 7500 Series ICP-MS Product Overview Introduction The determination of multiple trace elements in high-matrix
More informationTable S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples.
Supplementary files Table S1. Relative abundance of AGO1/4 proteins in different organs. Table S2. Summary of smrna datasets from various samples. Table S3. Specificity of AGO1- and AGO4-preferred 24-nt
More informationWater is the major constraint to crop production in many parts of the world.
Water is the major constraint to crop production in many parts of the world. To sustain crop production in water scarce environments, deficit irrigation (DI) is a suggestable irrigation practice. DI is
More informationElectronic Supplementary Information
Electronic Supplementary Material (ESI) for New Journal of Chemistry. This journal is The Royal Society of Chemistry and the Centre National de la Recherche Scientifique 2018 Electronic Supplementary Information
More informationImpact of Chromatography on Lipid Profiling of Liver Tissue Extracts
Impact of Chromatography on Lipid Profiling of Liver Tissue Extracts Application Note Clinical Research Authors Mark Sartain and Theodore Sana Agilent Technologies, Inc. Santa Clara, California, USA Introduction
More informationChemical Analysis Business Operations Waters Corporation Milford MA
The Detection and Identification of Unknown Contaminants During ToF Screening and Structural Elucidation for Pesticides in River Water Using an Integrated Software Approach Chemical Analysis Business Operations
More informationEGFR shrna A: CCGGCGCAAGTGTAAGAAGTGCGAACTCGAGTTCGCACTTCTTACACTTGCG TTTTTG. EGFR shrna B: CCGGAGAATGTGGAATACCTAAGGCTCGAGCCTTAGGTATTCCACATTCTCTT TTTG
Supplementary Methods Sequence of oligonucleotides used for shrna targeting EGFR EGFR shrna were obtained from the Harvard RNAi consortium. The following oligonucleotides (forward primer) were used to
More informationUptake and Metabolism of Phthalate Esters by Edible Plants
1 Supporting Information for 2 3 Uptake and Metabolism of Phthalate Esters by Edible Plants 4 Jianqiang Sun, Xiaoqin Wu, Jay Gan * 5 6 7 Department of Environmental Sciences, University of California,
More informationSupplemental Figure 1: Characterization of Toc159 co-suppression lines nts
Supplemental Data. ischof et al. Plant Cell (211)..1/tpc.111.92882 Supplemental Figure 1: Characterization of Toc19 co-suppression lines nts () Phenotype of rabiopsis plants co-suppressing attoc19. Images
More informationWhat You Can t See Can Hurt You. How MS/MS Specificity Can Bite Your Backside
What You Can t See Can Hurt You How MS/MS Specificity Can Bite Your Backside Johan van den Heever, Tom Thompson, and Don Noot Agri-Food Laboratories Branch Advances in Trace rganic Residue Analysis early
More informationPlant Food. Nitrogen (N)
Plant Food Nitrogen (N) Functions: Promote plant growth Increase protein content of crops Improves quality of crop Makes plant more efficient with water Helps for stay green and dry down Plants take up
More information