Animal Nutrition and Feed Technology (2010) 10 :

Transcription

1 Animal Nutrition and Feed Technology (2010) 10 : Effect of Fasciola gigantica Infection on Nutrient Utilization and Cytokine Gene Expression During Prepatent Period in Growing Crossbred (Bos taurus x Bos indicus) Cattle S.L. Ingale*, P. Singh, A.K. Verma and U.R. Mehra Centre for Advanced Faculty Training in Animal Nutrition, Indian Veterinary Research Institute, Izatnagr , India (Received September 23, 2009) ABSTRACT Ingale, S.L., Singh, P., Verma, A.K. and Mehra, U.R Effect of Fasciola gigantica infection on nutrient utilization and cytokine gene expression during prepatent period in growing crossbred (Bos taurus x Bos indicus) cattle. Animal Nutrition and Feed Technology, 10: A study was undertaken to investigate the nutrient utilization and cytokine gene expression as influenced by Fasciola gigantica infection in crossbred male cattle during prepatent period. Fifteen male (12 months age and 184.5±6.75 kg mean body wt) were randomly divided into three groups of five animals in each group following completely randomized design. Animals in groups I and II were fed with 100 percent, whereas, group III were fed with 75 % of NRC (1988) requirement. Animals in groups II and III were infected orally with a dose of 1000 metacercariae of F. gigantica, whereas, animals of group I served as uninfected control. Digestion cum metabolism trial of 8 days duration was conducted after 45 days post infection. The cytokine gene expression (IL-2 and IL-10) were analyzed 45 days post infection by using real-time reverse transcription polymerase chain reaction (RT-PCR) with the double stranded DNA-binding dye SYBR Green to know the T cell response during clinical phase of fasciolosis. Dry matter intake of group III was significantly (P<0.01) lower than groups I and II. Digestibility of ether extract of infected animals was significantly (P<0.05) lower than control whereas digestibility of other nutrients were not influenced due to F. gigantica infection. IL-10 was present in detectable levels in peripheral blood mononuclear cells (PBMCs) of infected animals, whereas in control animals IL-2 was not present in detectable levels. IL-2 was not present in detectable levels in PBMCs of both infected and control groups. It can be construed that nutrient utilization was hardly affected due to Fasciola gigantica infection during prepatent period and T cell response was Th2 type. Keywords : Crossbred calves, Fasciola gigantica, Prepatent period, Nutrient utilization, Cytokine expression. Reprint request: Dr. S.L. Ingale, slingale@gmail.com 177

2 Ingale et al. INTRODUCTION Feed intake and nutrient requirements have been recognized for long time as an important parameters for determining the efficiency of animal production. There are a numbers of internal and external factors that affect the production performance of animals, of which parasites and parasitism are major constraints to animal productivity throughout the world especially in tropical countries. Fasciolosis is an endoparasitic disease, also called as Liver Fluke Infestation commonly caused by three species of the liver flukes in India; Fasciola hepatica, Fasciola gigantica and Fasciola jaksoni. Of these three Fasciola species prevalent in India Fasciola gigantica has been the major cause of disease (Sharma et al., 1989). Hepatic fasciolosis is mainly of economic importance in sheep or cattle but other species may act as a reservoir of infection. It causes significant economic losses to livestock sector, estimated at US $2.4 billion in Asia and US$0.84 billion in Africa and the total world loss is at least US$3.2 billion per annum. The monetary losses are due to high mortality in infected flocks, persistently depressed growth, productivity and impaired reproduction in the infected animals (Kumar and Sharma, 1991; Yadav et al., 1999 and Mehra et al., 1999). Limited data of experimental F. gigantica infection in cattle revealed that the course of the disease differs in several respects (Hammond and Sewell, 1975; Yadav and Gupta, 1995). The ideal approach to control fasciolosis includes a portfolio of integrated strategies that are economically and environmentally sustainable. Adequate plane of nutrition is one of very basic aspect which modulates the nutritional status and health of the animals. The animals gradually recover with the subsequent increase in feed intake and body weight. The animals ultimately become apparently normal due to their normal immunocompetence mechanism. Modulating immunity of the animal to the infection by nutritional manipulation is one of the latest modus operandi in control and prevention of different infectious disease. Lack of data on nutrient utilization during Fasciola gigantica infestation in cattle prompted authors to undertake this study. MATERIAL AND METHODS Experimental animals and diets Fifteen male crossbred cattle (12 months age and 184.5± 6.75 kg mean body weight) were randomly divided into three groups following completely randomized design with five animals in each. All the animals were housed individually in well-ventilated calf pen under uniform management condition. Prior to the feeding trial, all the experimental calves were treated for ectoparasites with cypermethrin liquid spray. Animals in groups I and II were fed with 100 %; whereas, group III was fed with 75% of NRC (1988) requirement for maintenance on feed consisting of wheat straw and concentrate mixture. The ingredient and chemical composition of concentrate mixture used for experimental feeding is furnished in Table 1. Clean and fresh drinking water was provided ad libitum throughout experimental period. Institute Animal Ethics Committee guidelines meant for the use of experimental animals were followed strictly. 178

3 Nutrient utilization during fasciolosis Table 1. Ingredient and chemical composition (% DM basis) of feeds offered to cattle Attributes Concentrate mixture Wheat straw Physical composition (% as such basis) Crushed maize 35 - De-oiled soybean meal 32 - Wheat bran 30 - Mineral mixture 02 - Common salt 01 - Vitamin premix (g/100 kg) 25 - Chemical composition (% DM basis) Organic matter Crude protein Ether extract Crude fiber Neutral detergent fiber Acid detergent fiber Total ash Calcium Phosphorus Infection of animals All the animals in the group II and III were inoculated orally with single dose of 1000 Fasciola gigantica metacercariae through wheat flour capsule after 30 days of experimental feeding. Metacercariae were procured from Parasitology Division, Indian Veterinary Research Institute, Izatnagar, which were freshly collected from infected lymniad snail. Infection was monitored by faecal sample examination at weekly intervals throughout experimental period. Digestion cum metabolism trial Digestion cum metabolism trial of 8-days duration was conducted at 45 days post infection. The sample of faeces, urine, feed offered and feed residue were collected separately without mixing and feed intake was measured while animals were in metabolic cage. Chemical composition of feed offered and faecal samples was estimated (AOAC, 2000). The contents of neutral detergent fibre (NDF) and acid detergent fibre (ADF) were analyzed (Van Soest et al., 1991). The nitrogen content of feed, faeces and urine was determined by micro-kjeldahl method (AOAC, 2000). Cytokine profile analysis Blood was collected at 45 days post infection (PI), in heparinized vials and peripheral blood mononuclear cells (PBMCs) were isolated by histopaque gradient (Histopaque 1077, Sigma, USA). Total RNA was extracted from PBMCs using trizol reagent 179

4 Ingale et al. (Invitrogen, USA). The mrna was transcribed to cdna with Oligo dt primer and cdna amplified by real-time polymerase chain reaction to quantify mrna of IL-2, IL- 10 and β-actin using Mx3000 P system (Stratagene). Gene specific primers for amplification of bovine β-actin (227bp), FP-5' CGCACCACTGGCATTGTCAT 3', RP-5' TCCAAGGCGACGTAGCAGAG 3', IL-2 (181bp), FP-5 TTTTACGTGCCCAAGGTTAA 3, RP-5 CGTTTACTGTTGCATCATCA 3, and IL- 10 (218bp), FP-5 TGCTGGATGACTTTAAGGG 3, RP- 5 AGGGCAGAAAGCGATGACA3 were designed based on the sequence of these three genes available at gene bank sequence information. All RT-PCR reactions were set with this template cdna and three sets of primers using QuantiTect SYBR Green PCR master mix as per the manufactures (Qiagen, USA) instructions. A dissociation curve of each sample was analyzed in comparison to negative controls. Mean cycle threshold (Ct) values of duplicate test and control samples were used for statistical analysis using students t test. The dct values were calculated by subtracting the mean Ct values of β- actin gene from the respective cytokine, i.e. IL-2 and IL-10 mean Ct value. Statistical analysis Data were analyzed by the methods described by Snedecor and Cochran (1994). The data were subjected to analysis of variance (ANOVA) and when significant treatment effect was observed Duncan s multiple range tests was used to compare the means. RESULTS AND DISCUSSION Intake and digestibility of nutrients The intake and digestibility of various nutrients in different groups of crossbred calves is presented in Table 2. The intake of nutrients (g/d) was significantly (P<0.01) lower in group III than groups I and II during prepatent period. The significant (P<0.01) variation observed in the intake of nutrients among the groups was due to the feeding levels, and it maintained large difference in the nutritional status of animals between the treatment groups. Digestibility of DM, CP, NDF and ADF in the present study was not affected due to level of feed intake as well as Fasciola gigantica infection. This is in agreement with the findings of Mehra et al. (1999) in buffalo calves infected orally with dose of 1000 metacercariae of F. gigantica. Similar findings were also reported by Hawkins and Morris (1978) and Sykes et al. (1980) in sheep infected with F. hepatica. Digestibility of all these nutrients was numerically higher in group III, which was due to lower level of feeding as envisaged in experimental design. Digestibility of ether extract was significantly (P<0.05) lower in group III during prepatent period as compared to groups I and II, this might be due to damage of liver by migrating larvae and bile duct by matured flukes, which may have hampered lipid metabolism. Conversely, Mehra et al. (1999) reported profound increase in the digestibility of EE in infected group but hardly explain the finding. Increased EE digestibility may be attributed to compensation of energy requirement due to reduced feed intake. 180

5 Nutrient utilization during fasciolosis Table 2. Intake (g/d) and digestibility (%) of various nutrients in different groups Attributes Group I Group II Group III SEM Dry matter Intake a a b Digestibility Organic matter Intake a a b Digestibility b b a 0.73 Crude protein Intake a a b Digestibility Ether extract Intake a a b 4.71 Digestibility a ab b 1.38 Neutral detergent fiber Intake a a b Digestibility Acid detergent fiber Intake a ab b Digestibility a,b Values with different superscript in a row differ significantly *(P<0.05); **(P<0.01). Plane of nutrition The data pertaining to plane of nutrition of F. gigantica infected crossbred calves during metabolism trial is presented in Table 2.The mean body weights (kg) as well as (kg w0.75 ) of animals in the three groups were statistically similar during prepatent period (30 days PI). The DMI (g/d) of infected group III was significantly lower than control (Group I) and infected group II. The significantly lower intake of nutrients in-group III was due to the lower feeding level as envisaged in experimental design to provide 25% less nutrients. With respect to DCP and TDN intake, there was significant (P<0.05) difference in groups II and I compared to group III during prepatent period as plane of nutrition was higher in groups II and I. This indicates that there was no effect of F. gigantica infection on plane of nutrition during prepatent period of infection. Similar to present findings Mehra et al. (1999) reported that F. gigantica infection had no effect on intake of DM, CP and TDN during prepatent period of infection. Nitrogen balance Animals in all three groups were in positive nitrogen balance (Table 4) during prepatent period. The nitrogen balance of group III was significantly (P<0.01) lower than that of groups I and II. This variation was due to 25% lower level of feed in group 181

6 Ingale et al. Table 3. Plane of nutrition in crossbred cattle during prepatent period Attributes Group I Group II Group III SEM Body weight Kg NS Dry matter intake g/d** a a b g/kg W 0.75** a a b 2.67 Crude protein intake g/d** a a b g/kg W 0.75** 9.71 a 9.90 a 7.51 b 0.17 Digestible crude protein intake g/d** a a b g/kg W TDN intake g/d* a a b g/kg W 0.75** a a b 1.60 Nutritive value (%) of diet DCP TDN* b ab a 0.69 a,b Values with different superscript in a row differ significantly; *(P<0.05); **(P<0.01). III. Balance as percent of absorbed nitrogen was also significantly(p<0.05) lower in group III as compared to other two groups, however nitrogen balance as percent of intake was similar among three groups. Nitrogen balance in group I and group II was comparable, indicating that there was no effect of F. gigantica infection during prepatent period. The findings of present study are in agreement with Mehra et al. (1999). Cytokines (IL-2γ and IL-10) expression during fasciolosis The cytokine gene expression (IL-2 and IL-10) at 45 days post infection is presented in Fig. 1. The results in present study indicate that the T cell response of calves infected with F. gigantica was apparently Th2 type during prepatent infection irrespective of plane of nutrition. This was indicated by the presence of IL-10 in PBMC of the infected animals of both infected groups II (I-100) and III whereas an absence of IL-2 production in infected as well as control group during both phase of infection. This is in agreement with the findings of Waldvogel et al. (2004) in calves infected with F. hepatica, who also reported Th2 response indicated by expression of high amount of IL-4 but not INFγ mrna during early infection. Similar response was also reported by Clery et al. (1996) in cattle experimentally infected with F. hepatica. They suggested that non Th1 responses are important in the immunological mechanism that results in chronicity of F. hepatica in cattle. Molina (2005) also reported that T cell response during F. gigantica 182

7 Nutrient utilization during fasciolosis Table 4. Nitrogen metabolism during prepatent period Attributes Group I Group II Group III SEM (C-100) (I-100) (I-75) N balance (g/d) Intake** a a b 4.74 Faecal losses** a a b 2.11 Urinary losses* a a b 1.97 Balance** a a b 1.44 Balance as % of intake Balance as % of absorbed* a a b 2.38 a,b Values with different superscript in a row differ significantly; *(P<0.05); **(P<0.01). Fig. 1. IL-10 and IL-2 mrna expression 45 days PI Animal no 1-5: Control (C-100); Animal No. 6-10: Infected (I-100); Animal No : Infected (I-75) infection was Th2 and the production of Th2 cytokines like IL-6 in the serum of infected cattle during early phase of infection but absence of INF-γ during this period of infection. IL-10 is one of the cytokines produced by Th2 cells (Abbas et al., 1996; Cox et al., 2001) and it participates in the polarization of Th2 response, whereas IL-2 is one of the cytokine produced by Th1 cells and participates in the polarization of Th1 response (Abbas et al., 1996). Increased expression of IL-10 mrna in calves in the present study may have a role in the immunity of the host, as increased serum levels of IL-6 or IL- 8 in cattle, buffalo and human infected with F. gigantica or F. hepatica were observed (Khalil et al., 1999) and (Molina, 2005), but there is no published information regarding their role in the immunity against liver fluke infection. IL-6 and IL-8 have been shown to be involved in antibody dependent cell mediated cytotoxicity involving neutrophils (Goldsby et al., 2000). 183

8 Ingale et al. CONCLUSION Present finding suggest that nutrient utilization was not affected due to Fasciola gigantica infection during prepatent period and T cell response was Th2 type. ACKNOWLEDGEMENT Authors are thankful to Indian Council of Agriculture Research (ICAR), New Delhi for providing financial assistance for this research work. The first author is thankful to ICAR for providing Junior Research Fellowship. REFERENCES Abbas, A.K., Murphy, K.M. and Sher, A Functional diversity of helper T lymphocytes. Nature, 383: AOAC Official Methods of Analysis, 17 th ed. Association of Official Analytical Chemists, Washington, D.C. Balogun, T.F., Dim, N.I. and Olorunju, S.A.S Undecorticated cotton seed meal as a substitute for soybean meal for weaner and growing-finishing pig. Animal Feed Science and Technology, 30: Clery, D.G., Torgerson, P. and Mulcahy, G Immune responses of chronically infected adult cattle to Fasciola hepatica. Veterinary Parasitology, 62: Cox, F.E.G Concomitant infections, parasites and immune responses (a review). Parasitology, 122: S23-S38. Dukin, A.C., Blac, J.L. and James, R.C Nitrogen balance in relation to energy intake in male. British Journal of Nutrition, 55: Goldsby, R.A., Kindt, T.J., Osborne, B.A Kuby Immunology. W.H. Freeman and Company, New York. Hammond, J.A. and Sewell, M.M.H Experimental infection of cattle with Fasciola gigantica : Number of parasites recovered after varying period of infection. Tropical Animal Health and Production, 2: Hawkins, C.D. and Morris, R.S Depression of productivity in sheep infected with Fasciola hepatica. Veterinary Parasitology, 4: Khalil, S.S., Abou, S.S. and Rashwan, E.A Production of pro-inflammatory cytokines (GM-CSF, IL-8 and IL-6) by monocytes from fasciolosis patients. Journal of Egyptian Society of Parasitology, 20: Kumar, P. and Sharma, M.C Infertility in rural cows in relation to fasciolosis. Indian Journal of Animal Science, 47: Mehra, U.R., Dass, R.S., Verma, A.K., Sharma, R.L. and Yadav, S.C Effect of Fasciola gigantica infection on growth and nutrient utilization in buffalo calves. Veteinary Record,145: Molina E. C Serum interferon gamma and interleukins-6 and -8 during infection with Fasciola gigantica in cattle and buffaloes. Journal of Veterinary Science, 6: NRC Nutrient Requirements of Dairy Cattle. National Academy Press, Washington, D.C. Sharma, R.L., Dhar, D.N., Raina, O.K Studies on the prevalence and laboratory transmission of fasciolosis in animal in the Kashmir valley. British Veterinary Journal, 145:

9 Nutrient utilization during fasciolosis Snedecor, G.W. and Cochran, W.G Statistical Methods. 8 th ed. Iowa State University Press, Ames, Iowa, USA. Sykes, A.R., Coop, R.L. and Rushton, B Chronic subclinical fascoliasis in sheep: Effect on food intake, food utilization and blood constituents. Research in Veterinary Science, 28: Van Soest, P.J., Robertson, J.B. and Lewis, B.A Method of dietary fibre, neutral detergent fibre ad non-starch polysaccharide in relation to animal nutrition. Journal of Dairy Science, 74: Waldvogel, A.S., Lepage, M.F., Zakher, A., Reichel, M.P., Eicher, R. and Heussler,V.T Expression of interleukin-4, interleukin-4 splice variants and interferon-gamma mrna in calves experimentally infected with Fasciola hepatica. Veterinary Immunology and Immunopathology, 97: Yadav, S.C., Gupta, S.C Immunodiagnostic moieties in somatic and excretory/ secretory antigens of Fasciola gigantica. Indian Journal of Experimental Biology, 33: Yadav, S.C., Sharma, R.L., Kalicharan, A., Mehra, U.R., Dass, R.S., Verma, A.K Primary experimental infection of riverine buffaloes with Fasciola gigantica. Veterinary Parasitology, 82: