Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene. Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1

Similar documents
Nature Immunology doi: /ni Supplementary Figure 1. Raf-1 inhibition does not affect TLR4-induced type I IFN responses.

Supplementary Figure 1

Irf1 fold changes (D) 24h 48h. p-p65. t-p65. p-irf3. t-irf3. β-actin SKO TKO 100% 80% 60% 40% 20%

Intracellular MHC class II molecules promote TLR-triggered innate. immune responses by maintaining Btk activation

Cytosolic DNA-Mediated, STING-Dependent Pro-Inflammatory Gene Induction Necessitates

S1a S1b S1c. S1d. S1f S1g S1h SUPPLEMENTARY FIGURE 1. - si sc Il17rd Il17ra bp. rig/s IL-17RD (ng) -100 IL-17RD

Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk

Supplementary Fig. 1. GPRC5A post-transcriptionally down-regulates EGFR expression. (a) Plot of the changes in steady state mrna levels versus

FIG S1 Examination of eif4b expression after virus infection. (A) A549 cells

Supplementary Figure 1

RAW264.7 cells stably expressing control shrna (Con) or GSK3b-specific shrna (sh-

SUPPLEMENTARY INFORMATION

Supplemental Information

Supplementary Figure 1.TRIM33 binds β-catenin in the nucleus. a & b, Co-IP of endogenous TRIM33 with β-catenin in HT-29 cells (a) and HEK 293T cells

Stewart et al. CD36 ligands promote sterile inflammation through assembly of a TLR 4 and 6 heterodimer

SUPPLEMENTARY INFORMATION

Supplementary Information

Supplementary Information. Induction of p53-independent apoptosis by ectopic expression of HOXA5

condition. Left panel, the HCT-116 cells were lysed with RIPA buffer containing 0.1%

Deregulation of STING Signaling in Colorectal Carcinoma Constrains DNA Damage Responses and Correlates With Tumorigenesis

Plasma exposure levels from individual mice 4 hours post IP administration at the

Organisms have evolved multiple ways to detect and respond

T H E J O U R N A L O F C E L L B I O L O G Y

SUPPLEMENTARY INFORMATION

Supplementary Figure 1 Role of Raf-1 in TLR2-Dectin-1-mediated cytokine expression

Supplementary Figure 1:

Table S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY FIGURES AND TABLE

p47 negatively regulates IKK activation by inducing the lysosomal degradation of polyubiquitinated NEMO

Pro-apoptotic signalling through Toll-like receptor 3 involves TRIF-dependent

Supplementary Figure 1: si-craf but not si-braf sensitizes tumor cells to radiation.

Nature Immunology: doi: /ni Supplementary Figure 1. IC261 inhibits a virus-induced type I interferon response.

Tel: ; Fax: ;

SUPPLEMENTARY FIGURES

SUPPLEMENTARY INFORMATION. Supplementary Figures S1-S9. Supplementary Methods

Crucial role for human Toll-like receptor 4 in the development of contact allergy to nickel

Nature Immunology: doi: /ni Supplementary Figure 1. Production of cytokines and chemokines after vaginal HSV-2 infection.

Supplemental Figure 1

Integrin CD11b negatively regulates TLR-triggered inflammatory responses by. activating Syk and promoting MyD88 and TRIF degradation via cbl-b

Supplementary Figure 1 Induction of cellular senescence and isolation of exosome. a to c, Pre-senescent primary normal human diploid fibroblasts

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION

Cells and reagents. Synaptopodin knockdown (1) and dynamin knockdown (2)

Supplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression

Figure S1. Reduction in glomerular mir-146a levels correlate with progression to higher albuminuria in diabetic patients.

Reviewers' comments: Reviewer #1 (Remarks to the Author):

SUPPLEMENTARY INFORMATION

Nature Immunology doi: /ni.3268

MicroRNAs Modulate the Noncanonical NF- B Pathway by Regulating IKK Expression During Macrophage Differentiation

Tbk1-TKO! DN cells (%)! 15! 10!

(A) RT-PCR for components of the Shh/Gli pathway in normal fetus cell (MRC-5) and a

TRAF6 ubiquitinates TGFβ type I receptor to promote its cleavage and nuclear translocation in cancer

Andrea Hillesheim, Carolin Nordhoff, Yvonne Boergeling, Stephan Ludwig and Viktor Wixler *

Egr-1 regulates RTA transcription through a cooperative involvement of transcriptional regulators

Supplemental Figure 1. Western blot analysis indicated that MIF was detected in the fractions of

Involvement of FKBP6 in hepatitis C virus replication

(A) SW480, DLD1, RKO and HCT116 cells were treated with DMSO or XAV939 (5 µm)

Additional methods appearing in the supplement are described in the Experimental Procedures section of the manuscript.

Supplementary Materials for

Peli1 negatively regulates T-cell activation and prevents autoimmunity

Title of file for HTML: Supplementary Information Description: Supplementary Figures and Supplementary Table

NOD1 contributes to mouse host defense against Helicobacter pylori via induction of type I IFN and activation of the ISGF3 signaling pathway

NLRX1: 5 -GCTCCATGGCTTAGAGCATC-3 (forward) 5 -AACTCCTCCTCCGTCCTGAT-3 (reverse) β-actin

SUPPLEMENTAL FIGURE LEGENDS

SUPPLEMENTARY INFORMATION

Activation of Nrf2 by the dengue virus causes an increase in CLEC5A, which enhances TNF-α production by mononuclear phagocytes

ANGPTL2 increases bone metastasis of breast cancer cells through. Tetsuro Masuda, Motoyoshi Endo, Yutaka Yamamoto, Haruki Odagiri, Tsuyoshi

CONTRACTING ORGANIZATION: Boston University Medical Campus Boston, MA 02118

Supplementary information

Alcoholic hepatitis is a drug-induced disorder

supplementary information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

I. Paterniti, M. Campolo, M. Cordaro, D. Impellizzeri, R. Siracusa, R. Crupi, E. Esposito, and S. Cuzzocrea. University of Messina, Italy

Newly Recognized Components of the Innate Immune System

Gallic acid prevents isoproterenol-induced cardiac hypertrophy and fibrosis through regulation of JNK2 signaling and Smad3 binding activity

SD-1 SD-1: Cathepsin B levels in TNF treated hch

blood mononuclear cells were stained with AAD, annexin, CD3, CD4, CD25, LAP and specific

Supplementary Materials for

Supplementary Information

Supporting Information

GFP/Iba1/GFAP. Brain. Liver. Kidney. Lung. Hoechst/Iba1/TLR9!

Figure S1A. Blood glucose levels in mice after glucose injection

Supplementary Figure 1. Procedures for p38 activity imaging in living cells. (a) Schematic model of the p38 activity reporter. The reporter consists

INVESTIGATING THE ROLE OF IKKε. CANCER-ASSOCIATED NF-κB ACTIVITY. Mezher Adli. Chapel Hill 2007

Supplementary information. MARCH8 inhibits HIV-1 infection by reducing virion incorporation of envelope glycoproteins

The cytosolic exonuclease TREX1 inhibits the innate immune response to human immunodeficiency virus type 1

Atg5 flox/flox ; CAG-Cre, 19M brain heart lung. spleen stomach colon. Takamura_Fig. S1

(A) PCR primers (arrows) designed to distinguish wild type (P1+P2), targeted (P1+P2) and excised (P1+P3)14-

Supplementary Materials for

Supplementary Figure 1. The CagA-dependent wound healing or transwell migration of gastric cancer cell. AGS cells transfected with vector control or

Supplementary Material

Supplementary Figure 1. Prevalence of U539C and G540A nucleotide and E172K amino acid substitutions among H9N2 viruses. Full-length H9N2 NS

Supplementary Figure 1: STAT3 suppresses Kras-induced lung tumorigenesis

Intrinsic cellular defenses against virus infection

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

well for 2 h at rt. Each dot represents an individual mouse and bar is the mean ±

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

SUPPLEMENTARY INFORMATION

ISG15 sirna # Ctrl sirna+ifn+wt. Virus titer (Pfu/ml) hours post infection. d USP18 sirna #2 IFN

Transcription:

1 Supporting Information 2 3 4 Title: Cytosolic DNA-mediated, STING-dependent pro-inflammatory gene induction necessitates canonical NF-κB activation through TBK1 5 6 Authors: Abe et al. 7 8 9 Supporting Figure legends Fig. S1. STING ligands-mediated signaling response in MEFs. (A) Primary MEFs (1 1 x 1 5 cells/well) derived from wild-type (STING +/+ ) or STING-deficient mice 11 12 13 (STING -/- ) were stimulated with 1 µg /ml of canonical 3-5 cyclic-gmp-amp (cgamp) for the times indicated. The expression level of STING, IRF3 phosphorylated at Ser 396 (p-irf3), NFκB p65 phosphorylated at Ser 536 (p-nf-κbp65), NF-κBp65, 14 TBK1 phosphorylated at Ser 172 (p-tbk1), and β-actin was determined by 15 16 17 18 19 2 21 22 immunoblotting. (B) Nuclear translocation of NF-κBp65 is detected by cellular fractionation. STING +/+ and STING -/- MEFs were stimulated with1 µg /ml of dsdna9 for 3 h, and then cells were separated into cytosol and nuclear fractions. Each fraction was concentrated and subjected to immunoblotting with indicated antibodies. (C) STING +/+ and STING -/- MEFs were stimulated with 1 µg /ml of dsdna9, 5 µg /ml of Poly(dA:dT), 5 µg /ml of Poly(I:C), or 2 µm of DMXAA for 6 h, and then total RNA was extracted from these cells, and the expression level of mrna of IFNβ, Ccl5, IL-6 and CXCL1 was determined by qrt-pcr. Data were normalized to

23 24 25 26 27 28 the levels of GAPDH mrna. Error bars indicate the standard deviations (SD). Fig. S2. HSV-1-mediated signaling response in MEFs. (A) Primary MEFs (1 x 1 5 cells/well) derived from wild-type (STING +/+ ) or STING-deficient mice (STING -/- ) were stimulated with 5 µg /ml of dsdna representing the genomes of HSV-1 or purified HSV-1 at an moi of 1 PFU/ml for the times indicated. The expression level of STING, IRF3 phosphorylated at Ser 396 (p-irf3), NFκB p65 phosphorylated at Ser 536 29 3 (p-nf-κbp65), NF-κBp65, TBK1 phosphorylated at Ser 172 β-actin was determined by immunoblotting. (p-tbk1), TBK1, and 31 32 33 34 35 36 37 38 39 4 41 42 Fig. S3. TBK1 does not involve in the dsdna-mediated MAPKs activation. (A) TBK1 +/+ and TBK1 -/- MEFs were stimulated with 1 µg /ml of dsdna9, or 5 µg /ml of Poly(I:C) for the times indicated. The expression level of ERK1/2 phosphorylated at Thr 22 /Tyr 24 (p-erk1/2), ERK1/2, SAPK/JNK phosphorylated at Thr 183 /Tyr 185 (p-sapk/jnk), JNK1/2, p38 phosphorylated at Thr 18 /Tyr 182 (p-p38), p38, and c-jun phosphorylated at Ser 63 (p-cjun) was determined by immunoblotting. (B) 293T cells were transfected with empty vector (EV) and Flag-tagged TBK1 (TBK1-FL) for 24 h, and then cell extracts were subjected to immunoblotting with indiacted antibodies. Fig. S4. IKKi/IKKε and NIK does not involve in the STING-dependent, dsdna-mediated signaling response in MEFs. RNAi in MEFs using the non-specific (NS) and IKKi/IKKε (Α) or NIK (B) were stimulated with 5 µg /ml of dsdna9 for the times indicated. The expression level of STING, IRF3 phosphorylated at Ser 396 43 (p-irf3), NFκB p65 phosphorylated at Ser 536 (p-nf-κbp65), NF-κBp65, TBK1 44 phosphorylated at Ser 172 (p-tbk1), TBK1, NF-κBp52, NF-κBp1 phosphorylated at

45 46 47 48 49 5 Ser 866/87 (p-nf-κbp1), and β-actin was determined by immunoblotting. (C) RNAi in MEFs using the non-specific (NS) and IKKi/IKKε (upper panels) or NIK (lower panels) were stimulated with 5 µg /ml of dsdna9 for 6 h, and then total RNA was extracted from these cells, and the expression level of mrna of IL-6, CXCL1, and IKKi/IKKε or NIK were determined by real-time PCR, respectively. Real-time PCR data were normalized to the amount of GAPDH mrna.

Abe et al Supporting Fig.1! A.! STING +/+! STING -/-! 1 3 6 9 1 3 6 9 (hr)! cgamp (canonical)! B.! Cytoplasm! Nuclear! STING +/+ -/- +/+ -/-! dsdna9 + + + +! RFC1! (nuclear)! ΙκBα (cytoplasm) C.! 1 5 CXCL1! 4 3 2 1 Ccl5! 4 3 2 1 IL-6! 15 1 5 IFNβ STING +/+! STING -/-! dsdna9 +! Poly(dA:dT) +! Poly(I:C) +! DMXAA +! dsdna9 +! Poly(dA:dT) +! Poly(I:C) +! DMXAA +!

Abe et al Supporting Fig.2! STING +/+! STING -/-! 1 3 6 9 1 3 6 9 (hr)! HSV-1 (virion)! STING +/+! STING -/-! 1 3 6 9 1 3 6 9 (hr)! HSV-1 (dsdna)!

Abe et al Supporting Fig.3! A.! p-cjun! TBK1 +/+! TBK1 -/-! 3 6 9 3 6 9 (hr)! TBK1 +/+! TBK1 -/-! 3 6 9 3 6 9 (hr)! p-sapk/! p-erk1/2! ERK1/2! p-p38! p38! dsdna9! Poly(I:C)! B.! EV +! TBK1-FL +! NF-κΒ p65! p-ikkαβ IκΒα Flag! EV +! TBK1-FL +! p-sapk! p-erk1/2! ERK1/2! p-p38 p38 β actin!

Abe et al Supporting Fig.4! A.! RNAi NS! RNAi IKKi! B.! 1 3 6 1 3 6 (hr)! p-nf-κβ2p1! RNAi NS! RNAi NIK! 1 3 6 1 3 6 (hr)! dsdna9! NF-κΒ2p52! C.! 2 1 IKKi mrna! * 4 3 2 1 IL-6 mrna! 4 3 2 1 dsdna9! CXCL1 mrna! 6 4 2 RNAi-NS IKKi! NIK mrna! * 5 4 3 2 1 RNAi-NS IKKi! IL-6 mrna! RNAi-NS IKKi! CXCL1 mrna! RNAi-NS NIK! RNAi-NS NIK! RNAi-NS NIK! 3 2 1 mock! dsdna9!

2024 © healthdocbox.com Privacy Policy | Terms of Service | Feedback